MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-329N06
Chromosome	4 (Build37)
Map Location	117,240,161 - 117,240,276
singlet/doublet	singlet
Overlap gene	Prnpip1
Upstream gene	Gpbp1l1, LOC622665, Nasp, Akr1a4, Prdx1, Mmachc, 0610037D15Rik, Tesk2, Toe1, Mutyh, Hpdl, LOC625336, LOC100041048, Zswim5, Urod, Hectd3, Eif2b3, Ptch2, 9530048O09Rik, LOC100041324, 4833401D15Rik, Plk3, Best4-ps, LOC625405, Rps8, Kif2c, Gm1661, Tmem53, 4931406I20Rik, LOC100041093
Downstream gene	Dmap1, LOC433749, Klf17, Ppia-ps4_1138.1, Slc6a9, B4galt2, Atp6v0b, Dph2, Ipo13, Artn, St3gal3, Jmjd2a, Ptprf, Hyi, BC059842, Med8, Elovl1, Cdc20, Mpl, Tie1, LOC545675, LOC666596, 2610528J11Rik, 6330530A05Rik, 1110020C03Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gpbp1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77110 MGI:1924360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nasp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50927 MGI:1355328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Akr1a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58810 MGI:1929955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prdx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18477 MGI:99523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmachc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67096 MGI:1914346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610037D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68394 MGI:1915644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tesk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230661 MGI:2385204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Toe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68276 MGI:1915526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mutyh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70603 MGI:1917853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpdl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242642 MGI:2444646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 ESTs, 9 Proteins

name	LOC100041048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zswim5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74464 MGI:1921714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Urod (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22275 MGI:98916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hectd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76608 MGI:1923858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108067 MGI:1313286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19207 MGI:1095405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530048O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78611 MGI:1925861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs

name	LOC100041324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	4833401D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242646 MGI:3045358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12795 MGI:109604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Best4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230664 MGI:3663793
definition	gene_synonym : Vmd2l2p note : bestrophin 4, pseudogene pseudo : _no_value

name	LOC625405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 71 ESTs, 4 Proteins

name	Rps8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20116 MGI:98166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73804 MGI:1921054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381544 MGI:2686507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68777 MGI:1916027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931406I20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66743 MGI:1913993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Prnpip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140546 MGI:2153887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66233 MGI:1913483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 327 ESTs, 61 Proteins

name	Klf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75753 MGI:2181068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps4_1138.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606540
definition	note : peptidylprolyl isomerase A pseudogene 4_1138.1 pseudo : _no_value

name	Slc6a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14664 MGI:95760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53418 MGI:1858493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114143 MGI:1890510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67728 MGI:1914978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ipo13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230673 MGI:2385205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Artn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11876 MGI:1333791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St3gal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20441 MGI:1316659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230674 MGI:2446210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19268 MGI:102695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68180 MGI:1915430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC059842 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230676 MGI:2686975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 4 Proteins

name	Med8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Elovl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cdc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107995 MGI:1859866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17480 MGI:97076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tie1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21846 MGI:99906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	2610528J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66451 MGI:1913701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330530A05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230678 MGI:1923409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110020C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68625 MGI:1915875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpbp1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734458 GeneID:77110 MGI:1924360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GC-rich promoter binding protein 1-like 1 transcript_id : NM_029868.2

name	LOC622665 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142375415 GeneID:622665
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC622665 transcript_id : NM_001037916.2

name	Nasp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490377 GeneID:50927 MGI:1355328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear autoantigenic sperm protein (histone-binding) transcript_id : NM_016777.3

name	Nasp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090504 GeneID:50927 MGI:1355328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear autoantigenic sperm protein (histone-binding) transcript_id : NM_001081475.1

name	Akr1a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981167 GeneID:58810 MGI:1929955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member A4 (aldehyde reductase) transcript_id : NM_021473.2

name	Prdx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802543 GeneID:18477 MGI:99523
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 1 transcript_id : NM_011034.3

name	Mmachc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344135 GeneID:67096 MGI:1914346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylmalonic aciduria cblC type, with homocystinuria transcript_id : NM_025962.2

name	0610037D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053899 GeneID:68394 MGI:1915644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610037D15 gene transcript_id : NM_026714.2

name	Tesk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361402 GeneID:230661 MGI:2385204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific kinase 2 transcript_id : NM_146151.3

name	Toe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129870 GeneID:68276 MGI:1915526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : target of EGR1, member 1 (nuclear) transcript_id : NM_026654.2

