MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-141I16
Chromosome	4 (Build37)
Map Location	152,345,557 - 152,345,765
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dnajc11, Thap3, Phf13, Klhl21, Zbtb48, Tas1r1, Nol9, EG666980, Plekhg5, Tnfrsf25, Espn, LOC100043284, Hes2, Acot7, Gpr153, Hes3, Icmt, Rnf207, Rpl22, Chd5, Kcnab2, LOC100042028, Nphp4, LOC667039, Gm833
Downstream gene	LOC100042089, Ajap1, BC039966, A430005L14Rik, Dffb
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dnajc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230935 MGI:2443386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69876 MGI:1917126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230936 MGI:2446217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242785 MGI:1919288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100090 MGI:2140248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tas1r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110326 MGI:1927505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74035 MGI:1921285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666980 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666980 MGI:3644369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Plekhg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269608 MGI:2652860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:85030 MGI:1934667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Espn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 6 mRNAs

name	LOC100043284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Hes2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15206 MGI:1098624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70025 MGI:1917275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr153 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100129 MGI:1916157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hes3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15207 MGI:104877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Icmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57295 MGI:1888594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433809 MGI:2684989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19934 MGI:99262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269610 MGI:3036258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16498 MGI:109239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042028 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Nphp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260305 MGI:2384210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	Gm833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330004 MGI:2685679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ajap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230959 MGI:2685419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	BC039966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	A430005L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97159 MGI:2140680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dffb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13368 MGI:1196287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353982 GeneID:230935 MGI:2443386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 11 transcript_id : NM_172704.2

name	Thap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380266 GeneID:69876 MGI:1917126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing, apoptosis associated protein 3 transcript_id : NM_175152.3

name	Phf13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789396 GeneID:230936 MGI:2446217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 13 transcript_id : NM_172705.1

name	Klhl21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375454 GeneID:242785 MGI:1919288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 21 (Drosophila) transcript_id : NM_001033352.2

name	Zbtb48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366000 GeneID:100090 MGI:2140248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 48 transcript_id : NM_133879.2

name	Tas1r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994191 GeneID:110326 MGI:1927505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taste receptor, type 1, member 1 transcript_id : NM_031867.1

name	Nol9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311970 GeneID:74035 MGI:1921285
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 9 transcript_id : NM_028727.1

name	EG666980 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372797 GeneID:666980 MGI:3644369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666980 transcript_id : XM_987409.1

name	Plekhg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131086 GeneID:269608 MGI:2652860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 5 transcript_id : NM_001004156.2

name	Tnfrsf25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145578 GeneID:85030 MGI:1934667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 25 transcript_id : NM_033042.3

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494241 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_207687.2

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494245 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_207690.2

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494244 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_207689.2

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494242 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_207691.2

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494240 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_207688.2

name	Espn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494246 GeneID:56226 MGI:1861630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : espin transcript_id : NM_019585.3

name	Hes2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385755 GeneID:15206 MGI:1098624
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 2 (Drosophila) transcript_id : NM_008236.3

name	Acot7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19923051 GeneID:70025 MGI:1917275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 7 transcript_id : NM_133348.1

name	Gpr153 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130589 GeneID:100129 MGI:1916157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 153 transcript_id : NM_178406.2

name	Hes3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802621 GeneID:15207 MGI:104877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hairy and enhancer of split 3 (Drosophila) transcript_id : NM_008237.3

name	Icmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51317396 GeneID:57295 MGI:1888594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isoprenylcysteine carboxyl methyltransferase transcript_id : NM_133788.1

name	Rnf207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702020 GeneID:433809 MGI:2684989
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 207 transcript_id : NM_001033489.1

name	Rpl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543603 GeneID:19934 MGI:99262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L22 transcript_id : NM_009079.2

name	Chd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487024 GeneID:269610 MGI:3036258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 5 transcript_id : NM_001081376.1

name	Kcnab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543029 GeneID:16498 MGI:109239
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, beta member 2 transcript_id : NM_010598.2

name	LOC100042028 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253333 GeneID:100042028
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042028 transcript_id : XM_001477428.1

