MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-188A12
Chromosome	4 (Build37)
Map Location	45,699,943 - 45,700,250
singlet/doublet	singlet
Overlap gene	Gm829
Upstream gene	Pax5, 5730488B01Rik, LOC545618, Zcchc7, D4Wsu132e, Grhpr, Zbtb5, 1700055D18Rik, Polr1e, Fbxo10, 1110019J04Rik, Frmpd1, Rg9mtd3, Exosc3, LOC666325, Wdr32, Mcart1, Shb, LOC100040140, LOC100040557
Downstream gene	LOC100040567, LOC100040580, Aldh1b1, Igfbpl1, 1300002K09Rik, Tdrd7, Tmod1, BC057893, AU014645, Xpa, LOC624430, LOC666379, LOC666389, Foxe1, 5830415F09Rik, Hemgn, LOC100040643, Anp32b, Nans, Trim14, Coro2a, Tbc1d2, Gabbr2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pax5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18507 MGI:97489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730488B01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70602 MGI:1917852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC545618 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 106 Proteins

name	Zcchc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319885 MGI:2442912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D4Wsu132e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28027 MGI:107328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grhpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76238 MGI:1923488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230119 MGI:1924601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700055D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73405 MGI:1920655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs

name	Polr1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64424 MGI:1929022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269529 MGI:2686937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins

name	1110019J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 178 ESTs

name	Frmpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666060 MGI:2446274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rg9mtd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69934 MGI:1917184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66362 MGI:1913612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Wdr32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242418 MGI:2140179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcart1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230125 MGI:2684984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230126 MGI:98294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 3 Proteins

name	LOC100040140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 339 ESTs, 10 Proteins pseudo : _no_value

name	LOC100040557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Gm829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329839 MGI:2685675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100040580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Aldh1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72535 MGI:1919785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75426 MGI:1933198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300002K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74152 MGI:1921402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdrd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100121 MGI:2140279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21916 MGI:98775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272027 MGI:3039624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU014645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433702 MGI:2140419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22590 MGI:99135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624430 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 264 ESTs, 6 Proteins pseudo : _no_value

name	LOC666379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC666389 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins pseudo : _no_value

name	Foxe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110805 MGI:1353500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830415F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74753 MGI:1922003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hemgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93966 MGI:2136910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Anp32b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67628 MGI:1914878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nans (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94181 MGI:2149820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74735 MGI:1921985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107684 MGI:1345966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381605 MGI:2652885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabbr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242425 MGI:2386030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pax5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130642 GeneID:18507 MGI:97489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired box gene 5 transcript_id : NM_008782.2

name	5730488B01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252350 GeneID:70602 MGI:1917852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 5730488B01 gene transcript_id : XM_001473976.1

name	LOC545618 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252374 GeneID:545618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 106 Proteins product : similar to aurora kinase C transcript_id : XM_620030.4

name	Zcchc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84452165 GeneID:319885 MGI:2442912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 7 transcript_id : NM_177027.3

name	D4Wsu132e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542480 GeneID:28027 MGI:107328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, Wayne State University 132, expressed transcript_id : NM_138590.2

name	Grhpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17933767 GeneID:76238 MGI:1923488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyoxylate reductase/hydroxypyruvate reductase transcript_id : NM_080289.1

name	Zbtb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328403 GeneID:230119 MGI:1924601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 5 transcript_id : NM_173399.2

name	Polr1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872197 GeneID:64424 MGI:1929022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) I polypeptide E transcript_id : NM_022811.2

name	Fbxo10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371757 GeneID:269529 MGI:2686937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 2 Proteins product : F-box protein 10 transcript_id : XM_194139.6

name	1110019J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252363 GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 171 ESTs product : RIKEN cDNA 1110019J04 gene transcript_id : XM_001474120.1

name	1110019J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94371732 GeneID:68512 MGI:1915762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 63 ESTs product : RIKEN cDNA 1110019J04 gene, transcript variant 2 transcript_id : XM_898905.2

name	Frmpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922644 GeneID:666060 MGI:2446274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM and PDZ domain containing 1 transcript_id : NM_001081172.2