name	Mutyh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875427 GeneID:70603 MGI:1917853
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mutY homolog (E. coli) transcript_id : NM_133250.1

name	Hpdl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348524 GeneID:242642 MGI:2444646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 4-hydroxyphenylpyruvate dioxygenase-like transcript_id : NM_146256.3

name	LOC625336 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252874 GeneID:625336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 ESTs, 9 Proteins product : similar to Rpl36 protein transcript_id : XM_889902.3

name	Zswim5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131187 GeneID:74464 MGI:1921714
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 5 transcript_id : NM_001029912.2

name	Urod (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347605 GeneID:22275 MGI:98916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroporphyrinogen decarboxylase transcript_id : NM_009478.2

name	Hectd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271517 GeneID:76608 MGI:1923858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HECT domain containing 3 transcript_id : NM_175244.3

name	Eif2b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384892 GeneID:108067 MGI:1313286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2B, subunit 3 transcript_id : NM_175135.3

name	Ptch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130615 GeneID:19207 MGI:1095405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patched homolog 2 transcript_id : NM_008958.2

name	LOC100041324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252877 GeneID:100041324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100041324 transcript_id : XM_001477060.1

name	4833401D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803150 GeneID:242646 MGI:3045358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833401D15 gene transcript_id : NM_175030.2

name	Plk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299591 GeneID:12795 MGI:109604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polo-like kinase 3 (Drosophila) transcript_id : NM_013807.2

name	LOC625405 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252879 GeneID:625405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 71 ESTs, 4 Proteins product : similar to RNA polymerase II subunit transcript_id : XM_889972.3

name	Rps8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982034 GeneID:20116 MGI:98166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S8 transcript_id : NM_009098.2

name	Kif2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802894 GeneID:73804 MGI:1921054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 2C transcript_id : NM_134471.3

name	Gm1661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375490 GeneID:381544 MGI:2686507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1661, (NCBI) transcript_id : NM_001033774.2

name	Tmem53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345624 GeneID:68777 MGI:1916027
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 53 transcript_id : NM_026837.2

name	4931406I20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37059807 GeneID:66743 MGI:1913993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406I20 gene transcript_id : NM_025739.2

name	LOC100041093 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252872 GeneID:100041093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041093 transcript_id : XM_001475794.1

name	Prnpip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859764 GeneID:140546 MGI:2153887
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prion protein interacting protein 1 transcript_id : NM_080469.2

name	Dmap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981291 GeneID:66233 MGI:1913483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 1-associated protein 1 transcript_id : NM_023178.2

name	LOC433749 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372220 GeneID:433749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 327 ESTs, 61 Proteins product : similar to Rho family GTPase RhoA transcript_id : XM_485435.3

name	Klf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853590 GeneID:75753 MGI:2181068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 17 transcript_id : NM_029416.2

name	Slc6a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686111 GeneID:14664 MGI:95760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, glycine), member 9 transcript_id : NM_008135.4

name	B4galt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77682040 GeneID:53418 MGI:1858493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 transcript_id : NM_017377.4

name	Atp6v0b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382710 GeneID:114143 MGI:1890510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit B transcript_id : NM_033617.2

name	Dph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802472 GeneID:67728 MGI:1914978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DPH2 homolog (S. cerevisiae) transcript_id : NM_026344.3

name	Ipo13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802110 GeneID:230673 MGI:2385205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : importin 13 transcript_id : NM_146152.3

name	Artn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803588 GeneID:11876 MGI:1333791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : artemin transcript_id : NM_009711.3

name	St3gal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801788 GeneID:20441 MGI:1316659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 3 transcript_id : NM_009176.3

name	Jmjd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859780 GeneID:230674 MGI:2446210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 2A transcript_id : NM_172382.1

name	Ptprf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648047 GeneID:19268 MGI:102695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, F transcript_id : NM_011213.2

name	Hyi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742867 GeneID:68180 MGI:1915430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxypyruvate isomerase homolog (E. coli) transcript_id : NM_026601.1

name	BC059842 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252884 GeneID:230676 MGI:2686975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 3 Proteins product : cDNA sequence BC059842 transcript_id : XM_001477657.1

name	Med8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155156 GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) transcript_id : NM_173719.2

name	Med8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155154 GeneID:80509 MGI:1915269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 8 homolog (yeast) transcript_id : NM_020000.2

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702349 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_019422.2

