MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-382J16
Chromosome	4 (Build37)
Map Location	149,647,098 - 149,647,347
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Kif1b, LOC100041794, Ube4b, Rbp7, LOC627985, Nmnat1, Lzic, Ctnnbip1, Clstn1, Pik3cd, D4Ertd429e, Slc25a33, Spsb1, H6pd, Gpr157, Slc2a5, LOC435818, Car6, LOC100041882, Eno1
Downstream gene	LOC666880, LOC384091, Rere, Slc45a1, LOC677027, Errfi1, Park7, Tnfrsf9, Uts2, Per3, Vamp3, Camta1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Kif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16561 MGI:108426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Ube4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63958 MGI:1927086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63954 MGI:1890409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627985 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 152 ESTs, 6 Proteins

name	Nmnat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66454 MGI:1913704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lzic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69151 MGI:1916401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctnnbip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67087 MGI:1915756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clstn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65945 MGI:1929895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3cd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18707 MGI:1098211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	D4Ertd429e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc25a33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70556 MGI:1917806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spsb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74646 MGI:1921896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H6pd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100198 MGI:2140356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269604 MGI:2442046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56485 MGI:1928369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Car6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12353 MGI:1333786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 222 ESTs, 6 Proteins pseudo : _no_value

name	Eno1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13806 MGI:95393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC384091 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 2 Proteins

name	Rere (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68703 MGI:2683486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 244 ESTs, 4 Proteins

name	Slc45a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242773 MGI:2653235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677027 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 7 Proteins pseudo : _no_value

name	Errfi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74155 MGI:1921405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Park7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57320 MGI:2135637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21942 MGI:1101059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Uts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24111 MGI:1346329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Per3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18628 MGI:1277134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22319 MGI:1321389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100072 MGI:2140230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990459 GeneID:16561 MGI:108426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1B transcript_id : NM_207682.2

name	Kif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990457 GeneID:16561 MGI:108426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1B transcript_id : NM_008441.2

name	LOC100041794 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253325 GeneID:100041794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041794 transcript_id : XM_001477015.1

name	Ube4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376690 GeneID:63958 MGI:1927086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitination factor E4B, UFD2 homolog (S. cerevisiae) transcript_id : NM_022022.2

name	Rbp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379956 GeneID:63954 MGI:1890409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol binding protein 7, cellular transcript_id : NM_022020.2

name	LOC627985 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253358 GeneID:627985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 152 ESTs, 6 Proteins product : hypothetical LOC627985 transcript_id : XM_892701.3

name	Nmnat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57527869 GeneID:66454 MGI:1913704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicotinamide nucleotide adenylyltransferase 1 transcript_id : NM_133435.1

name	Lzic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801169 GeneID:69151 MGI:1916401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper and CTNNBIP1 domain containing transcript_id : NM_026963.3

name	Ctnnbip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158702 GeneID:67087 MGI:1915756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin beta interacting protein 1 transcript_id : NM_023465.3

name	Clstn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372647 GeneID:65945 MGI:1929895
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calsyntenin 1 transcript_id : NM_023051.2

name	Pik3cd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067113 GeneID:18707 MGI:1098211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase catalytic delta polypeptide transcript_id : NM_008840.2

name	Pik3cd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067115 GeneID:18707 MGI:1098211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase catalytic delta polypeptide transcript_id : NM_001029837.1

name	D4Ertd429e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68342031 GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 429, expressed transcript_id : NM_001025106.1

name	D4Ertd429e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68342039 GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 429, expressed transcript_id : NM_177672.3

name	Slc25a33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647274 GeneID:70556 MGI:1917806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 33 transcript_id : NM_027460.2

name	Spsb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541968 GeneID:74646 MGI:1921896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splA/ryanodine receptor domain and SOCS box containing 1 transcript_id : NM_029035.2

name	H6pd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382659 GeneID:100198 MGI:2140356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) transcript_id : NM_173371.3