name	Rg9mtd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378992 GeneID:69934 MGI:1917184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA (guanine-9-) methyltransferase domain containing 3 transcript_id : NM_027266.3

name	Exosc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385428 GeneID:66362 MGI:1913612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 3 transcript_id : NM_025513.2

name	Wdr32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815803 GeneID:242418 MGI:2140179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 32 transcript_id : NM_153167.2

name	Mcart1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977298 GeneID:230125 MGI:2684984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial carrier triple repeat 1 transcript_id : NM_001009949.1

name	Shb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252376 GeneID:230126 MGI:98294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 3 Proteins product : src homology 2 domain-containing transforming protein B transcript_id : XM_001474892.1

name	LOC100040557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252378 GeneID:100040557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100040557 transcript_id : XM_001474903.1

name	Gm829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701910 GeneID:329839 MGI:2685675
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 829, (NCBI) transcript_id : NM_001033412.1

name	LOC100040567 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252380 GeneID:100040567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100040567 transcript_id : XM_001474918.1

name	Aldh1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922649 GeneID:72535 MGI:1919785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member B1 transcript_id : NM_028270.4

name	Igfbpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922625 GeneID:75426 MGI:1933198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein-like 1 transcript_id : NM_018741.2

name	1300002K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386611 GeneID:74152 MGI:1921402
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300002K09 gene transcript_id : NM_028788.2

name	Tdrd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122662 GeneID:100121 MGI:2140279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tudor domain containing 7 transcript_id : NM_146142.1

name	Tmod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922650 GeneID:21916 MGI:98775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomodulin 1 transcript_id : NM_021883.2

name	BC057893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922727 GeneID:272027 MGI:3039624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057893 transcript_id : NM_173033.3

name	AU014645 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922626 GeneID:433702 MGI:2140419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU014645 transcript_id : NM_001033201.3

name	Xpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106448 GeneID:22590 MGI:99135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xeroderma pigmentosum, complementation group A transcript_id : NM_011728.1

name	Foxe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304110 GeneID:110805 MGI:1353500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box E1 (thyroid transcription factor 2) transcript_id : NM_183298.1

name	5830415F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347462 GeneID:74753 MGI:1922003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830415F09 gene transcript_id : NM_029086.2

name	Hemgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131169 GeneID:93966 MGI:2136910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hemogen transcript_id : NM_053149.2

name	Anp32b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363533 GeneID:67628 MGI:1914878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acidic nuclear phosphoprotein 32 family, member B transcript_id : NM_130889.2

name	Nans (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802602 GeneID:94181 MGI:2149820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylneuraminic acid synthase (sialic acid synthase) transcript_id : NM_053179.3

name	Trim14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349730 GeneID:74735 MGI:1921985
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 14 transcript_id : NM_029077.2

name	Coro2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802181 GeneID:107684 MGI:1345966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 2A transcript_id : NM_178893.3

name	Tbc1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038125 GeneID:381605 MGI:2652885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 2 transcript_id : NM_198664.3

name	Gabbr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487262 GeneID:242425 MGI:2386030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA) B receptor 2 transcript_id : NM_001081141.1

name	Pax5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679213 CCDS:CCDS18125.1 GeneID:18507 MGI:97489
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : paired box gene 5 protein_id : NP_032808.1

name	5730488B01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252351 GeneID:70602 MGI:1917852
definition	codon_start : 1 product : hypothetical protein LOC70602 protein_id : XP_001474026.1

name	LOC545618 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252375 GeneID:545618
definition	codon_start : 1 product : similar to aurora kinase C protein_id : XP_620030.3

name	Zcchc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892901 CCDS:CCDS18126.1 GeneID:319885 MGI:2442912
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 7 protein_id : NP_796001.1

name	D4Wsu132e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070400 CCDS:CCDS18127.1 GeneID:28027 MGI:107328
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, CCHC domain containing 7 protein_id : NP_613056.1

name	Grhpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17933768 CCDS:CCDS18128.1 GeneID:76238 MGI:1923488
definition	GO_function : GO:0030267 - glyoxylate reductase (NADP) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glyoxylate reductase/hydroxypyruvate reductase protein_id : NP_525028.1