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702350 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_001039175.1

name	Elovl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702352 GeneID:54325 MGI:1858959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 transcript_id : NM_001039176.1

name	Cdc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963586 GeneID:107995 MGI:1859866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 20 homolog (S. cerevisiae) transcript_id : NM_023223.1

name	Mpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754729 GeneID:17480 MGI:97076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloproliferative leukemia virus oncogene transcript_id : NM_010823.1

name	Tie1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446132 GeneID:21846 MGI:99906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase receptor 1 transcript_id : NM_011587.2

name	2610528J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130308 GeneID:66451 MGI:1913701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610528J11 gene transcript_id : NM_025572.2

name	6330530A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366443 GeneID:230678 MGI:1923409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330530A05 gene transcript_id : NM_172383.2

name	1110020C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802817 GeneID:68625 MGI:1915875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110020C03 gene transcript_id : NM_026789.2

name	Gpbp1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734459 CCDS:CCDS18511.1 GeneID:77110 MGI:1924360
definition	codon_start : 1 product : GC-rich promoter binding protein 1-like 1 protein_id : NP_084144.2

name	LOC622665 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85702302 CCDS:CCDS18512.1 GeneID:622665
definition	codon_start : 1 product : hypothetical protein LOC622665 protein_id : NP_001033005.1

name	Nasp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090505 GeneID:50927 MGI:1355328
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; somatic histone binding protein NASP product : nuclear autoantigenic sperm protein isoform 1 protein_id : NP_001074944.1

name	Nasp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490378 CCDS:CCDS18513.1 GeneID:50927 MGI:1355328
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; somatic histone binding protein NASP product : nuclear autoantigenic sperm protein isoform 2 protein_id : NP_058057.3

name	Akr1a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946870 CCDS:CCDS18514.1 GeneID:58810 MGI:1929955
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0008106 - alcohol dehydrogenase (NADP+) activity [Evidence NAS]; GO:0004032 - aldehyde reductase activity [Evidence ISS] [Evidence TAS] [Evidence IDA]; GO:0047939 - L-glucuronate reductase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0046185 - aldehyde catabolism [Evidence IDA]; GO:0008150 - biological_process [Evidence ND]; GO:0042840 - D-glucuronate catabolism [Evidence IDA]; GO:0019853 - L-ascorbic acid biosynthesis [Evidence IDA] codon_start : 1 note : aldehyde reductase; aldo-keto reductase family 1, member A1 (aldehyde reductase) product : aldo-keto reductase family 1, member A4 (aldehyde reductase) protein_id : NP_067448.1

name	Prdx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754976 CCDS:CCDS18515.1 GeneID:18477 MGI:99523
definition	GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0051920 - peroxiredoxin activity [Evidence IEA] GO_process : GO:0042345 - regulation of NF-kappaB import into nucleus [Evidence IMP]; GO:0006979 - response to oxidative stress [Evidence IMP] [Evidence IDA] codon_start : 1 note : proliferation-associated gene A; osteoblast specific factor 3; macrophage 23 Kd stress protein; macrophase stress protein 23 kd; Trx dependent peroxide reductase 2; thioredoxin dependent peroxide reductase 2; macrophage 23kDa stress protein; macrophase stress protein 22kDa; Prx I product : peroxiredoxin 1 protein_id : NP_035164.1

name	Mmachc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385456 GeneID:67096 MGI:1914346
definition	GO_function : GO:0031419 - cobalamin binding [Evidence IEA]; GO:0050897 - cobalt ion binding [Evidence IEA] codon_start : 1 product : methylmalonic aciduria cblC type, with homocystinuria protein_id : NP_080238.1

name	0610037D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053900 GeneID:68394 MGI:1915644
definition	codon_start : 1 product : hypothetical protein LOC68394 protein_id : NP_080990.2

name	Tesk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981902 CCDS:CCDS18516.1 GeneID:230661 MGI:2385204
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006915 - apoptosis [Evidence ISS]; GO:0048041 - focal adhesion formation [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : testis-specific kinase 2 protein_id : NP_666263.2

name	Toe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311839 CCDS:CCDS18517.1 GeneID:68276 MGI:1915526
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA] codon_start : 1 product : TOE1 homolog protein_id : NP_080930.1

name	Mutyh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875428 CCDS:CCDS18518.1 GeneID:70603 MGI:1917853
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : adenine-DNA glycosylase; mutY homolog alpha; the full-length form type A, 5' region product : mutY homolog protein_id : NP_573513.1

name	Hpdl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122847 CCDS:CCDS18519.1 GeneID:242642 MGI:2444646
definition	GO_function : GO:0003868 - 4-hydroxyphenylpyruvate dioxygenase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA] codon_start : 1 product : glyoxalase domain containing 1 protein_id : NP_666368.1

