MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-337C09
Chromosome	4 (Build37)
Map Location	42,538,306 - 42,538,725
singlet/doublet	singlet
Overlap gene	LOC100039995
Upstream gene	Dnaic1, 2310040A07Rik, LOC100042420, Cntfr, 2810432D09Rik, Dctn3, OTTMUSG00000006683, Oprs1, Galt, Il11ra1, Ccl27, LOC100039789, LOC623085, LOC100042466, LOC100042472, LOC100042493, Ccl19-ps1, LOC621580, LOC545611, LOC100042524, LOC100042519, LOC100039817, LOC100042536, LOC100039824, LOC100042539, LOC100042544, LOC100039848, LOC100039863, LOC100042555, 1700045I11Rik, LOC100039894, LOC100039909, EG545605, LOC674214, LOC100038965, LOC100039053, LOC100039193, LOC100039374, LOC100039930, LOC100038993, LOC100039939, Ccl19-ps3, Ccl21c, LOC100039323, LOC665845, LOC100039973, LOC100039986, 4933409K07Rik, LOC100039344
Downstream gene	EG623054, Ccl19-ps2, LOC100039331, LOC100039131, LOC100040035, LOC100040048, Il11ra2, LOC665962, LOC545614, 1700008B15Rik, Ccl19, Ccl21b, LOC100039205, LOC433698, BC049635, N28178, Dnajb5, 1700022I11Rik, Vcp, Fancg, Pigo, Stoml2, B230312A22Rik, Unc13b, 4930417M19Rik, Rusc2, 4833436C18Rik, Tesk1, Cd72, Sit1, Rmrp, LOC622404, E130306D19Rik, Car9, Tpm2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dnaic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68922 MGI:1916172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310040A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69638 MGI:1916888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 29 ESTs

name	LOC100042420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 27 ESTs, 1 Protein

name	Cntfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12804 MGI:99605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810432D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69961 MGI:1917211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dctn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53598 MGI:1859251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000006683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:550619 MGI:3650624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oprs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18391 MGI:1195268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14430 MGI:95638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il11ra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16157 MGI:107426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20301 MGI:1343459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC623085 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 1 Protein

name	LOC100042472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 54 ESTs, 1 Protein pseudo : _no_value

name	LOC100042493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 5 Proteins

name	Ccl19-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65957 MGI:1891387
definition	gene_synonym : ELC; Scya19-ps1 note : chemokine (C-C motif) ligand 19, pseudogene 1 pseudo : _no_value

name	LOC621580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 23 ESTs

name	LOC545611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	LOC100042524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs pseudo : _no_value

name	LOC100042519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 1 Protein pseudo : _no_value

name	LOC100039817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100042536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein

name	LOC100039824 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100042539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC100042544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 54 ESTs, 5 Proteins

name	LOC100039848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100039863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 56 ESTs, 1 Protein

name	LOC100042555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins

name	1700045I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73350 MGI:1920600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100039909 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 1 Protein

name	EG545605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545605 MGI:3704096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 53 ESTs, 1 Protein

name	LOC674214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs pseudo : _no_value

name	LOC100038965 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 6 Proteins

name	LOC100039053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 3 Proteins

name	LOC100039193 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	LOC100039374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein pseudo : _no_value

name	LOC100039930 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins

name	LOC100039939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	Ccl19-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65959 MGI:1891391
definition	gene_synonym : ELC; Scya19-ps3 note : chemokine (C-C motif) ligand 19, pseudogene 3 pseudo : _no_value

name	Ccl21c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65956 MGI:1891386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC665845 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein

name	LOC100039973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC100039986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	4933409K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108816 MGI:1918429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs pseudo : _no_value

name	LOC100039995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	EG623054 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623054 MGI:3643815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Ccl19-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65958 MGI:1891390
definition	gene_synonym : ELC; Scya19-ps2 note : chemokine (C-C motif) ligand 19, pseudogene 2 pseudo : _no_value

name	LOC100039331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein

name	LOC100039131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 55 ESTs, 5 Proteins

name	LOC100040035 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC100040048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein

name	Il11ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16158 MGI:109123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC545614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein

name	1700008B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75445 MGI:1922695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs

name	Ccl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24047 MGI:1346316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl21b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18829 MGI:1349183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs pseudo : _no_value

name	LOC433698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	BC049635 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277773 MGI:2679716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	N28178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230085 MGI:2140712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56323 MGI:1930018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67317 MGI:1914567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vcp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269523 MGI:99919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fancg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60534 MGI:1926471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56703 MGI:1861452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stoml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66592 MGI:1913842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230312A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230088 MGI:2441854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22249 MGI:1342278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930417M19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320571 MGI:2444287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rusc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100213 MGI:2140371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4833436C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329831 MGI:2445194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tesk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21754 MGI:1201675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12517 MGI:88345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54390 MGI:1889342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rmrp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19782 MGI:97937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622404 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130306D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230098 MGI:3036286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230099 MGI:2447188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22004 MGI:98810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnaic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383967 GeneID:68922 MGI:1916172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, intermediate chain 1 transcript_id : NM_175138.3