name	Gpr157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815862 GeneID:269604 MGI:2442046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 157 transcript_id : NM_177366.3

name	Slc2a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801986 GeneID:56485 MGI:1928369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 5 transcript_id : NM_019741.3

name	LOC435818 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253359 GeneID:435818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : novel member of the solute carrier family 2 (facilitated glucose transporter) Slc2 family transcript_id : XM_001480126.1

name	Car6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753269 GeneID:12353 MGI:1333786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 6 transcript_id : NM_009802.1

name	Eno1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963490 GeneID:13806 MGI:95393
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enolase 1, alpha non-neuron transcript_id : NM_023119.1

name	LOC666880 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253328 GeneID:666880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to Y59A8B.19 transcript_id : XM_986762.2

name	LOC384091 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372794 GeneID:384091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 2 Proteins product : similar to Snrpf protein transcript_id : XM_357414.2

name	Rere (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372852 GeneID:68703 MGI:2683486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 244 ESTs, 4 Proteins product : arginine glutamic acid dipeptide (RE) repeats, transcript variant 1 transcript_id : XM_204015.5

name	Slc45a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75709221 GeneID:242773 MGI:2653235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 45, member 1 transcript_id : NM_173774.3

name	Errfi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526961 GeneID:74155 MGI:1921405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ERBB receptor feedback inhibitor 1 transcript_id : NM_133753.1

name	Park7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181131 GeneID:57320 MGI:2135637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Parkinson disease (autosomal recessive, early onset) 7 transcript_id : NM_020569.1

name	Tnfrsf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117422436 GeneID:21942 MGI:1101059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 9 transcript_id : NM_011612.2

name	Tnfrsf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117422434 GeneID:21942 MGI:1101059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 9 transcript_id : NM_001077508.1

name	Tnfrsf9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117422438 GeneID:21942 MGI:1101059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 9 transcript_id : NM_001077509.1

name	Uts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755930 GeneID:24111 MGI:1346329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urotensin 2 transcript_id : NM_011910.1

name	Per3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922673 GeneID:18628 MGI:1277134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : period homolog 3 (Drosophila) transcript_id : NM_011067.2

name	Vamp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365904 GeneID:22319 MGI:1321389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 3 transcript_id : NM_009498.4

name	Camta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719158 GeneID:100072 MGI:2140230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin binding transcription activator 1 transcript_id : NM_001081557.1

name	Kif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990460 CCDS:CCDS18956.1 GeneID:16561 MGI:108426
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IDA]; GO:0019894 - kinesin binding [Evidence ISS]; GO:0008017 - microtubule binding [Evidence TAS]; GO:0003777 - microtubule motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0009790 - embryonic development [Evidence NAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0047497 - mitochondrion transport along microtubule [Evidence IDA]; GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2; kinesin heavy chain member 1B; Kif1b beta; Kif1b alpha; N-3 kinesin product : kinesin family member 1B isoform b protein_id : NP_997565.2

name	Kif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990458 CCDS:CCDS18957.1 GeneID:16561 MGI:108426
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IDA]; GO:0019894 - kinesin binding [Evidence ISS]; GO:0008017 - microtubule binding [Evidence TAS]; GO:0003777 - microtubule motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0009790 - embryonic development [Evidence NAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0047497 - mitochondrion transport along microtubule [Evidence IDA]; GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1; kinesin heavy chain member 1B; Kif1b beta; Kif1b alpha; N-3 kinesin product : kinesin family member 1B isoform a protein_id : NP_032467.2

name	LOC100041794 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253326 GeneID:100041794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477065.1

name	Ube4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968158 CCDS:CCDS18958.1 GeneID:63958 MGI:1927086
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence TAS] [Evidence IEA] GO_function : GO:0019899 - enzyme binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence TAS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0006457 - protein folding [Evidence NAS]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence TAS]; GO:0009411 - response to UV [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : ubiquitination factor E4B (homologous to yeast UFD2) product : ubiquitination factor E4B protein_id : NP_071305.1