name	LOC625336 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894566 GeneID:625336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894995.1

name	Zswim5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71361674 CCDS:CCDS18520.1 GeneID:74464 MGI:1921714
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger, SWIM domain containing 5 (Zswim5) product : zinc finger, SWIM domain containing 5 protein_id : NP_001025083.1

name	Urod (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347606 CCDS:CCDS18521.1 GeneID:22275 MGI:98916
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004853 - uroporphyrinogen decarboxylase activity [Evidence IDA] [Evidence IMP] GO_process : GO:0042168 - heme metabolism [Evidence IMP]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 product : uroporphyrinogen decarboxylase protein_id : NP_033504.2

name	Hectd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424882 CCDS:CCDS18522.1 GeneID:76608 MGI:1923858
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA] codon_start : 1 product : HECT domain containing 3 protein_id : NP_780453.1

name	Eif2b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626005 CCDS:CCDS18524.1 GeneID:108067 MGI:1313286
definition	GO_component : GO:0005851 - eukaryotic translation initiation factor 2B complex [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 2B, subunit 3 protein_id : NP_780344.2

name	Ptch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679517 CCDS:CCDS18526.1 GeneID:19207 MGI:1095405
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008158 - hedgehog receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : patched homolog 2 protein_id : NP_032984.1

name	LOC100041324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252878 GeneID:100041324
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477110.1

name	4833401D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239425 CCDS:CCDS18528.1 GeneID:242646 MGI:3045358
definition	codon_start : 1 product : hypothetical protein LOC242646 protein_id : NP_778195.1

name	Plk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299592 CCDS:CCDS18529.1 GeneID:12795 MGI:109604
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : cytokine inducible kinase product : polo-like kinase 3 protein_id : NP_038835.2

name	LOC625405 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82894570 GeneID:625405
definition	codon_start : 1 product : similar to RNA polymerase II subunit protein_id : XP_895065.1

name	Rps8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677813 CCDS:CCDS18530.1 GeneID:20116 MGI:98166
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S8 protein_id : NP_033124.1

name	Kif2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981665 CCDS:CCDS18531.1 GeneID:73804 MGI:1921054
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mitotic centromere-associated kinesin product : kinesin-like 6 protein_id : NP_608301.2

name	Gm1661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702083 CCDS:CCDS18532.1 GeneID:381544 MGI:2686507
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381544 protein_id : NP_001028946.1

name	Tmem53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312110 CCDS:CCDS18533.1 GeneID:68777 MGI:1916027
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : transmembrane protein 53 protein_id : NP_081113.1

name	4931406I20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37059808 CCDS:CCDS18534.1 GeneID:66743 MGI:1913993
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66743 protein_id : NP_080015.3

name	LOC100041093 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252873 GeneID:100041093
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475844.1

name	Prnpip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859765 CCDS:CCDS18535.1 GeneID:140546 MGI:2153887
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : prion protein interacting protein 1 protein_id : NP_536717.2

name	Dmap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963557 CCDS:CCDS18536.1 GeneID:66233 MGI:1913483
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : DNMT1 associated protein-1 protein_id : NP_075667.1

name	LOC433749 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51709421 GeneID:433749
definition	codon_start : 1 product : similar to Rho family GTPase RhoA protein_id : XP_485435.1

name	Klf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853591 CCDS:CCDS18537.1 GeneID:75753 MGI:2181068
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007276 - gametogenesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : germ cell specific zinc finger protein product : zinc finger protein 393 protein_id : NP_083692.2

name	Slc6a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067352 CCDS:CCDS18538.1 GeneID:14664 MGI:95760
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : glycine transporter 1 product : solute carrier family 6 member 9 protein_id : NP_032161.2

name	B4galt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8392959 CCDS:CCDS18539.1 GeneID:53418 MGI:1858493
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004461 - lactose synthase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : beta-1,4-galactosyltransferase II; UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 2 product : UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 protein_id : NP_059073.1

name	Atp6v0b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15991795 CCDS:CCDS18540.1 GeneID:114143 MGI:1890510
definition	GO_component : GO:0005768 - endosome [Evidence IDA]; GO:0016471 - hydrogen-translocating V-type ATPase complex [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump); lysosomal 21kDa; ATPase, H+ transporting, lysosomal 21kDa, V0 subunit B product : ATPase, H+ transporting, V0 subunit B protein_id : NP_291095.1