name	2310040A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252254 GeneID:69638 MGI:1916888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 29 ESTs product : RIKEN cDNA 2310040A07 gene transcript_id : XM_001473388.1

name	LOC100042420 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252294 GeneID:100042420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 27 ESTs, 1 Protein product : similar to 2310040A07Rik protein transcript_id : XM_001478385.1

name	Cntfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710005 GeneID:12804 MGI:99605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ciliary neurotrophic factor receptor transcript_id : NM_016673.1

name	2810432D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312503 GeneID:69961 MGI:1917211
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810432D09 gene transcript_id : NM_027278.1

name	Dctn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380109 GeneID:53598 MGI:1859251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 3 transcript_id : NM_016890.3

name	OTTMUSG00000006683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134244289 GeneID:550619 MGI:3650624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000006683 transcript_id : NM_001017362.2

name	Oprs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892605 GeneID:18391 MGI:1195268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opioid receptor, sigma 1 transcript_id : NM_011014.2

name	Galt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952694 GeneID:14430 MGI:95638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-1-phosphate uridyl transferase transcript_id : NM_016658.2

name	Il11ra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802044 GeneID:16157 MGI:107426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 11 receptor, alpha chain 1 transcript_id : NM_010549.2

name	Ccl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431221 GeneID:20301 MGI:1343459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 27 transcript_id : NM_001048179.1

name	Ccl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755427 GeneID:20301 MGI:1343459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 27 transcript_id : NM_011336.1

name	LOC100039789 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252256 GeneID:100039789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473508.1

name	LOC623085 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252258 GeneID:623085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC623085 transcript_id : XM_001473534.1

name	LOC100042466 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252296 GeneID:100042466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 77 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478493.1

name	LOC100042493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252299 GeneID:100042493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001478541.1

name	LOC621580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252301 GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : hypothetical LOC621580, transcript variant 1 transcript_id : XM_001487802.1

name	LOC621580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252303 GeneID:621580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : hypothetical LOC621580, transcript variant 2 transcript_id : XM_001487803.1

name	LOC545611 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252260 GeneID:545611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : hypothetical LOC545611 transcript_id : XM_620023.4

name	LOC100039817 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252262 GeneID:100039817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100039817 transcript_id : XM_001473592.1

name	LOC100042536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252307 GeneID:100042536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478587.1

name	LOC100039824 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252264 GeneID:100039824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473611.1

name	LOC100042539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252309 GeneID:100042539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001478593.1

name	LOC100042544 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252311 GeneID:100042544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 54 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001478610.1

name	LOC100039848 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252266 GeneID:100039848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473659.1

name	LOC100039863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252268 GeneID:100039863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 56 ESTs, 1 Protein product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001473680.1

name	LOC100042555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252313 GeneID:100042555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins product : similar to interleukin 11 receptor, alpha chain 2 transcript_id : XM_001478617.1

name	1700045I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252270 GeneID:73350 MGI:1920600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700045I11 gene transcript_id : XM_001487791.1

name	LOC100039894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252272 GeneID:100039894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : hypothetical protein LOC100039894 transcript_id : XM_001473735.1

name	LOC100039909 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252274 GeneID:100039909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 48 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001473759.1

name	LOC100038965 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252318 GeneID:100038965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 54 ESTs, 6 Proteins product : similar to TCA4 transcript_id : XM_001471996.1

name	LOC100039053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252322 GeneID:100039053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 12 ESTs, 3 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001472168.1

name	LOC100039193 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252326 GeneID:100039193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001472298.1

name	LOC100039930 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252343 GeneID:100039930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to CG31439-PA transcript_id : XM_001473797.1

name	LOC100038993 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252320 GeneID:100038993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 115 ESTs, 6 Proteins product : similar to interleukin 11 receptor, alpha chain 2 transcript_id : XM_001472054.1

name	LOC100039939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252346 GeneID:100039939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001473820.1

name	Ccl21c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922618 GeneID:65956 MGI:1891386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 21c (leucine) transcript_id : NM_023052.2

name	LOC100039323 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252332 GeneID:100039323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001472444.1

name	LOC665845 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252329 GeneID:665845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_979819.2

name	LOC100039973 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252348 GeneID:100039973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473878.1

name	LOC100039986 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252352 GeneID:100039986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100039986 transcript_id : XM_001473895.1

name	4933409K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657927 GeneID:108816 MGI:1918429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933409K07 gene transcript_id : NM_178649.4

name	LOC100039995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252354 GeneID:100039995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to 4933409K07Rik protein transcript_id : XM_001473914.1

name	EG623054 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252356 GeneID:623054 MGI:3643815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : predicted gene, EG623054 transcript_id : XM_897499.3