name	Zbtb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328404 CCDS:CCDS18129.1 GeneID:230119 MGI:1924601
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : expressed in brain and neural tube product : zinc finger and BTB domain containing 5 protein_id : NP_775575.2

name	Polr1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12328816 CCDS:CCDS18131.1 GeneID:64424 MGI:1929022
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009303 - rRNA transcription [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RNA polymerase I associated factor; polymerase (RNA) I associated factor 1; RNA polymerase I associated factor (Paf53) product : RNA polymerase I associated factor 53 protein_id : NP_073722.1

name	Fbxo10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94371758 GeneID:269529 MGI:2686937
definition	codon_start : 1 product : F-box protein 10 protein_id : XP_194139.6

name	1110019J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252364 GeneID:68512 MGI:1915762
definition	codon_start : 1 product : hypothetical protein LOC68512 protein_id : XP_001474170.1

name	1110019J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82893107 GeneID:68512 MGI:1915762
definition	codon_start : 1 product : hypothetical protein LOC68512 isoform 2 protein_id : XP_903998.1

name	Frmpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487185 GeneID:666060 MGI:2446274
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : FERM and PDZ domain containing 1 protein_id : NP_001074641.1

name	Rg9mtd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560100 CCDS:CCDS18135.1 GeneID:69934 MGI:1917184
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008175 - tRNA methyltransferase activity [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : RNA (guanine-9-) methyltransferase domain containing 3 protein_id : NP_081542.2

name	Exosc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930417 CCDS:CCDS18136.1 GeneID:66362 MGI:1913612
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 product : exosome component 3 protein_id : NP_079789.1

name	Wdr32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815804 GeneID:242418 MGI:2140179
definition	codon_start : 1 product : WD repeat domain 32 protein_id : NP_694807.2

name	Mcart1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977299 CCDS:CCDS18137.1 GeneID:230125 MGI:2684984
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mitochondrial carrier triple repeat 1 protein_id : NP_001009949.1

name	Shb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252377 GeneID:230126 MGI:98294
definition	codon_start : 1 product : src homology 2 domain-containing transforming protein B protein_id : XP_001474942.1

name	LOC100040557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252379 GeneID:100040557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474953.1

name	Gm829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701911 GeneID:329839 MGI:2685675
definition	codon_start : 1 product : hypothetical protein LOC329839 protein_id : NP_001028584.1

name	LOC100040567 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252381 GeneID:100040567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474968.1

name	Aldh1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312260 CCDS:CCDS18139.1 GeneID:72535 MGI:1919785
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008531 - riboflavin kinase activity [Evidence IEA] GO_process : GO:0009231 - riboflavin biosynthesis [Evidence IEA] codon_start : 1 product : aldehyde dehydrogenase 1 family, member B1 protein_id : NP_082546.1

name	Igfbpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055246 GeneID:75426 MGI:1933198
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : IGFBP-like protein product : insulin-like growth factor binding protein-like 1 protein_id : NP_061211.1

name	1300002K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037341 CCDS:CCDS18141.1 GeneID:74152 MGI:1921402
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74152 protein_id : NP_083064.1

name	Tdrd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122663 CCDS:CCDS18142.1 GeneID:100121 MGI:2140279
definition	codon_start : 1 product : tudor domain containing 7 protein_id : NP_666254.1

name	Tmod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230778 CCDS:CCDS18143.1 GeneID:21916 MGI:98775
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS]; GO:0030016 - myofibril [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005523 - tropomyosin binding [Evidence IEA] GO_process : GO:0030241 - muscle thick filament assembly [Evidence IMP]; GO:0030239 - myofibril assembly [Evidence IMP] codon_start : 1 note : erythrocyte tropomodulin product : tropomodulin 1 protein_id : NP_068683.1

name	BC057893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922728 GeneID:272027 MGI:3039624
definition	codon_start : 1 product : hypothetical protein LOC272027 protein_id : NP_766621.3