name	Dph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468993 CCDS:CCDS18541.1 GeneID:67728 MGI:1914978
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 1 product : diptheria toxin resistance protein required for diphthamide biosynthesis (Saccharomyces)-like 2 protein_id : NP_080620.1

name	Ipo13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122681 CCDS:CCDS18542.1 GeneID:230673 MGI:2385205
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006606 - protein import into nucleus [Evidence ISS]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : importin 13 protein_id : NP_666264.1

name	Artn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753124 CCDS:CCDS18543.1 GeneID:11876 MGI:1333791
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0030116 - glial cell line-derived neurotrophic factor receptor binding [Evidence ISS]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IPI] GO_process : GO:0007411 - axon guidance [Evidence IMP] [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0007422 - peripheral nervous system development [Evidence IMP] codon_start : 1 product : artemin protein_id : NP_033841.1

name	St3gal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543705 CCDS:CCDS18544.1 GeneID:20441 MGI:1316659
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008118 - N-acetyllactosaminide alpha-2,3-sialyltransferase activity [Evidence IEA]; GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sialyltransferase 3; ST3Gal III; sialyltransferase (N-acetyllacosaminide alpha 2,3-sialyltransferase); sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase) product : sialyltransferase 6 protein_id : NP_033202.2

name	Jmjd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859781 CCDS:CCDS18545.1 GeneID:230674 MGI:2446210
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : jumonji domain containing 2A protein_id : NP_759014.1

name	Ptprf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115648048 CCDS:CCDS18546.1 GeneID:19268 MGI:102695
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 note : leukocyte antigen-related (LAR) PTP receptor product : protein tyrosine phosphatase, receptor type, F protein_id : NP_035343.2

name	Hyi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742868 GeneID:68180 MGI:1915430
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hydroxypyruvate isomerase homolog protein_id : NP_080877.1

name	BC059842 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252885 GeneID:230676 MGI:2686975
definition	codon_start : 1 product : hypothetical protein LOC230676 protein_id : XP_001477707.1

name	Med8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29366816 CCDS:CCDS18548.1 GeneID:80509 MGI:1915269
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; activator-recruited cofactor 32 kDa component product : mediator of RNA polymerase II transcription, subunit 8 homolog isoform 2 protein_id : NP_776067.1

name	Med8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155155 GeneID:80509 MGI:1915269
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; activator-recruited cofactor 32 kDa component product : mediator of RNA polymerase II transcription, subunit 8 homolog isoform 1 protein_id : NP_064384.2

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702353 CCDS:CCDS18549.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 1 protein_id : NP_001034265.1

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507145 CCDS:CCDS18549.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 2; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 1 protein_id : NP_062295.1

name	Elovl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702351 CCDS:CCDS18550.1 GeneID:54325 MGI:1858959
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; sequence similarity to Cig30 1 product : elongation of very long chain fatty acids-like 1 isoform 2 protein_id : NP_001034264.1

name	Cdc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963587 CCDS:CCDS18551.1 GeneID:107995 MGI:1859866
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cell division cycle 20 homolog protein_id : NP_075712.1

name	Mpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754730 CCDS:CCDS18552.1 GeneID:17480 MGI:97076
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thrombopoietin receptor product : myeloproliferative leukemia virus oncogene protein_id : NP_034953.1

name	Tie1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446133 CCDS:CCDS18553.1 GeneID:21846 MGI:99906
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence IMP]; GO:0030336 - negative regulation of cell migration [Evidence IMP]; GO:0045026 - plasma membrane fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : tyrosine kinase receptor 1 protein_id : NP_035717.2

name	2610528J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385014 CCDS:CCDS18554.1 GeneID:66451 MGI:1913701
definition	codon_start : 1 product : hypothetical protein LOC66451 protein_id : NP_079848.1

name	6330530A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369507 GeneID:230678 MGI:1923409
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230678 protein_id : NP_759015.1

name	1110020C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312076 GeneID:68625 MGI:1915875
definition	codon_start : 1 product : hypothetical protein LOC68625 protein_id : NP_081065.1

name	LOC100041048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041048
definition	number : 2 pseudo : _no_value

name	LOC100041048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041048
definition	number : 1 pseudo : _no_value

name	LOC545675 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545675
definition	number : 2 pseudo : _no_value

name	LOC545675 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545675
definition	number : 1 pseudo : _no_value

name	LOC666596 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666596
definition	number : 1 pseudo : _no_value

name	LOC666596 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666596
definition	number : 2 pseudo : _no_value