name	Nphp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244072 GeneID:260305 MGI:2384210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nephronophthisis 4 (juvenile) homolog (human) transcript_id : NM_153424.2

name	Gm833 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353827 GeneID:330004 MGI:2685679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 833, (NCBI) transcript_id : NM_001033414.2

name	Ajap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372801 GeneID:230959 MGI:2685419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : adherens junction associated protein 1, transcript variant 1 transcript_id : XM_485506.4

name	BC039966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253335 GeneID:407793 MGI:3039570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : cDNA sequence BC039966 transcript_id : XM_001477621.1

name	A430005L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802941 GeneID:97159 MGI:2140680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430005L14 gene transcript_id : NM_175287.3

name	Dffb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802948 GeneID:13368 MGI:1196287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA fragmentation factor, beta subunit transcript_id : NM_007859.3

name	Dnajc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370020 CCDS:CCDS18981.1 GeneID:230935 MGI:2443386
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily C, member 11 protein_id : NP_766292.1

name	Thap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424746 CCDS:CCDS18982.1 GeneID:69876 MGI:1917126
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : snoRNA MBI-15 product : THAP domain containing, apoptosis associated protein 3 protein_id : NP_780361.1

name	Phf13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789397 GeneID:230936 MGI:2446217
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PHD zinc finger protein PHF5 product : PHD finger protein 13 protein_id : NP_766293.1

name	Klhl21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781692 CCDS:CCDS18983.1 GeneID:242785 MGI:1919288
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 21 protein_id : NP_001028524.1

name	Zbtb48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126366001 GeneID:100090 MGI:2140248
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : GLI-Krueppel family member HKR3 product : GLI-Kruppel family member HKR3 protein_id : NP_598640.2

name	Tas1r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994192 CCDS:CCDS18985.1 GeneID:110326 MGI:1927505
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : candidate taste receptor T1R1; G protein-coupled receptor 70 product : sweet taste receptor T1r protein_id : NP_114073.1

name	Nol9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311971 CCDS:CCDS18986.1 GeneID:74035 MGI:1921285
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleolar protein 9 protein_id : NP_083003.1

name	EG666980 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372798 GeneID:666980 MGI:3644369
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992503.1

name	Plekhg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921315 CCDS:CCDS18987.1 GeneID:269608 MGI:2652860
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : RhoA-specific guanine exchange factor SYX1; RhoA-specific guanine exchange factor SYX2 product : neuronal RhoA GEF protein protein_id : NP_001004156.1

name	Tnfrsf25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145579 GeneID:85030 MGI:1934667
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : tumor necrosis factor receptor superfamily, member 12 product : tumor necrosis factor receptor superfamily, member 25 protein_id : NP_149031.2

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877082 CCDS:CCDS18989.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; jerker; actin cytoskeletal regulatory protein product : espin isoform 1 protein_id : NP_997570.1

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877090 CCDS:CCDS18992.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; jerker; actin cytoskeletal regulatory protein product : espin isoform 5 protein_id : NP_997573.1

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877088 CCDS:CCDS18991.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; jerker; actin cytoskeletal regulatory protein product : espin isoform 4 protein_id : NP_997572.1

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111494243 CCDS:CCDS18993.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; jerker; actin cytoskeletal regulatory protein product : espin isoform 3 protein_id : NP_997574.2

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877086 CCDS:CCDS18990.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; jerker; actin cytoskeletal regulatory protein product : espin isoform 2 protein_id : NP_997571.1

name	Espn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877084 CCDS:CCDS18994.1 GeneID:56226 MGI:1861630
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS] [Evidence IDA]; GO:0005903 - brush border [Evidence ISS] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0031941 - filamentous actin [Evidence ISS]; GO:0005902 - microvillus [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence ISS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051639 - actin filament network formation [Evidence NAS]; GO:0051494 - negative regulation of cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030046 - parallel actin filament bundle formation [Evidence IDA] codon_start : 1 note : isoform 6 is encoded by transcript variant 6; jerker; actin cytoskeletal regulatory protein product : espin isoform 6 protein_id : NP_062531.2