name	LOC100039331 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252334 GeneID:100039331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 87 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XM_001472494.1

name	LOC100039131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252324 GeneID:100039131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 55 ESTs, 5 Proteins product : similar to beta chemokine Exodus-2 transcript_id : XM_001472262.1

name	LOC100040035 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252359 GeneID:100040035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to EBI-1 ligand chemokine transcript_id : XM_001473986.1

name	LOC100040048 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149252361 GeneID:100040048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein product : similar to chemokine (C-C motif) ligand 27 transcript_id : XM_001473998.1

name	Il11ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560576 GeneID:16158 MGI:109123
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 11 receptor, alpha chain 2 transcript_id : NM_010550.2

name	LOC665962 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94371725 GeneID:665962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to CG31439-PA transcript_id : XM_980595.1

name	1700008B15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149252330 GeneID:75445 MGI:1922695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs product : RIKEN cDNA 1700008B15 gene transcript_id : XM_001472421.1

name	Ccl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10518345 GeneID:24047 MGI:1346316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 19 transcript_id : NM_011888.2

name	Ccl21b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130240 GeneID:18829 MGI:1349183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 21b transcript_id : NM_011124.4

name	BC049635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375499 GeneID:277773 MGI:2679716
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049635 transcript_id : NM_177785.3

name	N28178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476176 GeneID:230085 MGI:2140712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence N28178 transcript_id : NM_172690.2

name	Dnajb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254371 GeneID:56323 MGI:1930018
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 5 transcript_id : NM_019874.3

name	1700022I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803396 GeneID:67317 MGI:1914567
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700022I11 gene transcript_id : NM_026088.2

name	Vcp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369659 GeneID:269523 MGI:99919
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : valosin containing protein transcript_id : NM_009503.3

name	Fancg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716362 GeneID:60534 MGI:1926471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group G transcript_id : NM_053081.1

name	Pigo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910491 GeneID:56703 MGI:1861452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class O transcript_id : NM_020035.1

name	Stoml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981247 GeneID:66592 MGI:1913842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stomatin (Epb7.2)-like 2 transcript_id : NM_023231.2

name	B230312A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803417 GeneID:230088 MGI:2441854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230312A22 gene transcript_id : NM_172691.2

name	Unc13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487232 GeneID:22249 MGI:1342278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-13 homolog B (C. elegans) transcript_id : NM_001081413.1

name	4930417M19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366050 GeneID:320571 MGI:2444287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930417M19 gene transcript_id : NM_177195.3

name	Rusc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641886 GeneID:100213 MGI:2140371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and SH3 domain containing 2 transcript_id : NM_001037709.1

name	Rusc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83641888 GeneID:100213 MGI:2140371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and SH3 domain containing 2 transcript_id : NM_199057.2

name	4833436C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383707 GeneID:329831 MGI:2445194
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833436C18 gene transcript_id : NM_177377.3

name	Tesk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543856 GeneID:21754 MGI:1201675
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific protein kinase 1 transcript_id : NM_011571.2

name	Cd72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680889 GeneID:12517 MGI:88345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD72 antigen transcript_id : NM_007654.1

name	Sit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802022 GeneID:54390 MGI:1889342
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppression inducing transmembrane adaptor 1 transcript_id : NM_019436.2

name	LOC622404 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:85702295 GeneID:622404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC622404 transcript_id : NM_001037913.1

name	E130306D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701437 GeneID:230098 MGI:3036286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130306D19 gene transcript_id : NM_001013377.1

name	Car9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046219 GeneID:230099 MGI:2447188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 9 transcript_id : NM_139305.2

name	Tpm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892876 GeneID:22004 MGI:98810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomyosin 2, beta transcript_id : NM_009416.3

name	Dnaic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29611661 CCDS:CCDS18066.1 GeneID:68922 MGI:1916172
definition	codon_start : 1 exception : mismatches in translation product : dynein, axonemal, intermediate chain 1 protein_id : NP_780347.1

name	LOC100042420 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252295 GeneID:100042420
definition	codon_start : 1 product : similar to 2310040A07Rik protein protein_id : XP_001478435.1

name	2310040A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252255 GeneID:69638 MGI:1916888
definition	codon_start : 1 product : hypothetical protein LOC69638 protein_id : XP_001473438.1

name	Cntfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710006 CCDS:CCDS18067.1 GeneID:12804 MGI:99605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence IGI] codon_start : 1 exception : mismatches in translation product : ciliary neurotrophic factor receptor protein_id : NP_057882.1

name	2810432D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312504 CCDS:CCDS18068.1 GeneID:69961 MGI:1917211
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69961 protein_id : NP_081554.1

name	Dctn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980821 CCDS:CCDS18069.1 GeneID:53598 MGI:1859251
definition	GO_component : GO:0005869 - dynactin complex [Evidence ISS] [Evidence IDA]; GO:0005875 - microtubule associated complex [Evidence IDA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0007017 - microtubule-based process [Evidence IDA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dynactin light chain (P24); p24 dynactin light chain product : dynactin 3 protein_id : NP_058586.2