name	9530048O09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252870 GeneID:78611 MGI:1925861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs product : RIKEN cDNA 9530048O09 gene transcript_id : XR_035280.1

clone name	MSMg01-398E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461O23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-306E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-329N06.T7 (MSMg01no329_n06.b1)	MSMg01-329N06.TJ (MSMg01no329_n06.g1)
ACC	AG446546	AG446547
length	826	782
length of high quality (start - end)	144 (21 - 164)	116 (77 - 192)
definition	CHROMAT_FILE: MSMg01no329_n06.b1 PHD_FILE: MSMg01no329_n06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:15:25 2005	CHROMAT_FILE: MSMg01no329_n06.g1 PHD_FILE: MSMg01no329_n06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:15:25 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GAACTACTATTTCCAGAGGATCCGCGGAATTCTTTGTTTACCCCTGTACC CCATTTTTAAATAGGGTTATTTGATTTTCTGGAGCCCATCTTATCTTTAT GTCCTCCTTATCTTTATGGTCAAGCTGTTCCCAGTAATGTTTTAACTACG GTGCATACCCCGGTTTGCCCTTCCTTTGTTCTCAGTCTTACTCATCCTCT ATCCCTCTCTATCACCATTGATTTCTGATCACTTTATATGCTTTCACTTT CTCTTGCTCTTTTTTCCTTTCCTTTCTTTTCGTTCCTTCTTCCCCTCTCT CTCTTCCTCCTTTTTTTCACCTTTTTTTTTCACTCCTTTTTTTTTTTTTT TACCCCTTTTCCCTTCCTTCTTCTTCTTACTTTTTCTACATTCCATACTT TTTTCCCCCCCCCCCCCCTTTATTTATTCCCCTTTCTCCACCCACCCTCC TTTCCTTCTTCTTCCTTTTTTCCCCCTTTTTTTCCCTTTTTTTTTCCGTT CCCTTTTCCCCCTTCTTTCCCTCCCTTTCCCCTTTTTCCCTTCCCTTTTT CCTTTTTTCATTCCTTACTTCCTTCTCTTTTTCCTTTTTTTTCCTTTCCA TTTCTTTTTTTTTTCTCTACACCACTTTTTTTATTATTTTTTCTTTTACG CTTTTTCCCACCCCTCATTTCCTTTATCCCCTCCCCTTTTTCTCCCTTTC CCCCCTTTTCCCCCTTTCTTTTTTTTTTTTTTTCCCACCTCCCCTTTTTA TCCTTTTCCTTTCTTTTCACCCACACTTTCACTGCCCCCTTTCATTTTCC CCTTTCTATTATTCTACGTCACTTTT	CGATGACAGTGGTAGCCTGGCGGCGCCTGGTTCAGACXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXCATTGGAACTTGGAAGATGGATGAGAGAAGTT TTCAGCACCAGATATGATAGTACTCGAAGTGAGGTGACTGTAGGGTAGGC TCTCATCATAGCCCCTGCTGCCTAGGTGATTCGTCAGCAAGGGAAGGGAG TAAACTGGACAGCTCACTGGATAGGGACAGAAATGACTGTAGGCAATATA CCCTCGCCTATCTGTATATTTTATCTGTGTCAGATACTTTATTCCCCCAA TTCCTTGTTCTTCCCTCCTGCCCCAAAACTTTGCTCTGTATCTCCATCTC GCACTTTCTCTTTTTTTCCAGACCCCCTTGTTTTATTGTCTTATTTTCCT CACTCCTTTCCCCCCCCCCTCCCACCCTTTCTTCTTTTCACTTTTATACT TTTTTTATCGTTTCTATTCTCTCTATGTCCCTCTTTTTTTTTCTCCCTTT TTCTATTTCCACTCTCCCCCCATTTCCCTCCCCCATTTTTCTTACCCCAC TCCCCTTCTTTTTTACCCTTCCTTCTCTTTTCTTTCTTTGCCCTCTTCTT TTTTCCCCCCTTTTTTTTTTCACTCCTTTTATCATTTTTTCTTCGTTCTT TTTTTTCTTCTCCCTGTTTCTATTTTTTTTTTTCCCCTTTTTCCTTCCTA TGACCTTTCATTGTCCCCTCGTTTCTCCTTTTTTCCTTCGTCCTTCCTTC CCTCTTTCCTTCCTTTTCTCCTGCTCCCCCCC