name	AU014645 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922627 CCDS:CCDS18145.1 GeneID:433702 MGI:2140419
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] codon_start : 1 note : nuclear cap binding protein subunit 1 product : nuclear cap binding protein subunit 1, 80kDa protein_id : NP_001028373.2

name	Xpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106449 CCDS:CCDS18146.1 GeneID:22590 MGI:99135
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0006289 - nucleotide-excision repair [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP] codon_start : 1 exception : mismatches in translation product : xeroderma pigmentosum, complementation group A protein_id : NP_035858.1

name	Foxe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304111 CCDS:CCDS18147.1 GeneID:110805 MGI:1353500
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box E1 (thyroid transcription factor 2) protein_id : NP_899121.1

name	5830415F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626025 CCDS:CCDS18148.1 GeneID:74753 MGI:1922003
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74753 protein_id : NP_083362.1

name	Hemgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716441 CCDS:CCDS18150.1 GeneID:93966 MGI:2136910
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : nuclear protein; negative differentiation regulator product : hemogen protein_id : NP_444379.1

name	Anp32b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700032 CCDS:CCDS18151.1 GeneID:67628 MGI:1914878
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000084 - S phase of mitotic cell cycle [Evidence ISS] codon_start : 1 note : acidic protein rich in leucines; proliferation related acidic leucine rich protein PAL31 product : acidic nuclear phosphoprotein 32 family, member B protein_id : NP_570959.1

name	Nans (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716467 CCDS:CCDS18152.1 GeneID:94181 MGI:2149820
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0019007 - N-acetylneuraminic acid phosphate synthase activity [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016051 - carbohydrate biosynthesis [Evidence IEA] codon_start : 1 note : N-acetylneuraminic acid 9-phosphate synthetase; N-acetylneuraminic acid phosphate synthase; sialic acid synthase product : N-acetylneuraminic acid synthase (sialic acid synthase) protein_id : NP_444409.1

name	Trim14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39540508 CCDS:CCDS18153.1 GeneID:74735 MGI:1921985
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PU.1 binding protein Pub protein_id : NP_083353.1

name	Coro2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794278 CCDS:CCDS18154.1 GeneID:107684 MGI:1345966
definition	GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0004356 - glutamate-ammonia ligase activity [Evidence IEA] GO_process : GO:0006542 - glutamine biosynthesis [Evidence IEA]; GO:0006807 - nitrogen compound metabolism [Evidence IEA] codon_start : 1 note : coronin 4 product : coronin, actin binding protein 2A protein_id : NP_849224.1

name	Tbc1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111038126 CCDS:CCDS18155.1 GeneID:381605 MGI:2652885
definition	codon_start : 1 note : likely ortholog of H. sapiens TBC1 domain family, member 2 (TBC1D2) product : TBC1 domain family, member 2 protein_id : NP_941066.3

name	Gabbr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487263 GeneID:242425 MGI:2386030
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : GABA-B receptor 2; gamma-aminobutyric acid type B receptor, subunit 2; G protein-coupled receptor 51; ortholog of human G protein-coupled receptor 51 GPR51 product : gamma-aminobutyric acid (GABA) B receptor 2 protein_id : NP_001074610.1

name	LOC666325 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666325
definition	number : 1 pseudo : _no_value

name	LOC100040580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040580
definition	number : 3 pseudo : _no_value

name	LOC100040580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040580
definition	number : 2 pseudo : _no_value

name	LOC100040580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040580
definition	number : 1 pseudo : _no_value

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 3 pseudo : _no_value

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 2 pseudo : _no_value

name	LOC666379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666379
definition	number : 1 pseudo : _no_value

name	LOC100040643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040643
definition	number : 2 pseudo : _no_value

name	LOC100040643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040643
definition	number : 1 pseudo : _no_value

name	1700055D18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252358 GeneID:73405 MGI:1920655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs product : RIKEN cDNA 1700055D18 gene transcript_id : XR_035225.1

name	LOC100040140 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252365 GeneID:100040140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 339 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_031676.1

name	LOC624430 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252370 GeneID:624430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 264 ESTs, 6 Proteins product : similar to OTU domain containing 6B pseudo : _no_value transcript_id : XR_031787.1