name	Rbp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968156 CCDS:CCDS18959.1 GeneID:63954 MGI:1890409
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence IDA]; GO:0019841 - retinol binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cytosolic binding protein; cellular retinol binding protein type III product : retinol binding protein 7, cellular protein_id : NP_071303.1

name	LOC627985 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82896077 GeneID:627985
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897794.1

name	Nmnat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57527870 CCDS:CCDS18960.1 GeneID:66454 MGI:1913704
definition	EC_number : 2.7.7.1 GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000309 - nicotinamide-nucleotide adenylyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0004515 - nicotinate-nucleotide adenylyltransferase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0009435 - NAD biosynthesis [Evidence IDA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : nicotinamide mononucleotide adenylyl transferase; NMN adenylyltransferase; nicotinamide mononucleotide adenylyl transferase; NAD(+) diphosphorylase; NAD(+) pyrophosphorylase; deamido-NAD(+) diphosphorylase; deamido-NAD(+) pyrophosphorylase; nicotinate-nucleotide adenylyltransferase; nicotinamide/nicotinate mononucleotide adenylyltransferase 1 product : nicotinamide nucleotide adenylyltransferase 1 protein_id : NP_597679.1

name	Lzic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229082 CCDS:CCDS18961.1 GeneID:69151 MGI:1916401
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008013 - beta-catenin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : leucine zipper and CTNNBIP1 domain containing protein_id : NP_081239.1

name	Ctnnbip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13374561 GeneID:67087 MGI:1915756
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IPI] codon_start : 1 product : catenin, beta interacting protein 1 protein_id : NP_075954.1

name	Clstn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746426 CCDS:CCDS18963.1 GeneID:65945 MGI:1929895
definition	GO_component : GO:0005576 - extracellular region [Evidence IEP]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEP] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA] [Evidence NAS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence TAS]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence NAS] codon_start : 1 note : calsyntenin-1; alcadein alpha product : calsyntenin 1 protein_id : NP_075538.1

name	Pik3cd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067116 GeneID:18707 MGI:1098211
definition	GO_component : GO:0005942 - phosphoinositide 3-kinase complex [Evidence IEA] GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IEA]; GO:0046934 - phosphatidylinositol-4,5-bisphosphate 3-kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IMP]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : p100 delta; phosphatidylinositol 3-kinase catalytic subunit delta; phosphatidylinositol 3-kinase p110 delta; phosphoinositide 3 kinase P110delta product : phosphatidylinositol 3-kinase catalytic delta polypeptide protein_id : NP_001025008.1

name	Pik3cd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067114 GeneID:18707 MGI:1098211
definition	GO_component : GO:0005942 - phosphoinositide 3-kinase complex [Evidence IEA] GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IEA]; GO:0046934 - phosphatidylinositol-4,5-bisphosphate 3-kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IMP]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : p100 delta; phosphatidylinositol 3-kinase catalytic subunit delta; phosphatidylinositol 3-kinase p110 delta; phosphoinositide 3 kinase P110delta product : phosphatidylinositol 3-kinase catalytic delta polypeptide protein_id : NP_032866.2

name	D4Ertd429e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68342032 CCDS:CCDS18964.1 GeneID:230917 MGI:1196277
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC230917 isoform a protein_id : NP_001020277.1

name	D4Ertd429e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68342040 CCDS:CCDS18965.1 GeneID:230917 MGI:1196277
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC230917 isoform b protein_id : NP_808340.2

name	Slc25a33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647275 GeneID:70556 MGI:1917806
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : novel mitochondrial carrier protein domains containing protein product : mitochondrial carrier protein protein_id : NP_081736.2

name	Spsb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18141301 CCDS:CCDS18966.1 GeneID:74646 MGI:1921896
definition	codon_start : 1 product : SPRY domain-containing SOCS box protein SSB-1 protein_id : NP_083311.1