quality values	Open. Hide. 6 6 7 6 8 8 8 8 8 8 9 16 12 11 9 9 11 10 10 12 20 24 28 34 34 25 22 31 32 36 36 33 39 41 39 36 23 27 18 14 12 11 15 12 23 23 39 46 47 33 33 33 36 36 33 39 39 39 39 39 32 30 28 21 20 20 32 32 43 43 43 40 40 43 43 43 54 48 43 42 35 32 32 35 35 39 42 48 54 57 59 54 46 46 43 39 39 44 37 42 37 41 47 47 48 57 59 57 57 57 59 43 40 40 46 44 38 22 15 12 12 19 21 30 41 42 59 59 41 28 22 22 21 20 22 19 25 13 13 13 28 29 37 30 30 28 32 30 15 10 10 10 10 10 13 15 28 28 32 32 25 19 12 12 19 22 12 9 9 9 12 11 13 14 15 23 15 14 10 15 8 8 8 8 8 8 6 6 8 8 15 21 18 18 22 22 22 27 23 8 8 8 8 8 6 6 8 8 8 8 6 6 8 8 10 9 10 10 10 10 11 13 13 18 14 8 8 8 6 8 10 13 13 17 8 11 11 12 12 12 12 12 13 12 14 15 8 8 11 12 19 19 8 8 7 7 8 12 28 30 30 18 19 16 16 18 19 16 12 12 18 19 24 20 15 14 14 14 27 24 19 10 10 10 10 14 12 16 22 10 9 9 8 10 8 8 8 8 8 8 9 11 10 10 9 8 8 8 15 11 17 17 24 22 20 15 14 9 8 8 8 8 10 12 10 12 12 9 9 8 8 8 8 13 13 17 14 13 16 10 10 10 19 21 32 25 14 14 8 7 8 6 6 12 9 10 14 10 9 14 13 13 12 10 11 14 14 11 11 12 8 9 8 8 8 10 10 8 8 8 8 11 12 14 10 10 10 11 13 13 11 12 12 9 9 9 9 11 11 12 12 12 12 12 10 15 19 23 28 17 31 27 25 22 13 10 8 8 8 8 8 8 8 13 8 8 8 8 15 15 12 13 15 10 10 9 8 8 8 8 8 7 6 6 6 8 8 15 15 18 14 20 20 20 14 19 16 16 13 10 10 10 17 22 35 22 18 10 9 9 8 10 8 8 8 8 13 25 17 28 22 22 25 25 32 19 17 22 22 20 20 35 15 12 10 8 6 6 6 10 8 9 13 10 11 10 9 9 9 12 17 10 9 9 10 10 19 23 14 11 11 9 14 10 16 18 29 17 15 17 11 11 15 9 9 9 10 8 8 8 8 13 19 22 22 29 27 29 28 33 22 20 27 25 23 16 23 11 11 11 11 11 11 16 15 9 9 9 9 9 22 17 17 18 8 8 10 10 9 10 11 11 11 11 13 12 12 10 19 10 10 9 12 12 9 9 9 9 10 10 10 10 10 10 10 10 16 19 19 19 15 14 24 13 11 10 10 9 9 9 9 11 10 12 12 15 19 24 33 24 14 8 8 8 8 8 8 12 13 15 15 10 10 10 10 10 6 6 6 6 11 15 14 32 31 18 16 8 6 6 6 10 10 19 16 11 11 11 11 17 19 20 20 11 8 8 8 8 8 6 6 6 6 10 13 28 29 25 26 13 12 8 8 8 8 12 14 16 15 16 14 14 22 14 9 8 8 10 13 13 18 31 24 20 13 12 10 10 10 17 17 20 20 19 22 22 20 20 27 28 34 20 20 19 11 9 8 8 8 8 8 8 10 9 9 14 12 10 9 13 9 11 12 24 24 16 15 10 8 8 6 6 6 8 8 9 7 8 6 6 6 6 6 6 6 6 8 15 13 6 6 6 8 8 8 8 8 14 18 18 21 12 9 9 8 8 10 10 8 15 12 10 10 10 14 13 8 8 8 8 10 12 11 11 9 9 9 10 8 11 10 13 10 13 12 11	Open. Hide. 8 8 8 13 13 10 10 9 8 19 8 8 8 19 17 11 19 22 39 30 22 10 10 10 22 22 25 25 8 6 6 7 6 6 6 12 9 9 9 19 22 32 37 37 31 31 31 36 31 31 50 50 42 30 21 15 11 10 9 9 9 11 11 16 16 11 8 8 19 19 30 30 20 23 10 12 12 22 28 43 43 43 37 40 40 40 42 42 48 48 48 39 43 41 43 42 46 46 46 48 48 41 31 31 31 31 36 36 37 32 32 32 41 57 46 46 37 37 37 36 37 39 42 57 43 43 29 32 17 17 25 32 32 23 22 22 32 32 37 37 42 43 39 37 35 35 35 37 43 47 47 57 57 48 42 30 21 15 15 15 29 32 47 43 42 42 33 28 28 27 27 20 32 15 13 13 10 12 8 8 8 12 15 30 21 28 23 28 15 15 12 12 12 12 