name	LOC666389 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252371 GeneID:666389
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_031797.1

clone name	MSMg01-386J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-312L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357L17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-418I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-547N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181K07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-128N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022F12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-188A12.T7 (MSMg01no188_a12.b1)	MSMg01-188A12.TJ (MSMg01no188_a12.g1)
ACC	AG379180	AG379181
length	781	1,182
length of high quality (start - end)	313 (59 - 371)	---
definition	CHROMAT_FILE: MSMg01no188_a12.b1 PHD_FILE: MSMg01no188_a12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:03:32 2005	CHROMAT_FILE: MSMg01no188_a12.g1 PHD_FILE: MSMg01no188_a12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:03:32 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	AATTTTTTATGATCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXCGCGGAATTCTCTATACACTGTCCCATGAGTGCTTTCCCATA CTGCTGAATACTCTGGCAAAGCATGAGTAATTGTCATATATTACCTACAG CACTCCAAAAAGACTGTGGGATGCTGGGATGCTGGCCACCAGGCTAGACT CTGGACACCCAATATTTCTTCAGACACTAACCTGGATATTGCTGTGAAAG TTTGTAATAGATGTGACTAAAAGTCATAATTAGTTGGCTTTGAAGGGAAT TTATCCTAGATAACCCATGGTGCCCAATCAAACTACTGAAATTCCATGAG GGTAGAACTATTGCTTCCCCTTTATTTAACCCCCGCACCAGCGGATGTCT GTCTTGCTTGAAGGCCTGTCCTGCAGACTGCAGACTCACCATGGAAGCCC TGCGATTTCCCCCACCCAATTACTTGCAACACAATAAATTAATCCCTTCT CTATCATACATGCATACATGCATGTCTCAGTATATGTGGTGTACAAGTTC CAGGATCCCAGAGGATGCCCAAATCAGTGCTCAGGTCCTTCATATAAAAA GTGAGAGTGTGTGTGCTCGCCTTTTCACTACTCTCATTTTTTTTCCCTTT TTTATCTTTTTTTTCTTTTCTTTACTTTTATTATACTCATATATCATATT ACTCCATATTTGTTATCATTTTCTCATTCATACTCTATTATTTTTAAATT CATATTCCAAATACAACTTTTTTTTTTTCTN	GGAAAAAGGGAGGAAGGAGGAGGTGGGGGATGTNTGAGGTGGAATTAAAA TAAAGTGTGGGGAAGAAAAGAAAAAGAGAAAGAAGGACGAGAGGAGAAGG GATAACAAAAAAAAGGAGTAGAGGAAGAGAGGAAGAGAGTGGAGGGGGAG GAAAGGGGAAGAAAGAAAGGGGAAGAGAGGAGGGGGTAGGAAAGGTATAG AGAAGGGGAAGTAGGGAAAAGAAGTGGAAAGAGAGGAAAAAAGGAGGAGG AAAATGGTGTGAAAGGAAGAGAAAAGGAAGAGAAAATGGATGAAGAAGAG GATAGAGGGGTAAGAAGAAGGAAAAAGAGGAGGGGGGGGGGGTGAGATAA GGGGAATAAAAGTTGTAAAGAGAGGGGGAAAATAATATGAAAAGAAGGGT AGGGGTTGGGGATTTGTAGGGAGGTTGGGTAAGAAGTGAAGGGGGGGGTT AATTAATAAAAATATTCGGAAGGTATAAAAGGGGGAAAAATGAGGAAGAG GAAGAGAGGAAAGGGGGAGGGGTAAAGAAAGAAAGGGGGGAGGGTAGAGG AAAAAGGGAGGAAAAAGGAGGAGAAGAGAATATTGTTTGGAGTTTTTAAG GGGCCAAAAAAAGGGAAAAGGAGTGGGTGGGGTGTAATAGGGATGTAGTG TAATAAAGGTGGGTTTGGGTGTTGTGGCGACAAAAAAAATTTTTTACTTT GTAAATTGTGTGGGTTCGGGTGTGGGGGGTGGGTGGTGGAGAGTAAAGGG AAAAAAAAAAAAGGAAGAAGAAAGAGGGATAATGGGGGATAGGAAAGTAA AATGGTGAGAAGGGGGGAAAGAGGAGAAGGAAGAAGGAGAGGGAGGGAAA GAAAAGAGGAAGGATAATAGGAGAGAGGGGGGGGGGAGAAGAGAGAGGGA GAATAAAGAAAAGGGAAAGGGGTAATAGGGGGATAAAAAAAGAGGGGATA TATAAGGAGGTAAGAAGGGGGGGAAGAAGAGGGGGAAGAAAAGAGAGAGA TAGAGTAGAAGAGTGGTGAGAAGAAAAGAAAGAAGAGAAAAGAGAGGGAG ATAAGGAAGAGAGAGGAGAGAGGGATAGATGGGGGTTGATACGAGGGAGG AGAAAGAAAGGGGGGAAGGGAGAAGAGGAGTAGATATAGAGAATAAGAGA GAGGAAAATGAGGGAGGAAGTAGGGAGAGAAG