name	H6pd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982147 CCDS:CCDS18967.1 GeneID:100198 MGI:2140356
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0017057 - 6-phosphogluconolactonase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0047936 - glucose 1-dehydrogenase activity [Evidence IEA]; GO:0004345 - glucose-6-phosphate 1-dehydrogenase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006098 - pentose-phosphate shunt [Evidence IDA] codon_start : 1 note : glucose-6-phosphate dehydrogenase 1 product : hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) protein_id : NP_775547.2

name	Gpr157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815863 GeneID:269604 MGI:2442046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : novel 7 transmembrane receptor (Secretin family) domain containing protein product : G protein-coupled receptor 157 protein_id : NP_796340.2

name	Slc2a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543728 CCDS:CCDS18968.1 GeneID:56485 MGI:1928369
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fructose transporter product : solute carrier family 2 (facilitated glucose transporter), member 5 protein_id : NP_062715.2

name	LOC435818 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253360 GeneID:435818
definition	codon_start : 1 product : similar to novel member of the solute carrier family 2 (facilitated glucose transporter) Slc2 family protein_id : XP_001480176.1

name	Car6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753270 GeneID:12353 MGI:1333786
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : carbonic anhydrase 6 protein_id : NP_033932.1

name	Eno1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963491 CCDS:CCDS18971.1 GeneID:13806 MGI:95393
definition	GO_component : GO:0000015 - phosphopyruvate hydratase complex [Evidence IEA] GO_function : GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004634 - phosphopyruvate hydratase activity [Evidence IDA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha-enolase; 2-phospho-D-glycerate hydrolase product : enolase 1, alpha non-neuron protein_id : NP_075608.1

name	LOC666880 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253329 GeneID:666880
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991856.2

name	LOC384091 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372795 GeneID:384091
definition	codon_start : 1 product : similar to Snrpf protein protein_id : XP_357414.2

name	Rere (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82895961 GeneID:68703 MGI:2683486
definition	codon_start : 1 product : arginine glutamic acid dipeptide (RE) repeats isoform 1 protein_id : XP_204015.3

name	Slc45a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75709222 CCDS:CCDS18973.1 GeneID:242773 MGI:2653235
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : deleted in neuroblastoma 5 protein_id : NP_776135.2

name	Errfi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526962 CCDS:CCDS18974.1 GeneID:74155 MGI:1921405
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0031098 - stress-activated protein kinase signaling pathway [Evidence ISS] codon_start : 1 product : mitogen-inducible gene 6 protein protein_id : NP_598514.1

name	Park7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741460 CCDS:CCDS18975.1 GeneID:57320 MGI:2135637
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence TAS] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0051583 - dopamine uptake [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0042542 - response to hydrogen peroxide [Evidence IMP] [Evidence IDA]; GO:0001963 - synaptic transmission, dopaminergic [Evidence IMP] codon_start : 1 note : RNA-binding protein regulatory subunit; RNA binding protein regulatory subunit product : DJ-1 protein protein_id : NP_065594.2

name	Tnfrsf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117422439 GeneID:21942 MGI:1101059
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant 3 product : tumor necrosis factor receptor superfamily, member 9 isoform 1 precursor protein_id : NP_001070977.1

name	Tnfrsf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755831 CCDS:CCDS18976.1 GeneID:21942 MGI:1101059
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant 1 product : tumor necrosis factor receptor superfamily, member 9 isoform 1 precursor protein_id : NP_035742.1

name	Tnfrsf9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117422435 GeneID:21942 MGI:1101059
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant 2 product : tumor necrosis factor receptor superfamily, member 9 isoform 2 precursor protein_id : NP_001070976.1

name	Uts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755931 CCDS:CCDS18977.1 GeneID:24111 MGI:1346329
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : urocortin 2; urotensin II product : urotensin 2 protein_id : NP_036040.1