name	OTTMUSG00000006683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62865645 GeneID:550619 MGI:3650624
definition	codon_start : 1 note : AT rich interactive domain 3C (Bright like) product : AT rich interactive domain 3C protein_id : NP_001017362.1

name	Oprs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754942 CCDS:CCDS18070.1 GeneID:18391 MGI:1195268
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0000247 - C-8 sterol isomerase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA] GO_process : GO:0006696 - ergosterol biosynthesis [Evidence IEA] codon_start : 1 product : opioid receptor, sigma 1 protein_id : NP_035144.1

name	Galt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952695 GeneID:14430 MGI:95638
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008108 - UDP-glucose:hexose-1-phosphate uridylyltransferase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006012 - galactose metabolism [Evidence IMP] codon_start : 1 product : galactose-1-phosphate uridyl transferase protein_id : NP_057867.2

name	Il11ra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110651 CCDS:CCDS18071.1 GeneID:16157 MGI:107426
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004921 - interleukin-11 receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0001779 - natural killer cell differentiation [Evidence IMP] codon_start : 1 note : locus 2; interleukin 11 receptor, alpha chain 2 product : interleukin 11 receptor, alpha chain 1 protein_id : NP_034679.1

name	Ccl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431222 GeneID:20301 MGI:1343459
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; small inducible cytokine A27; chemokine (C-C motif) ligand 27a; small inducible cytokine A27a; skinkine; skinskine; chemokine (C-C motif) ligand 27b; small inducible cytokine A27b product : chemokine (C-C motif) ligand 27 isoform b protein_id : NP_001041644.1

name	Ccl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755428 CCDS:CCDS18072.1 GeneID:20301 MGI:1343459
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; small inducible cytokine A27; chemokine (C-C motif) ligand 27a; small inducible cytokine A27a; skinkine; skinskine; chemokine (C-C motif) ligand 27b; small inducible cytokine A27b product : chemokine (C-C motif) ligand 27 isoform a protein_id : NP_035466.1

name	LOC100039789 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252257 GeneID:100039789
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473558.1

name	LOC623085 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252259 GeneID:623085
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473584.1

name	LOC100042466 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252297 GeneID:100042466
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478543.1

name	LOC100042493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252300 GeneID:100042493
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001478591.1

name	LOC621580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252302 GeneID:621580
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487852.1

name	LOC621580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252304 GeneID:621580
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487853.1

name	LOC545611 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252261 GeneID:545611
definition	codon_start : 1 product : hypothetical protein protein_id : XP_620023.2

name	LOC100039817 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252263 GeneID:100039817
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473642.1

name	LOC100039824 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252265 GeneID:100039824
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473661.1

name	LOC100042536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252308 GeneID:100042536
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478637.1

name	LOC100042539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252310 GeneID:100042539
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001478643.1

name	LOC100042544 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252312 GeneID:100042544
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001478660.1

name	LOC100039848 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252267 GeneID:100039848
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473709.1

name	LOC100039863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252269 GeneID:100039863
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001473730.1

name	LOC100042555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252314 GeneID:100042555
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478667.1

name	1700045I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252271 GeneID:73350 MGI:1920600
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487841.1

name	LOC100039894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252273 GeneID:100039894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473785.1

name	LOC100039909 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252275 GeneID:100039909
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001473809.1

name	LOC100038965 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252319 GeneID:100038965
definition	codon_start : 1 product : similar to TCA4 protein_id : XP_001472046.1

name	LOC100039053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252323 GeneID:100039053
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001472218.1

name	LOC100039193 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252327 GeneID:100039193
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001472348.1

name	LOC100039930 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252344 GeneID:100039930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473847.1

name	LOC100038993 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252321 GeneID:100038993
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472104.1

name	LOC100039939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252347 GeneID:100039939
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001473870.1

name	Ccl21c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14547895 GeneID:65956 MGI:1891386
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : small inducible cytokine A21c; Ccl21-leu; novel protein similar to chemokine (C-C motif) ligand 21b (serine) Ccl21b product : chemokine (C-C motif) ligand 21c (serine) protein_id : NP_075539.1

name	LOC100039323 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252333 GeneID:100039323
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001472494.1

name	LOC665845 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371716 GeneID:665845
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_984913.1

name	LOC100039973 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252349 GeneID:100039973
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001473928.1

name	LOC100039986 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252353 GeneID:100039986
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473945.1

name	4933409K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657928 GeneID:108816 MGI:1918429
definition	codon_start : 1 product : hypothetical protein LOC108816 protein_id : NP_848764.3

name	LOC100039995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252355 GeneID:100039995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473964.1

name	EG623054 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252357 GeneID:623054 MGI:3643815
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902592.3

name	LOC100039331 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252335 GeneID:100039331
definition	codon_start : 1 product : similar to 4933409K07Rik protein protein_id : XP_001472544.1