name	Hes2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098067 CCDS:CCDS18995.1 GeneID:15206 MGI:1098624
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hairy and enhancer of split 2 protein_id : NP_032262.2

name	Acot7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923052 GeneID:70025 MGI:1917275
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IDA] GO_process : GO:0009062 - fatty acid catabolism [Evidence IDA] codon_start : 1 note : acyl-CoA hydrolase; brain acyl-CoA hydrolase; 50-kDa brain acyl-CoA hydrolase product : acyl-CoA thioesterase 7 protein_id : NP_579926.1

name	Gpr153 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859807 CCDS:CCDS18996.1 GeneID:100129 MGI:1916157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor PGR1 product : G protein-coupled receptor 153 protein_id : NP_848493.1

name	Hes3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657919 CCDS:CCDS18997.1 GeneID:15207 MGI:104877
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hairy and enhancer of split 3 protein_id : NP_032263.2

name	Icmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317397 CCDS:CCDS18998.1 GeneID:57295 MGI:1888594
definition	EC_number : 2.1.1.100 GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004671 - protein-S-isoprenylcysteine O-methyltransferase activity [Evidence IMP] GO_process : GO:0006481 - C-terminal protein amino acid methylation [Evidence IEA] [Evidence ISS]; GO:0008104 - protein localization [Evidence IMP] codon_start : 1 note : prenylcysteine carboxyl methyltransferase; prenylated protein carboxyl methyltransferase; protein-S isoprenylcysteine O-methyltransferase product : isoprenylcysteine carboxyl methyltransferase protein_id : NP_598549.1

name	Rnf207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702021 GeneID:433809 MGI:2684989
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ring finger protein 207 protein_id : NP_001028661.1

name	Rpl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677775 CCDS:CCDS18999.1 GeneID:19934 MGI:99262
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008201 - heparin binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L22 protein_id : NP_033105.1

name	Chd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487025 GeneID:269610 MGI:3036258
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : chromodomain helicase DNA binding protein 5 protein_id : NP_001074845.1

name	Kcnab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543030 CCDS:CCDS19000.1 GeneID:16498 MGI:109239
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage gated channel, shaker related subfamily, beta member 2 product : potassium voltage-gated channel, shaker-related subfamily, beta member 2 protein_id : NP_034728.2

name	LOC100042028 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253334 GeneID:100042028
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477478.1

name	Nphp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244073 GeneID:260305 MGI:2384210
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0016337 - cell-cell adhesion [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS]; GO:0007632 - visual behavior [Evidence ISS] codon_start : 1 note : nephroretinin product : nephrocystin 4 protein_id : NP_700473.2

name	Gm833 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701915 GeneID:330004 MGI:2685679
definition	codon_start : 1 product : hypothetical protein LOC330004 protein_id : NP_001028586.1

name	Ajap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895973 GeneID:230959 MGI:2685419
definition	codon_start : 1 product : adherens junction associated protein 1 isoform 1 protein_id : XP_485506.3

name	BC039966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253336 GeneID:407793 MGI:3039570
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477671.1

name	A430005L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424952 CCDS:CCDS19003.1 GeneID:97159 MGI:2140680
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC97159 protein_id : NP_780496.1

name	Dffb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542553 CCDS:CCDS19004.1 GeneID:13368 MGI:1196287
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004516 - nicotinate phosphoribosyltransferase activity [Evidence IDA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : DNase inhibited by DNA fragmentation factor; DNA fragmentation factor, 40 kD, beta subunit; caspase-activated DNase product : DNA fragmentation factor, beta subunit protein_id : NP_031885.2

name	LOC667039 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667039
definition	number : 1 pseudo : _no_value

name	LOC100042089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042089
definition	number : 1 pseudo : _no_value

name	LOC100042089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042089
definition	number : 2 pseudo : _no_value

name	LOC100043284 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253361 GeneID:100043284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : hypothetical protein LOC100043284 pseudo : _no_value transcript_id : XR_034594.1