quality values	Open. Hide. 6 6 6 8 8 9 8 8 6 6 6 6 10 15 8 6 6 6 7 11 13 22 26 30 28 27 23 26 25 30 30 30 33 33 33 33 48 48 35 35 28 28 28 36 57 57 50 50 48 57 57 57 57 48 48 48 48 48 50 57 57 48 28 28 28 28 41 50 59 68 68 68 68 50 50 50 50 50 57 57 51 51 51 42 42 36 37 37 43 59 59 68 68 68 50 50 50 50 50 50 57 57 57 57 59 68 68 68 68 50 50 68 57 57 57 57 54 57 57 57 57 68 68 68 68 57 57 52 54 50 50 50 50 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 68 68 68 57 59 57 57 57 57 57 57 57 57 41 57 57 57 57 57 59 57 57 57 57 57 57 57 57 52 52 57 59 59 57 57 52 52 52 57 57 57 57 57 57 57 68 59 57 57 57 57 57 57 57 59 59 59 59 59 68 68 68 68 68 68 68 57 57 52 52 52 54 59 59 68 68 57 57 50 50 50 50 50 50 68 50 68 57 57 57 57 57 57 57 57 57 57 57 59 54 54 50 59 50 47 47 57 44 57 48 48 48 44 44 54 54 54 59 59 59 59 48 54 54 57 57 57 57 57 54 57 57 57 57 57 57 57 54 59 59 68 68 57 57 57 57 57 57 57 57 43 47 35 35 43 42 42 42 43 39 39 39 37 37 39 59 59 48 48 48 48 48 47 43 39 39 39 47 59 59 59 59 28 15 9 9 9 9 19 23 41 41 41 39 39 35 35 39 39 48 48 57 57 57 57 59 59 59 59 59 34 26 23 23 14 12 9 9 11 8 8 8 15 12 10 10 10 13 11 11 11 11 11 12 11 11 11 16 22 28 37 33 36 39 43 43 48 48 57 57 48 48 48 48 43 43 39 39 39 43 39 43 39 32 41 28 25 13 13 12 12 24 27 25 22 16 11 11 10 15 15 19 20 23 28 26 28 17 17 16 26 23 28 28 37 47 40 39 43 36 36 43 43 48 48 48 46 47 46 43 43 36 36 36 43 43 57 57 44 37 31 25 18 32 18 21 20 31 31 37 39 37 37 37 39 37 37 39 44 57 57 57 57 57 57 54 54 47 42 22 20 18 30 30 30 30 23 37 37 32 32 17 15 11 25 25 35 35 43 43 43 41 27 16 11 11 11 27 27 50 35 32 17 14 14 14 17 32 28 35 35 35 25 24 19 14 14 16 16 19 24 25 25 11 12 13 24 21 21 16 19 11 11 11 13 13 19 24 22 21 14 14 10 19 21 20 19 14 16 16 19 19 29 28 24 18 15 16 18 15 20 26 19 28 23 19 10 8 8 8 10 10 21 19 21 21 15 12 13 10 8 8 8 8 8 8 8 10 10 6 8 8 8 8 8 8 8 8 6 6 8 8 10 10 9 9 13 13 10 13 10 8 11 15 13 13 11 8 8 7 7 8 10 10 12 8 8 8 8 8 8 8 10 6 6 6 6 10 11 15 20 20 14 10 9 9 9 9 9 10 10 9 8 8 8 6 6 8 8 6 7 7 10 10 9 8 11 8 8 10 8 8 8 10 10 8 9 9 14 14 8 8 8 8 8 10 11 13 12 10 8 8 10 8 8 8 8 8 8 6 6 6 7 8 8 11 11 11 10 8 8 8 8 8 6 6 8 7 7 10 8 8 8 8 8 8 8 6 6 8 8 9 9 11 12 10 9 9 10 13 10 13 9 10 3 0	Open. Hide. 7 8 8 8 8 10 16 17 10 10 6 6 6 6 8 8 8 8 10 8 10 8 8 6 6 8 8 8 8 6 6 8 3 0 3 6 6 6 6 6 8 8 18 11 11 9 9 10 10 6 6 8 7 8 8 6 6 8 8 8 8 8 8 8 8 12 9 9 9 9 10 13 14 11 11 6 6 8 8 8 12 6 7 8 8 8 7 7 7 8 9 9 8 6 6 6 8 10 10 9 10 8 8 8 6 6 6 7 7 9 9 9 