name	LOC100039131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252325 GeneID:100039131
definition	codon_start : 1 product : similar to beta chemokine Exodus-2 protein_id : XP_001472312.1

name	LOC100040035 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252360 GeneID:100040035
definition	codon_start : 1 product : similar to EBI-1 ligand chemokine protein_id : XP_001474036.1

name	LOC100040048 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149252362 GeneID:100040048
definition	codon_start : 1 product : similar to chemokine (C-C motif) ligand 27 protein_id : XP_001474048.1

name	Il11ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560577 CCDS:CCDS18078.1 GeneID:16158 MGI:109123
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004921 - interleukin-11 receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : locus 2 product : interleukin 11 receptor, alpha chain 2 protein_id : NP_034680.2

name	LOC665962 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94371726 GeneID:665962
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985689.1

name	1700008B15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149252331 GeneID:75445 MGI:1922695
definition	codon_start : 1 product : hypothetical protein LOC75445 protein_id : XP_001472471.1

name	Ccl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755422 CCDS:CCDS18080.1 GeneID:24047 MGI:1346316
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 function : strongly attracts lymphocytes note : small inducible cytokine A19; EBI-1 ligand chemokine; EBV-induced molecule 1 ligand chemokine; chemokine CCL19; attracts mature dendritic cells and naive T cells product : chemokine (C-C motif) ligand 19 protein_id : NP_036018.1

name	Ccl21b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14547891 CCDS:CCDS18081.1 GeneID:18829 MGI:1349183
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0050930 - induction of positive chemotaxis [Evidence IDA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0048535 - lymph node development [Evidence IMP] codon_start : 1 note : small inducible cytokine A21b; exodus-2; chemokine (C-C motif) ligand 21b (serine) product : chemokine (C-C motif) ligand 21a (serine) protein_id : NP_035254.1

name	BC049635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244306 CCDS:CCDS18082.1 GeneID:277773 MGI:2679716
definition	codon_start : 1 product : hypothetical protein LOC277773 protein_id : NP_808453.1

name	N28178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369996 CCDS:CCDS18083.1 GeneID:230085 MGI:2140712
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC230085 protein_id : NP_766278.1

name	Dnajb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845259 CCDS:CCDS18084.1 GeneID:56323 MGI:1930018
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : heat shock protein hsp40-3; DnaJ (Hsp40) homolog subfamily B member 5 product : DnaJ (Hsp40) homolog, subfamily B, member 5 protein_id : NP_063927.1

name	1700022I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315979 GeneID:67317 MGI:1914567
definition	codon_start : 1 product : hypothetical protein LOC67317 protein_id : NP_080364.1

name	Vcp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30023842 CCDS:CCDS18086.1 GeneID:269523 MGI:99919
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016887 - ATPase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006919 - caspase activation [Evidence IDA]; GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0045184 - establishment of protein localization [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence ISS]; GO:0030970 - retrograde protein transport, ER to cytosol [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0030968 - unfolded protein response [Evidence ISS] codon_start : 1 exception : mismatches in translation note : transitional endoplasmic reticulum ATPase; homolog of yeast cdc48 product : valosin containing protein protein_id : NP_033529.2

name	Fancg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716363 CCDS:CCDS18087.1 GeneID:60534 MGI:1926471
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IMP]; GO:0009314 - response to radiation [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 function : putative DNA repair protein note : Fanconi anemia complementation group G product : Fanconi anemia, complementation group G protein_id : NP_444311.1

name	Pigo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910492 CCDS:CCDS18088.1 GeneID:56703 MGI:1861452
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016780 - phosphotransferase activity, for other substituted phosphate groups [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence IDA] [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol glycan, class O protein_id : NP_064419.1

name	Stoml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963591 CCDS:CCDS18089.1 GeneID:66592 MGI:1913842
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : stomatin-like protein 2 protein_id : NP_075720.1

name	B230312A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370006 CCDS:CCDS18090.1 GeneID:230088 MGI:2441854
definition	codon_start : 1 product : hypothetical protein LOC230088 protein_id : NP_766279.1

name	Unc13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487233 GeneID:22249 MGI:1342278
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0001566 - non-kinase phorbol ester receptor activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0016082 - synaptic vesicle priming [Evidence IMP] codon_start : 1 note : unc13 homolog 1; unc-13 homolog A product : unc-13 homolog B protein_id : NP_001074882.1

name	4930417M19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126366051 CCDS:CCDS18091.1 GeneID:320571 MGI:2444287
definition	GO_function : GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA] codon_start : 1 product : testis flippase protein_id : NP_796169.2

name	Rusc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83641887 CCDS:CCDS18092.1 GeneID:100213 MGI:2140371
definition	codon_start : 1 product : RUN and SH3 domain containing 2 protein_id : NP_001032798.1