clone name	MSMg01-491P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-141I16.T7 (MSMg01no141_i16.b1)	MSMg01-141I16.TJ (MSMg01no141_i16.g1)
ACC	AG346387	AG346388
length	1,414	1,239
length of high quality (start - end)	209 (125 - 333)	262 (132 - 393)
definition	CHROMAT_FILE: MSMg01no141_i16.b1 PHD_FILE: MSMg01no141_i16.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:00:03 2005	CHROMAT_FILE: MSMg01no141_i16.g1 PHD_FILE: MSMg01no141_i16.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:00:03 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TCCCCCCCATTGGGCGCTAXXXXXXXXXXXXXXXXXXXXXXXCGCGGAAT TCACCCACAGAAGGATGCCCGTGAGAGCCTCAGNTGNNNACTGAGAAATC AAAAACCTCCCCTTTAAAACAGTGAGAGGAAATGCTTGACCTTTCGAGGA CAATTTTCCTCTCTCTCGTCAAGAGCCCGCTCCTTCCGCAGCTGTGCAGT CTCTCCCAGGGATCCCCTTCCATCCTGAGCCTGAGATATCTCCATCCCCA AGAAGTTCCCCTGCTTCTCCTTTTGTGCCCTGGCCTTTGCCTTGCTCACC TCCTGTCATGACACCTGCAGGGAGGTGGGAGTGGGGGGGGATCATTCTTT TAGCTAGAAGTGTACTCTGTCGACTGCCGCACCCAACGAATCGCTCCTGT CTTTTTTTTTTCTGAAAAAACCCCCCATTCCCTTCTTTACGCAGAAAGTT CCCCCCCCCAATTTTCTCTCCCCTACCCATGAACTATTCATTAGCGTTTC TCTTCCTCATAGTTCTGTTTCTTTTTTTATTTGTCCTTTTTGTTCTCATG ATCTACCTTCTCTTTCTCTCTTTTATTCTTGTAGCCCTCTATTCTATTTA CTATTCTGTTCCCCTCTTTCCTTTTTCCCTCTAATTCCCTCTCTCCCTCC TTCTCTCTATATATCTTATCCTTCTCTTCTCTCCTCCCTTCCCCACTCTC CTTATCTTTAACTTTCCCCTCTTTCCTTTCTCTTTTCATTCCTTCTTTTC CCTTCTTCCTTCCCTTTTTCCCCTCCTCTTCCTTCTCTGCCTTCATTTAT TCTCTACACTATCTTTTTTATCTTTATCCATATACCTTCTCTATACTCGC CCTCTCCCCCTTTTCTTCCAATCTTCTTTCCATCATTCCCTCCTCCCTCT CCTCCTGTTCTTTCTCTTTTCTTCTTCCCTCCTTTCTTCTTCCTCTCCTT TTTTCTTCTTCTCCACTCCTCCTCTCTTTTTCTTATTCTTCCTCATCCCC TCTTTTCTCTCTTATCCATCTCTTTCTCTTCTCTTCTTTTCTCTTTCTTT TCTCTACTTTTCTTCCCATCTTATTCCCCTTCCCTTCTTCTTTCTCTCTC TTCTTTCCTTCCTTTTTTTTCTTTTTCCTTCCTTCTCTACTTTTTCTCCA TCTTCTCTCCTTGTCTCTCTTCTTCTTTTTCCTTTCCTTTTTTACGTTTA TCCTTCATCTTCCTCTTCTTTTTTTCTCTCTATTTGTCATCCATCTTCTT CTCCCTTCTCCTCTTCATTTTCCTTTCTCTTCTTTATCATTNTTTATCTC TTACTTTCTTTCTATTTTTCACTCTTTTCTCCTGTATTGTGCTCCTCTAC TTCTTCTTCTTTACTCNTCTCTATGCAACATTCTCTCCTTCTCTTCTCCC ATTCTCTCTTCCCA	TTTTTTTAACATTGGAGCCTGGGGCGCCXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXCTCTAAAAGCTCCTATAGAGNCAGGNAAGGN ATTGGANTACCCTTTAAAAACCTTAAACCCCAGATGTGGCCTTGGAAAAT GGACACTCTTCCTAGAAAGGGTTTGCATTGTAAGCTCTGCACATCTGTAC TGGCTGGTATTGTGTGTCAACTTGACCCAAGCTGGAGTTATCACAGAGAA AGGAGCCTCCCTTGAGGAAATGCCTCCATGAGATCCAGCTGTAAGGCATT TTCTCAATTAGTGATCAAGGGGGAAAGGCCCATTGTGGGTGATGCCATTC