name	Per3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922674 CCDS:CCDS18978.1 GeneID:18628 MGI:1277134
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 product : period homolog 3 protein_id : NP_035197.2

name	Vamp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678553 CCDS:CCDS18979.1 GeneID:22319 MGI:1321389
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_process : GO:0017156 - calcium ion-dependent exocytosis [Evidence IMP]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : cellubrevin product : vesicle-associated membrane protein 3 protein_id : NP_033524.1

name	Camta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719159 GeneID:100072 MGI:2140230
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : calmodulin binding transcription activator 1 isoform 1 protein_id : NP_001075026.1

name	LOC100041882 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253327 GeneID:100041882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 222 ESTs, 6 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_033085.1

name	LOC677027 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253330 GeneID:677027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 7 Proteins product : similar to Rps15a protein pseudo : _no_value transcript_id : XR_033130.1

clone name	MSMg01-328P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-382J16.T7 (MSMg01no382_j16.b1)	MSMg01-382J16.TJ (MSMg01no382_j16.g1)
ACC	AG486469	AG486470
length	1,014	780
length of high quality (start - end)	---	252 (276 - 527)
definition	CHROMAT_FILE: MSMg01no382_j16.b1 PHD_FILE: MSMg01no382_j16.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:24:24 2005	CHROMAT_FILE: MSMg01no382_j16.g1 PHD_FILE: MSMg01no382_j16.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:24:24 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTTTTCTCTTTCTTCTTCCCTCCTCTCCCTCTCCGCGCCCGCCCGCGCGG CGTGCGCGTGCTCTTTTCGCCTCGTGCTGCCCGCGTTTGCTCTCTTGCGC CCCTCGCTCCGCGTTCCGCCGCTCGTTGCTCTGTTGCTGTGCGGTGTGCG CGGGGCGCCTCTCTTCCCCGTCGCTCTCTTCCGTTCTCTTCTTCGCCTTC TTCTGCGTGCTCTTCTTCCGCTGCGCTTGGGTGGCTGCGTGCTCTTCCCG TGGACGTGCGTGCTGGGGGGGGTGCTGGGGGGCTGGGCCTGTTGGGTGGG TGGGTGGTGGGGGGCTGGGCTGCCCGCTGGTGGTGGTCCTGCGGGGGTGC TGCCGGGGGGTCTTGTGGGGCGTTGGTGTGGTGTCGCGGTTGCTGTGCTC TCTTTTTTTCGAGCGGTCGTCGTGCTTCTGCTTCTGGCACTTTGCCGTCG