18 18 12 12 11 12 12 12 11 11 18 16 11 11 11 12 12 24 24 28 17 21 12 12 11 10 10 10 10 10 12 12 12 11 11 12 15 11 11 11 16 12 15 15 12 12 12 12 11 11 11 11 11 10 13 10 11 8 10 8 8 8 8 10 10 10 8 8 8 10 8 10 10 12 12 12 10 11 10 10 9 9 9 9 10 11 11 11 10 9 10 12 12 12 10 16 18 12 12 12 16 16 15 10 10 10 9 9 9 9 10 10 8 8 10 15 12 10 8 8 8 8 8 8 10 11 11 10 10 10 12 12 11 12 15 12 13 21 10 10 10 12 14 13 12 10 8 12 8 8 6 6 8 8 11 11 9 9 9 9 10 10 8 8 8 8 8 8 9 9 8 8 10 10 10 9 11 11 11 11 10 10 9 9 9 9 9 8 8 8 8 8 8 9 9 9 8 8 8 8 10 8 8 8 9 9 8 8 10 10 9 18 18 13 10 10 11 13 18 19 19 16 17 14 12 11 9 12 9 9 9 8 8 8 8 8 8 8 10 10 19 15 12 9 9 8 8 8 8 10 8 8 8 8 8 11 13 14 12 11 8 8 9 8 6 6 6 8 8 8 6 6 8 8 8 8 8 10 10 8 8 9 9 9 12 11 9 9 9 10 10 12 13 22 12 11 12 9 10 10 12 10 12 18 15 15 10 8 8 8 8 8 10 12 10 10 12 12 12 10 10 10 12 16 12 10 9 9 10 19 10 12 12 13 10 15 12 11 11 11 12 12 16 15 9 9 10 10 8 8 8 8 13 8 8 8 8 8 8 8 10 8 8 8 8 13 19 18 16 19 12 11 11 10 9 15 15 11 11 8 8 8 10 10 12 10 10 10 8 8 8 12 12 12 8 10 10 15 13 10 10 8 8 8 13 10 8 8 8 8 11 11 12 8 8 6 6 8 10 16 13 9 9 12 10 8 7 7 7 11 10 10 8 13 11 10 13 9 9 9 10 10 8 8 8 10 12 12 10 8 8 8 8 10 10 11 22 22 19 11 11 11 11 10 10 10 10 10 11 8 8 7 6 15 10 11 8 8 8 15 19 27 26 17 18 12 19 12 10 15 15 14 16 17 20 19 17 12 14 12 17 16 12 10 9 8 8 7 7 8 9 12 8 15 8 6 8 8 6 6 8 7 8 8 8 8 6 9 15 19 19 21 15 15 18 18 21 22 22 19 24 10 8 8 6 6 8 8 9 9 13 10 10 14 8 9 12 12 20 28 21 22 11 11 11 12 15 15 15 12 9 9 12 10 15 13 8 8 8 9 10 11 12 11 11 11 11 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no329_n06.g1 MSMg01no329_n06.g1 CHROMAT_FILE:
MSMg01no329_n06.g1 PHD_FILE: MSMg01no329_n06.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:15:25 2005
         (116 letters)



>mm_chr4_117239961_117240476
          Length = 516

 Score =  209 bits (108), Expect = 5e-59
 Identities = 114/116 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttggaagatggatgagagaagttttcagcaccagatatgatagtactcgaagtgaggtg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 cttggaagatggatgagagaagttttcagcaccagatatgatagtactcgaagtgaggtg 260

                                                                   
Query: 61  actgtagggtaggctctcatcatagcccctgctgcctaggtgattcgtcagcaagg 116
           |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 261 actgtagggtaggctctcatcagagcccctgctgcctaggtgactcgtcagcaagg 316


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 116
Length of database: 516
Length adjustment: 8
Effective length of query: 108
Effective length of database: 508
Effective search space:    54864
Effective search space used:    54864
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information