CTGGGCTGGTAGTCTTGGGTTCTATAATAAAGCAAGCTGATCAAGCCAAT ATTTTTTTGCCAGTAAGGAACATCCCTCCATGGCCTCTGCATCAGCTCCT GCTTCCTGACCTGCTTGAGTTCCAGTCCTGACTTCCTTGGTGATGAACAG CAGTATGGAAGTGTAATCTGAATAAACCCTTTCCTCCCCAACTTGCTTCT TGGTCATGATGTTTGTGCAGGAATAGAAACCCTGACTAAAACAGCATCTT CTGTCACAGATGTACCTGTCACTGTATTCCATGGGATGGTGTGTATCTAT TTATATTCATATTCTTCTCTTTTATATTCTATTTTTCTTAACTTTTTATA TTTTTAAATTTCCTGTTATCTTTTCTTTTATTCTATCTTTTATTACTCTC TTATTAATCTCATTTTCACTTTTTTTTTTTTTTTCTTTTTTTATATATTT TCTTTTATTTTTTAATTTTTTCTTTTTTTATTTTTATTTTTCTTTTTTTT TTCTTCTATTTTTTCTTTTTTCTTATCTTTATTTATTTTTTTTTAATTAT TCTTTTTTTTTTATACCTTACTTTATTATTTATTCTCTTTTATATTTTTC TACTTTTTTTCCTTATTCATTTTATTCTTAAACTTTTTTATTATTTTTTC TTATTATTTTTTTTTCTTTCATCTTTTTATATTTATTTTTTAATTTTTAT TTTTATCTATTTCTTTTTCCTCCTCATCTTTTTTCATATTACTTTGTCTT TATTTTTCTTATTTTTTTAATCTTTCAATCTTCATATAATTTTATATTAA TTGTAATTTCTCATTCTTTACTTACTTTTTATCTCTTTTATTTCACTATA CTATTTTACTCTTTTCTTTTTCTTTTTATTTTTCCTTTA
quality values	Open. Hide. 6 8 8 6 6 7 6 6 6 7 11 10 11 12 12 10 10 8 8 8 8 10 15 15 9 10 10 9 9 10 15 15 22 17 10 11 12 20 24 24 24 24 29 28 28 31 32 42 26 23 14 10 11 14 19 37 30 31 30 30 30 16 15 8 13 8 11 8 8 8 6 6 6 7 9 9 9 9 11 11 11 9 3 0 3 3 0 0 0 3 15 19 20 17 12 16 26 30 34 37 30 30 30 37 37 37 24 23 10 10 13 11 9 8 8 8 8 8 10 12 11 12 12 12 12 21 26 39 39 39 39 30 33 25 31 31 37 37 39 39 39 43 43 48 48 43 43 43 43 43 39 41 41 48 42 46 39 47 47 47 47 48 48 48 41 32 29 31 31 37 37 39 43 37 32 30 30 42 36 48 37 42 37 40 42 42 44 33 28 28 36 32 43 43 43 37 43 43 43 42 32 32 32 37 37 44 44 42 35 32 33 33 44 42 43 52 57 57 57 57 54 52 57 52 43 43 38 23 23 38 44 43 43 33 32 32 43 43 52 52 52 52 52 43 43 52 43 43 50 50 39 39 39 50 50 50 37 43 43 48 44 57 50 54 54 57 57 57 48 48 48 57 42 42 33 42 42 44 44 47 47 44 43 43 43 57 57 57 44 46 43 44 42 35 35 35 42 39 48 48 57 57 44 43 37 37 44 43 54 46 42 37 35 35 39 42 39 39 36 43 43 43 43 43 39 34 24 18 12 12 24 24 15 15 20 20 19 15 22 9 8 8 8 8 8 6 6 8 8 8 8 8 8 8 9 9 9 9 10 8 8 10 10 10 13 13 19 10 9 12 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 6 6 8 8 12 8 12 8 8 9 9 9 8 8 8 11 10 11 8 8 9 10 15 13 8 8 7 8 8 9 10 12 15 19 15 12 12 11 11 17 13 16 13 17 11 11 8 8 8 8 8 8 8 8 8 9 9 10 10 9 13 13 9 9 15 27 32 18 16 8 8 8 8 8 10 8 9 9 9 8 8 12 10 8 8 8 8 6 9 8 8 8 6 8 8 11 12 15 12 11 9 9 9 9 9 9 9 8 8 8 8 8 8 8 8 10 10 10 11 8 8 6 6 8 8 10 10 10 10 9 9 9 9 9 11 9 8 8 8 10 8 