name	Rusc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83641889 CCDS:CCDS18092.1 GeneID:100213 MGI:2140371
definition	codon_start : 1 product : RUN and SH3 domain containing 2 protein_id : NP_951012.2

name	4833436C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893535 GeneID:329831 MGI:2445194
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC329831 protein_id : NP_796351.1

name	Tesk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543857 CCDS:CCDS18094.1 GeneID:21754 MGI:1201675
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : testis specific protein kinase 1 protein_id : NP_035701.2

name	Cd72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680890 GeneID:12517 MGI:88345
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : CD72 antigen protein_id : NP_031680.1

name	Sit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507101 CCDS:CCDS18096.1 GeneID:54390 MGI:1889342
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SHP2 interacting transmembrane adaptor protein product : SHP2-interacting transmembrane adaptor protein protein_id : NP_062309.1

name	LOC622404 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85702296 CCDS:CCDS18097.1 GeneID:622404
definition	codon_start : 1 product : hypothetical protein LOC622404 protein_id : NP_001033002.1

name	E130306D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701438 CCDS:CCDS18098.1 GeneID:230098 MGI:3036286
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230098 protein_id : NP_001013395.1

name	Car9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046220 CCDS:CCDS18099.1 GeneID:230099 MGI:2447188
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0002009 - morphogenesis of an epithelium [Evidence IMP]; GO:0046903 - secretion [Evidence IMP] codon_start : 1 product : carbonic anhydrase 9 protein_id : NP_647466.2

name	Tpm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11875203 CCDS:CCDS18100.1 GeneID:22004 MGI:98810
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005862 - muscle thin filament tropomyosin [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence TAS] codon_start : 1 product : tropomyosin 2, beta protein_id : NP_033442.2

name	LOC433698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433698
definition	number : 4 pseudo : _no_value

name	LOC433698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433698
definition	number : 3 pseudo : _no_value

name	LOC433698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433698
definition	number : 2 pseudo : _no_value

name	LOC433698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:433698
definition	number : 1 pseudo : _no_value

name	LOC100042472 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252298 GeneID:100042472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 54 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_033727.1

name	LOC100042524 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252306 GeneID:100042524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs product : similar to RIKEN cDNA 4933409K07 gene pseudo : _no_value transcript_id : XR_033762.1

name	LOC100042519 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252305 GeneID:100042519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_033754.1

name	EG545605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149252315 GeneID:545605 MGI:3704096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 53 ESTs, 1 Protein product : predicted gene, EG545605 transcript_id : XR_033794.1

name	LOC674214 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252317 GeneID:674214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_030504.1

name	LOC100039374 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252337 GeneID:100039374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_030760.1

name	LOC100039344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252336 GeneID:100039344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 77 ESTs product : similar to RIKEN cDNA 4933409K07 gene pseudo : _no_value transcript_id : XR_030749.1

name	LOC545614 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252338 GeneID:545614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 57 ESTs, 1 Protein product : similar to 4933409K07Rik protein transcript_id : XR_001565.2

name	LOC100039205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149252328 GeneID:100039205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 66 ESTs product : similar to 4933409K07Rik protein pseudo : _no_value transcript_id : XR_030661.1

name	Rmrp (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:32526884 GeneID:19782 MGI:97937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA component of mitochondrial RNAase P transcript_id : NR_001460.1