GGGCGGTGTTGGGGCGTCTGGGTCTCGCTCCTCGCCCTTCGCTCGTTTGT GCGTGTTCGGGGTTGTTGCGCCCCGTTGTTGCTCTGCTCTCCGGGTGTTG GGTGTCGGTCCGGGGTGGGGCTCGTGCGGCGGCGTTGGTGCCGTGCGGCT CGCCCCTGTTTCCGGTCCTTTCTCTCTGGGTCTGTCTCTTCTCGTTGTCG CCGTTTTGCTGCGCCGCTGCGTTCTCGTGTCGTCGCGCGGCCGCGTCTCT CTGGCGCGCGCTCTGGGGTTGCGCGTGTGCTGGCGTGGTGTCTCTCGCGT GCGCCTGCCGGGCTTTTTTCGTCGCGTCGTGTCTGTGTGCTGCCGGTGTC GTTGTTTGCGTGTGTTTTGTTGCTCGTTTCTTGCGTCGTCTGCCTGTCCT GCCGCGCTCGGGCGTGCTTTGCCTGTGTCTCTGCGCGTCGTCCCGCTCCT GTTTCCTCTTGCTGGCCATCTGCGGCCGCGCGTCTGTGCGCTTCGCTTGT TGTGTTTGTGTGGTTCTTGTTCGGGTGTGTTGCTCCTTCTCGTTGCCTTC TCTTCGTCCTTTGN	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXTCCTCGTCCCTGGCTCACTGCATTAACAGGGAAGAGCTGCTT CTAAGGCGCTCTGGGGGAAGAGCGACATGGTCCCCGAAACGGCAGGAAGA CAGAGGGATGAGGGCTCCGAAGTATCAGACTTGGATCGGGGCCAAGACAA TGAACCTCCTTGTCTCCGCCCCTCAGTTCTTTCAGAGGTCCTACGAGACT CTTAATAACCACAAGTGGCCGGGTGGGCTTAGGTCTCATCTAGAAGGCAT CCTCGTGACTTGAGTCAATGTGACTCAGGAGGAGAGCATCAGGCCACCCC AGCTGAGCATGCTGGCAAACAGACCGTAAAATAAAATTCAGCAGAGTGAA AGGCTGAACTGGGAACCTCAGCTGCTCTGCACAATCAGACCCATACAAAC AAAGGAAAGGGGTGTCTCATGCCTCTTCTAANAAACATTTTATTCTTAGT TTTTTTAAGATAGGTTCCCATGTAATCCTGTGCCAACCTTCCACTCACTA TGGTGGCTGAGCTAATAATCTCCTTGCCTCCAAGTGCTGGAATCACGGGG ATGCTCCCCCTTGGCCAGCTTACATTTATGAATTTGGTTTTACGGCGGGC CTGTGGGTGTCTATGAATCTTCCTTTTGTTCCTTTTTATTTTCTCTATGC TTTTCTTCCACTTCCTATGCGTACCCTCACATTTTGCGCATTACTATCCT TTCCTTTTTTTCCTTTTTATTTTATTCTTN
quality values	Open. Hide. 10 13 11 9 9 11 11 8 8 8 8 10 11 11 10 8 8 8 8 6 6 6 6 8 8 8 9 9 8 10 8 8 8 8 8 8 9 9 8 8 11 10 8 9 11 8 17 8 8 8 8 8 8 6 6 8 8 8 6 6 8 8 6 6 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 8 10 10 8 8 8 13 11 12 6 6 6 6 8 8 10 9 10 6 6 7 7 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 10 7 7 10 8 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 6 7 10 6 8 8 8 8 8 8 8 8 8 6 6 6 6 8 13 8 8 6 6 8 8 9 8 8 6 6 8 8 10 9 10 9 10 9 10 10 13 10 8 8 6 6 6 6 8 8 8 6 8 8 8 9 9 10 8 13 8 8 6 6 8 8 9 10 13 12 15 15 21 21 9 7 6 6 8 6 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 10 10 12 10 8 8 12 9 8 8 11 10 10 8 8 6 6 8 8 8 6 6 10 10 10 8 8 8 10 10 10 10 10 8 8 8 8 8 8 10 11 6 7 8 6 8 8 14 8 8 6 6 6 6 8 8 8 8 8 8 10 6 6 6 8 10 11 10 8 8 15 22 17 15 10 8 8 8 10 10 8 6 6 6 7 7 8 10 8 9 8 8 8 8 8 12 10 10 12 14 11 15 14 12 12 11 11 11 12 12 11 8 8 8 6 8 8 10 10 12 11 11 11 9 10 8 8 8 7 13 12 10 8 6 6 8 7 7 11 9 7 10 10 13 