10 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 6 6 8 10 10 16 12 10 9 9 10 9 9 9 9 9 9 10 13 10 10 10 8 8 10 10 10 10 10 12 10 10 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 12 8 8 6 6 8 8 8 8 8 10 10 10 10 9 9 9 10 8 8 6 7 10 8 10 10 10 10 10 9 11 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 8 12 8 8 8 8 8 8 8 8 8 8 8 8 9 9 11 10 10 15 10 10 10 13 12 13 8 8 6 6 8 6 6 13 10 8 8 8 8 8 8 11 15 8 8 6 6 8 8 8 8 6 6 8 8 13 16 21 26 15 10 8 8 6 7 8 8 8 6 6 8 8 8 9 9 10 10 10 13 8 8 8 10 8 8 8 8 8 8 8 8 10 8 10 9 8 8 6 6 6 7 8 10 10 10 10 10 10 8 8 8 8 8 8 10 10 10 10 10 11 10 13 13 12 10 10 8 8 8 8 8 8 8 6 6 9 9 8 8 8 8 8 10 12 11 9 9 9 13 10 11 9 10 10 12 10 10 9 9 10 10 10 8 9 9 9 9 11 11 11 11 13 14 11 8 6 6 6 8 6 7 8 8 9 9 10 8 8 8 8 6 6 8 8 8 8 6 6 8 8 8 8 6 6 8 8 6 6 8 11 9 9 12 10 10 8 8 8 8 8 8 10 13 8 6 7 6 6 6 6 7 10 8 11 11 10 10 10 11 11 13 8 8 8 8 8 8 8 8 8 10 10 10 11 15 10 8 8 8 8 8 8 8 9 8 8 10 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 10 10 8 8 6 6 6 6 8 8 8 8 8 8 8 10 8 9 8 8 8 8 7 6 12 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 10 11 11 11 11 10 8 8 6 6 8 8 10 8 8 8 8 8 8 13 8 8 8 9 9 9 8 12 11 11 8 8 8 8 10 8 8 8 8 12 8 8 8 9 8 8 8 8 10 9 11 11 10 10 8 8 8 10 8 8 8 9 11 17 17 10 8 10 10 8 8 8 8 8 8 8 8 8 6 6 8 10 8 10 14 7 7 8 8 6 7 6 6 8 10 10 8 8 8 8 8 6 7 8 8 8 8 8 8 8 8 8 13 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 10 8 8 8 8 8 8 8 8 9 9 9 10 16 12 10 12 9 8 12 6 9 13 10 8 8 8 8 10 10 10 10 8 8 8 8 8 8 8 8 9 11 14 18 10 10 10 10 9 8 10 8 10 11 10 8 8 6 6 6 6 8 10 10 6 6 8 10 13 8 8 8 6 6 8 8 15 12 13 12 12 12 11 11 11 11 10 10 10 10 8 8 7 7 8 8 7 7 8 8 14 8 8 6 6 8 8 8 9 7 9 9 10 8 7 6 8 10 16 9 8 8 10 10 10 10 9 12 9 9 10 8 8 6 6 6 6 6 6 6 6 6 8 8 8 10 11 13 13 10 10 8 10 11 8 8 8 8 8 10 8 8 8 8 8 8 10 8 8 6 11 10 8 8 6 6 8 6 9 9 8 8 6 6 8 8 6 6 3 0 3 14 8 8 6 6 8 6 6 8 8 6 6 8 8 21 10 13 6 6 6 6 9 9 10 10 20 13 8 8 8 8 8 8 7 10 6 6 8 6 6 8 6 9 9 9 9 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 10 8 6 6 6 6 3 0 3 11 10 8 8 12 8 8 6 6 8 8 8 8 8 8 8 10 11 11 9 7 11 8 11 8 10 8 8 8 8 10 9 9 9 10 10 8 8 10 8 8 7 6 8 8 6	Open. Hide. 6 8 9 9 9 6 8 8 7 7 6 6 6 6 6 6 6 6 6 6 6 6 6 8 8 13 8 7 9 9 13 18 37 19 17 10 10 10 12 15 19 9 12 19 28 28 30 35 34 28 24 19 19 16 19 28 37 37 48 48 47 43 59 39 25 25 9 9 9 9 7 7 7 8 8 8 8 8 8 10 10 10 19 19 22 