clone name	MSMg01-478C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-499G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-296B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283G23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-337C09.T7 (MSMg01no337_c09.b1)	MSMg01-337C09.TJ (MSMg01no337_c09.g1)
ACC	AG451997	AG451998
length	747	763
length of high quality (start - end)	593 (65 - 657)	420 (75 - 494)
definition	CHROMAT_FILE: MSMg01no337_c09.b1 PHD_FILE: MSMg01no337_c09.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:25:26 2005	CHROMAT_FILE: MSMg01no337_c09.g1 PHD_FILE: MSMg01no337_c09.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 22:25:26 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	AXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAAT TCCAGAAGATCCCGGAGTAGCTGGTGAGTAGGCCGCCAGCAAGGCTTTCT TTTGTAGAGGAGGAGCCCTACTTGGCTGAGCCTCTAGAGAAGCTCACTGC TGAATGCTGGGTCAGAGGGACCCCCAGTGTAAATCATCATACACTGCTGA AGGCACATACAGCAATGTCTTCACACAGATAGGCTGGAGGACGTCATCCA CACATACTTCTCTGGAGAAGGCGTCACGTGTTTTAGCACAAGGGCTGCAC AGGTCCTGTTCAGGCTCCTTTCATGTAACCTTTGCCCAGGACTCCACCAA GATGGCATGCAGGCTGAGTCACATTGATGTTTTTGTTTGTTTGTTTGTTT GTTTGTTTTTGTTCTGTTTTAAGAAAAGGTCTTGCTATGTATGCTGGTCT CTAGTTCATGATGGCCGTGCTGGGATCCCAGGTGTGCAAGCACCATGTCC AATGGACTCTGATGCTATCGTCCTGATTGGTCTGAATGGCAGCTGAGGCT CATGCATTATTAATACCACCTACTCTGGGCCACTCCCACTAATCAGACAT TCCTAGTCGTGTTATACACGCTACGATTTTCTTTCTTTTATAATCTCTAA GTTTTTGGGTATAGCTTTTCTTCATTCTTGAAAATTCCCACATGATATAT GACAATACTCTTTTTCAATTTCCCCCCAACTCCTTCTTTTTCCCACC	TGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXAGCCTGCGAGCGTGCTGAGGGATGAA GAAAAGCTCTCTGGTGAGAGCTGAGAAGGGTTTTCCTGGCCCGAAAAATT TTAAAGTCTCACGTGGCTTGGCTTTATTCCATGGCTTATGCTTATACTGC GTGTGGCTCTGCACACGTGGAGGTCTAGCGATGACAGCCGGCAGGCCCCA CTGAAGCTGAAGCTGTCTTTGTAGAAGATGCCACTCCAAAGTTTTACATT CTGACAGAGTCAGAAATGGAACACCACCGATCTGAGCTCTTTGAGGCTCA TCCAAAGACTCATTTGGAGAAGTTGAAGAAGGGGGCGGGGCTGCCTCAGG TAAGGGAATAGGCGGCGACACCTTCAAGAAATGAGGCTCTTTGTAGGGGG GTTTGAGTGTATTCTTGGAGACACCTTGAGTGCACAAGAAGGTGGACCCC ATGGATTCACTATGCATATAATGTAGACCGCATAATAACTGAGCGTACCT CCTTCTGAACATTGCTCTTGTATTCATCCAATTGTCCCCTCTGCGTAATA CATACGTCTTGTTCTATTTCCTAGATCCTTGCTGATCAATGTCTTTTCCC ATTGTTTTTTTAACCTCTTTCTTATTAAACCCTTCCTCTTTCTATCTTTC TACTCCCCCATTTCTACTCCCTTATTTATTGTTATCTCCTGTTTTCGTCC AATTCTTCTCTCT
quality values	Open. Hide. 9 9 9 11 17 22 27 13 6 6 6 10 10 23 24 28 28 28 29 28 44 48 23 22 17 17 17 19 21 9 9 9 16 14 17 17 19 13 14 18 24 28 28 43 43 43 22 19 19 21 29 24 25 24 19 21 12 9 9 11 11 11 11 9 9 20 23 39 36 39 43 48 48 53 57 53 53 53 53 57 57 59 59 59 57 57 48 48 48 57 57 54 54 57 68 68 68 68 68 68 68 68 68 68 68 54 57 54 59 59 59 59 59 59 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 59 59 57 57 57 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 68 68 59 59 57 57 57 52 52 57 57 57 59 52 52 52 57 57 57 57 57 68 68 68 57 57 59 59 59 59 59 59 57 57 59 59 59 57 57 57 57 57 57 57 57 57 59 59 57 57 57 57 57 57 59 59 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 52 62 62 62 62 62 52 52 52 62 62 62 62 68 68 68 68 68 68 68 62 62 52 52 52 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 45 45 45 59 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 52 52 52 59 59 59 59 59 59 57 57 59 59 59 68 68 68 68 68 68 59 59 57 52 52 50 50 38 42 42 50 44 57 52 52 52 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 43 43 44 44 48 48 47 46 43 57 57 57 57 57 48 44 44 44 43 43 42 44 35 35 35 47 39 39 39 37 37 37 43 43 48 48 48 48 42 46 48 59 59 59 48 48 48 47 47 47 50 57 59 59 59 59 59 48 57 37 39 37 37 37 37 39 43 41 41 28 22 22 28 22 22 37 39 41 39 47 47 35 35 37 37 37 37 37 28 28 23 41 41 43 40 39 37 32 30 30 28 22 18 22 22 34 34 47 41 37 37 32 29 26 29 34 25 28 32 59 37 37 37 30 30 28 20 17 23 19 19 19 14 18 22 34 34 48 48 57 48 48 48 48 39 39 26 26 14 15 15 28 26 28 23 28 28 32 32 19 10 10 10 17 17 16 30 37 29 36 35 28 24 27 19 12 12 24 24 28 20 21 11 11 12 21 25 34 33 25 25 18 12 10 11 13 18 22 19 8 8 8 10 15 37 30 17 17 10 10 10 20 15 11 11 9 8 8 8 8 11 27 16 24 20 20 20 23 11 11 7 7 6 8 8 8 8 12 13 14 14 9 9 13 15 13 13 10 13 19 20 22 19 13 9 9 9 9 10 11 11 10 10 8 9 8 8 8 8 8 8 8 8 12 16 17 19 19 10 7 6 6 6	Open. Hide. 8 8 8 8 8 21 15 17 11 10 10 18 25 31 37 41 43 39 39 44 39 39 44 37 30 21 17 9 9 9 10 10 9 11 11 11 21 21 39 36 36 27 23 11 11 11 21 21 50 50 50 41 27 15 9 9 9 9 9 15 9 12 12 27 21 31 31 31 36 35 30 30 32 35 47 57 57 59 59 57 57 57 57 57 57 59 59 68 68 68 68 68 68 42 42 41 41 41 42 57 68 68 68 68 68 68 68 68 68 57 57 59 57 54 59 59 59 59 68 68 68 57 57 57 57 54 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 57 57 57 62 62 62 54 54 54 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 57 59 43 35 35 43 32 35 20 20 20 27 35 42 57 57 59 57 57 57 68 68 68 59 59 59 59 59 59 59 68 68 68 57 57 57 57 57 59 59 59 57 57 57 57 57 43 43 52 59 57 57 57 59 59 59 59 59 59 59 57 57 57 57 57 57 59 57 57 59 59 59 57 57 54 54 52 59 43 43 43 57 59 59 59 59 59 50 43 43 44 44 29 27 27 41 36 30 32 29 15 10 13 10 10 10 10 10 12 24 44 57 57 57 57 57 44 39 39 37 43 43 44 44 48 48 48 48 48 54 59 59 46 39 39 42 39 39 30 30 30 39 39 43 43 43 43 40 40 40 43 43 43 42 42 27 27 15 17 12 16 12 12 12 28 30 41 46 39 32 15 10 8 8 8 15 16 28 29 24 28 20 21 12 12 12 19 25 25 23 9 9 9 9 10 19 25 25 13 13 13 22 19 18 12 11 11 12 13 10 9 12 9 9 9 9 9 9 10 10 8 8 10 8 9 9 13 13 13 12 10 15 11 11 11 11 11 11 10 10 9 17 17 10 10 10 10 10 16 16 11 11 12 18 18 15 12 6 6 6 7 10 12 12 12 10 10 10 12 12 10 10 10 12 16 17 12 14 14 15 11 8 8 11 13 8 8 8 8 10 8 10 11 19 11 15 15 14 19 19 21 15 13 7 6 8 6 10 10 17 15 15 8 8 8 6 6 8 8 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 19 17 9 8 10 8 8 8 8 8 8 13 12 10 15 11 8 8 6 6 8 8 8 8 10 8 7 10 8 9 10 12 11 10 10 9 9 9 10 10 8 11 11 17 10 10 6 6 6 6 8 10 11 10 9 8 10 8 8 8 10 12 19 15 8 8 8 8 13 13 22 18 11 11 11 19 12 8 8 8 8 10 7 9 9 9 9 8 8 8 8 8 8 8 8 6 8 8 8 13 8 8 8 8 6 6 8 8 8 8 10 13 8 9 9 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no337_c09.g1 MSMg01no337_c09.g1 CHROMAT_FILE:
MSMg01no337_c09.g1 PHD_FILE: MSMg01no337_c09.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 22:25:26 2005
         (420 letters)