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 9 9 9 9 10 8 8 8 8 6 6 8 6 8 8 10 10 8 10 10 10 10 10 10 10 15 20 28 19 12 10 10 13 8 8 8 8 8 8 9 8 11 6 6 6 6 6 8 7 7 8 7 8 8 9 8 8 8 8 8 8 8 8 8 8 7 7 9 9 8 8 8 10 10 8 9 9 13 9 8 8 6 6 8 8 9 10 10 10 10 12 9 7 6 6 6 8 8 13 15 13 7 9 6 6 8 6 7 12 8 9 9 9 9 9 10 8 8 8 8 8 9 15 15 9 6 6 6 6 6 6 9 10 15 32 22 22 8 11 10 8 8 8 10 15 12 11 9 9 8 6 8 7 12 12 13 9 9 7 8 6 6 8 8 11 12 12 12 11 10 6 6 6 6 6 6 8 10 11 11 9 9 8 8 10 10 10 8 8 8 8 8 8 10 8 10 7 9 10 12 8 8 9 13 8 8 9 10 19 13 8 12 8 8 8 8 8 6 8 8 10 23 23 23 8 8 6 8 8 12 10 8 8 8 8 8 8 6 7 7 7 10 7 15 15 17 15 14 10 13 11 15 11 8 8 6 6 8 8 11 15 15 10 6 6 7 12 11 9 6 6 6 6 10 10 15 15 21 17 9 12 8 8 8 6 6 6 6 8 8 10 14 19 25 22 11 11 6 8 6 6 8 8 10 8 8 6 6 7 10 6 9 12 17 28 19 18 14 12 12 6 8 6 6 6 8 11 10 10 10 7 13 6 6 6 8 6 6 6 8 13 13 19 8 8 6 6 6 7 10 8 9 18 12 12 10 10 15 10 10 6 6 6 7 6 8 9 10 10 6 6 6 6 8 8 8 8 15 13 17 16 15 14 14 18 14 16 24 24 15 14 17 10 10 6 8 7 9 12 11 11 8 8 8 8 10 13 22 22 12 12 10 13 11 9 6 6 8 15 6 6 9 9 9 11 11 8 6 7 7 16 19 20 20 20 19 13 10 8 13 13 12 9 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 10 9 9 9 12 11 12 8 8 11 11 11 14 19 19 8 6 6 6 7 7 12 12 11 9 14 9 10 10 12 9 9 8 8 8 8 8 8 8 6 6 8 10 18 11 10 10 8 10 6 6 6 8 8 9 9 9 10 11 10 9 9 9 8 8 8 8 8 8 9 9 9 9 15 8 11 6 6 6 6 6 6 8 8 22 8 10 16 13 9 7 7 9 9 9 22 25 37 18 9 7 7 6 6 9 6 6 6 3 3 3 6 6 6 6 6 7 10 18 16 13 12 12 12 13 11 6 7 8 6 6 11 8 8 8 8 9 13 23 24 10 6 6 6 10 6 6 6 6 7 8 10 10 10 10 10 11 8 11 9 9 8 7 6 8 8 11 11 14 17 16 19 22 22 17 18 13 15 7 7 7 10 8 12 8 12 7 9 9 8 9 9 8 8 8 8 10 10 11 7 8 6 6 8 8 10 11 8 8 6 6 7 15 14 6 6 8 8 11 8 10 14 14 8 9 9 9 10 10 11 11 17 11 11 11 10 7 6 6 10 10 11 7 7 8 8 10 11 15 10 8 8 8 8 8 8 11 8 8 8 10 12 9 15 19 17 19 10 8 8 8 9 9 8 8 10 8 6 6 6 6 8 8 10 8 8 8 8 8 11 10 13 15 16 17 26 10 10 9 11 11 7 7 6 6 8 6 6 8 8 8 8 6 6 8 6 8 8 10 14 9 13 11 12 10 10 10 13 7 7 7 8 10 8 9 6 6 7 7 11 17 12 14 11 13 8 9 9 12 15 21 16 9 11 9 9 9 12 10 8 6 6 6 6 6 6 6 12 11 10 11 9 9 9 8 10 8 8 8 10 12 11 11 16 10 15 8 8 6 7 7 6 8 8 23 23 21 8 8 8 8 11 9 9 7 7 8 11 11 14 10 10 10 10 10 8 9 9 9 9 9 8 12 8 8 8 11 8 6 6 6 8 8 8 10 8 8 8 8 6 6 6 8 12 11 15 8 8 12 7 7 9 10 12 12 12 19 9 9 11 7 8 8 8 8 8 8 8 15 11 8 8 8 8 7 9 6 6 6 6 6 6 8 8 8 8 13 13 9 9 11 8 9 9 9 7 8 6 6 8 8 8 8 6 6 6 8 8 7 7 9 9 10 10 9 6 10 6 8 8 10 9 10 9 10 10 9 9 9 10 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 7 7 9 9 8 15 10 10 6 6 6 9 15 9 9 7 6 6 6 6 9 14 15 15 11 9 14 8 6 6 6 11 7 9 9 9 13 17 9 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no188_a12.b1 MSMg01no188_a12.b1 CHROMAT_FILE:
MSMg01no188_a12.b1 PHD_FILE: MSMg01no188_a12.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:03:32 2005
         (313 letters)