10 10 10 3 0 3 23 23 3 0 3 7 7 3 0 3 23 23 23 23 3 0 3 11 8 8 8 8 8 8 10 13 10 13 15 14 13 11 17 17 9 9 9 10 10 15 15 19 31 34 33 36 43 43 34 32 31 33 28 37 37 43 43 43 43 36 36 43 43 48 50 48 50 48 48 36 31 31 25 31 31 46 43 48 43 39 39 36 39 43 43 43 46 48 43 43 43 44 44 48 44 44 42 32 30 42 42 44 44 43 42 39 47 47 47 46 44 43 43 43 44 44 48 57 44 42 35 35 35 43 43 44 48 47 57 57 57 57 57 57 57 57 57 52 52 52 52 52 52 52 52 52 44 44 42 42 37 43 43 37 32 33 35 43 43 33 33 38 43 33 33 35 44 43 52 52 57 43 43 33 33 39 43 43 52 52 52 57 57 57 57 57 57 43 50 37 37 37 50 50 52 57 57 44 44 29 27 27 36 27 27 27 33 43 44 59 59 52 52 52 43 43 32 36 20 20 38 38 44 57 43 42 32 32 20 20 27 28 35 44 32 32 15 15 12 18 18 28 32 21 32 25 35 35 19 32 26 32 30 42 39 47 59 48 54 47 47 39 37 42 40 44 23 23 23 36 36 37 28 40 40 31 30 32 32 41 41 46 47 30 21 10 10 10 16 24 32 32 37 39 43 59 41 30 17 17 17 24 30 23 21 15 9 9 9 9 9 13 18 23 11 10 9 9 11 16 23 25 35 39 59 59 48 48 48 57 39 39 37 39 39 39 39 35 34 28 20 18 18 13 22 8 8 8 15 24 47 43 43 43 43 28 34 21 23 20 22 28 32 43 43 43 57 43 43 40 39 42 37 37 28 32 28 30 37 39 43 43 39 42 35 35 37 37 59 43 43 43 44 57 46 41 40 24 24 24 30 32 37 32 43 29 29 28 32 32 32 24 24 12 24 12 12 18 27 32 28 17 12 24 12 12 14 26 30 35 37 32 30 30 35 32 43 43 46 57 48 47 47 39 41 41 41 37 42 39 48 47 57 39 39 32 37 37 30 30 25 25 31 34 28 31 36 40 37 35 35 32 32 22 19 19 19 12 14 14 14 21 21 12 11 11 18 12 13 13 19 19 26 17 18 12 15 10 11 10 12 12 15 15 18 12 12 12 12 12 14 17 18 21 12 24 24 28 24 31 13 13 12 13 13 18 22 20 28 22 21 21 10 10 6 6 8 8 16 13 13 10 8 8 8 8 8 8 10 10 10 9 9 8 8 6 6 8 8 8 9 12 9 9 9 10 10 10 10 10 9 9 8 8 8 8 8 10 12 8 8 8 6 8 7 6 8 8 8 8 8 8 8 8 8 11 15 12 12 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 12 9 9 8 8 8 8 8 10 8 8 8 8 8 10 8 8 8 8 8 8 10 9 10 9 8 8 8 8 8 8 8 6 6 8 8 8 8 8 10 8 10 10 8 8 6 6 8 8 12 10 8 8 8 8 8 6 6 8 8 9 9 11 11 11 10 10 13 10 10 10 13 9 8 6 6 6 8 8 9 9 9 8 8 8 8 8 8 9 13 10 10 10 10 10 10 12 15 18 15 15 10 10 10 10 9 8 8 8 8 8 8 8 8 8 8 10 10 8 10 7 7 8 8 9 9 9 10 9 8 8 8 8 8 8 8 12 13 10 9 9 8 8 8 8 8 8 8 12 8 11 12 10 10 17 10 12 15 12 14 8 10 8 8 8 8 8 8 8 10 8 8 8 8 8 8 10 11 11 19 15 11 11 12 10 9 9 8 8 8 8 7 7 8 8 10 12 18 19 18 13 12 8 8 8 8 11 11 12 8 8 6 7 8 8 8 8 6 6 8 8 12 12 10 8 8 8 8 8 8 8 8 7 8 8 9 9 9 8 8 8 6 6 6 6 8 10 10 10 