>mm_chr4_42538106_42538925
          Length = 820

 Score =  797 bits (412), Expect = 0.0
 Identities = 418/420 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   agcctgcgagcgtgctgagggatgaagaaaagctctctggtgagagctgagaagggtttt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 agcctgcgagcgtgctgagggatgaagaaaagctctctggtgagagctgagaagggtttt 260

                                                                       
Query: 61  cctggcccgaaaaattttaaagtctcacgtggcttggctttattccatggcttatgctta 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 cctggcccgaaaaattttaaagtctcacgtggcttggctttattccatggcttatgctta 320

                                                                       
Query: 121 tactgcgtgtggctctgcacacgtggaggtctagcgatgacagccggcaggccccactga 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tactgcgtgtggctctgcacacgtggaggtctagcgatgacagccggcaggccccactga 380

                                                                       
Query: 181 agctgaagctgtctttgtagaagatgccactccaaagttttacattctgacagagtcaga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 agctgaagctgtctttgtagaagatgccactccaaagttttacattctgacagagtcaga 440

                                                                       
Query: 241 aatggaacaccaccgatctgagctctttgaggctcatccaaagactcatttggagaagtt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 aatggaacaccaccgatctgagctctttgaggctcatccaaagactcatttggagaagtt 500

                                                                       
Query: 301 gaagaagggggcggggctgcctcaggtaagggaataggcggcgacaccttcaagaaatga 360
           |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 501 gaagaagggggcggggctgcctcaggtaagggaataggtggggacaccttcaagaaatga 560

                                                                       
Query: 361 ggctctttgtaggggggtttgagtgtattcttggagacaccttgagtgcacaagaaggtg 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ggctctttgtaggggggtttgagtgtattcttggagacaccttgagtgcacaagaaggtg 620


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 420
Length of database: 820
Length adjustment: 9
Effective length of query: 411
Effective length of database: 811
Effective search space:   333321
Effective search space used:   333321
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information