>mm_chr4_45699918_45700630
          Length = 713

 Score =  588 bits (304), Expect = e-172
 Identities = 307/308 (99%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattctctatacactgtcccatgagtgctttcccatactgctgaatactctggcaaagc 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 gaattctctatacactgtcccatgagtgctttcccatactgctgaatactctggcaaagc 274

                                                                       
Query: 65  atgagtaattgtcatatattacctacagcactccaaaaagactgtgggatgctgggatgc 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 273 atgagtaattgtcatatattacctacagcactccaaaaagactgtgggatgctgggatgc 214

                                                                       
Query: 125 tggccaccaggctagactctggacacccaatatttcttcagacactaacctggatattgc 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 213 tggccaccaggctagactctggacacccaatatttcttcagacactaacctggatattgc 154

                                                                       
Query: 185 tgtgaaagtttgtaatagatgtgactaaaagtcataattagttggctttgaagggaattt 244
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 153 tgtgaaagtttgtaatagatgtgactaaaagtcataattagttggctttgaagggaattt 94

                                                                       
Query: 245 atcctagataacccatggtgcccaatcaaactactgaaattccatgagggtagaactatt 304
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 93  atcctagataacccatggtgcccaatcaaactactgaaagtccatgagggtagaactatt 34

                   
Query: 305 gcttcccc 312
           ||||||||
Sbjct: 33  gcttcccc 26


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 313
Length of database: 713
Length adjustment: 9
Effective length of query: 304
Effective length of database: 704
Effective search space:   214016
Effective search space used:   214016
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information