10 6 6 8 8 8 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 8 9 9 11 9 12 10 8 8 7 6 10 8 8 10 12 11 12 16 11 11 9 9 8 8 6 6 8 10 10 12 11 21 13 13 11 11 8 11 8 8 8 8 9 9 9 12 15 10 10 10 10 10 12 10 9 9 12 12 12 13 11 13 10 11 13 12 11 11 11 10 10 9 9 9 9 9 9 9 10 11 9 9 9 11 9 8 8 8 8 8 8 8 8 9 9 9 12 11 13 10 9 10 10 10 10 9 10 8 8 6 6 8 8 12 9 9 9 10 10 10 10 8 8 8 10 9 9 10 10 8 8 8 10 9 10 10 10 8 8 8 10 10 13 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 13 15 15 9 8 8 8 7 7 8 8 9 9 8 8 8 8 11 10 9 9 9 8 8 8 8 8 8 8 8 8 8 8 9 9 10 8 8 12 8 10 9 7 8 7 7 10 12 8 8 8 8 8 8 6 6 6 8 6 6 8 8 12 9 14 8 10 8 8 8 8 8 8 10 6 6 8 12 13 15 16 12 10 11 8 8 8 10 8 8 8 10 7 6 6 6 8 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no141_i16.b1 MSMg01no141_i16.b1 CHROMAT_FILE:
MSMg01no141_i16.b1 PHD_FILE: MSMg01no141_i16.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:00:03 2005
         (209 letters)



>mm_chr4_152345357_152345965
          Length = 609

 Score =  368 bits (190), Expect = e-106
 Identities = 205/210 (97%), Gaps = 2/210 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   agaggaaatgcttgacctttcgaggacaattttcctctctctcgtcaagagcccgctcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agaggaaatgcttgacctttcgaggacaattttcctctctctcgtcaagagcccgctcct 260

                                                                       
Query: 61  tccgcagctgtgcagtctctcccagggatccccttccatcctgagcctgagatatctcca 120
           ||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 261 tccgcagctgtgcggtctctcccagggatcccct-ccatcctgagcctgagatatctcca 319

                                                                       
Query: 121 tccccaagaagttcc-cctgcttctccttttgtgccctggcctttgccttgctcacctcc 179
           ||||||||||||| | ||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 320 tccccaagaagtttctcctgcttctccttttatgccctggcctttgccttgctcacctcc 379

                                         
Query: 180 tgtcatgacacctgcagggaggtgggagtg 209
           ||||||||||||||||||||||||||||||
Sbjct: 380 tgtcatgacacctgcagggaggtgggagtg 409


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 209
Length of database: 609
Length adjustment: 9
Effective length of query: 200
Effective length of database: 600
Effective search space:   120000
Effective search space used:   120000
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information