11 11 11 11 6 6 6 6 6 6 8 6 8 8 8 8 8 8 8 9 11 11 12 12 11 11 11 11 9 9 9 10 10 8 10 8 8 9 9 10 13 10 10 9 11 16 11 11 10 11 11 11 11 10 8 8 6 6 8 6 10 10 10 9 10 10 9 8 8 13 13 8 10 8 8 8 10 10 8 8 8 8 8 8 8 8 8 10 10 11 9 7 7 8 8 8 6 6 6 6 8 6 6 6 6 6 8 9 8 6 8 6 6 8 8 11 15 11 10 10 10 10 10 10 10 6 7 8 8 11 8 8 8 8 8 8 10 6 6 6 6 6 6 8 8 8 8 8 8 8 8 6 6 8 8 8 8 6 6 6 6 8 8 8 10 13 8 8 8 8 8 10 8 9 8 8 8 8 8 8 8 10 11 11 11 11 11 10 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 11 12 15 10 8 8 8 8 8 8 10 8 8 8 8 11 9 13 7 7 6 6 8 8 10 11 15 11 11 8 8 8 8 8 10 9 8 8 8 6 8 8 9 10 10 10 10 10 10 8 8 8 8 10 13 17 8 8 8 10 6 6 8 8 6 6 8 8 11 8 13 8 9 9 13 16 8 8 8 10 8 8 9 9 11 11 11 10 9 9 10 10 10 8 8 8 8 8 8 8 8 8 12 10 9 8 8 10 9 9 9 11 10 8 8 8 8 8 7 6 8 6 6 8 8 8 15 8 8 9 9 8 10 8 8 8 8 8 8 6 6 8 8 8 8 8 8 10 15 17 15 8 8 8 8 8 8 8 8 8 8 10 10 10 10 14 13 8 8 8 8 8 8 8 8 10 9 7 10 8 8 8 6 6 7 11 10 9 9 9 13 8 8 8 8 7 9 15 12 10 7 7 7 8 8 8 8 8 8 6 7 7 7 12 8 8 12 8 6 6 6 6 8 6 9 6 8 11 10 10 8 10 10 10 10 8 8 8 8 8 8 11 6 8 6 7 8 8 8 19 15 15 14 8 8 8 8 9 9 8 8 8 8 8 6 6 8 8 9 11 11 11 11 11 10 10 9 10 10 10 11 12 18 10 9 8 8 6 6 8 7 8 12 8 8 8 8 9 10 10 8 8 8 13 13 9 9 10 8 9 9 10 9 8 8 7 7 7 8 11 10 8 8 8 12 8 8 8 8 9 8 8 8 10 8 8 8 8 8 8 8 8 6 7 8 10 11 12 12 9 9 9 9 9 9 9 11 10 10 10 8 10 8 8 10 8 8 8 8 8 10 8 8 8 8 10 8 9 9 8 6 6 6 6 8 7 7 7 7 8 8 8 8 6 6 6 6 11 10 10 8 8 8 8 9 9 9 8 8 8 8 3 0	Open. Hide. 37 37 37 39 44 44 39 39 39 39 39 44 59 44 34 25 10 8 8 8 8 8 18 10 10 10 21 21 37 31 32 28 22 13 13 17 27 23 33 33 36 36 36 33 23 31 23 31 22 23 23 34 27 53 50 43 43 39 28 28 13 13 12 12 13 19 18 23 23 28 32 25 25 27 20 13 8 6 6 8 8 10 12 13 17 19 19 16 10 10 10 10 10 12 11 11 11 12 12 12 12 12 11 10 8 8 15 10 8 8 8 10 8 9 9 8 8 10 8 8 8 8 15 10 12 10 13 8 8 8 12 15 10 20 15 22 16 19 11 12 15 28 34 36 41 25 22 17 17 11 10 10 12 22 26 21 10 6 6 8 17 17 11 11 11 12 13 10 10 9 9 9 13 15 19 19 17 12 12 12 13 24 18 14 21 21 16 21 17 20 15 21 19 23 16 15 14 9 12 14 30 34 44 30 30 30 32 32 35 41 41 41 41 41 32 24 26 13 13 13 32 18 18 12 24 12 13 13 26 32 32 21 10 10 10 10 17 19 29 29 43 43 43 35 35 43 43 43 43 43 44 43 43 42 42 43 43 43 43 26 27 11 11 11 24 18 14 10 10 10 10 10 10 13 13 24 15 23 28 38 23 21 21 15 15 27 44 43 52 43 59 57 57 57 57 59 59 59 57 52 57 57 44 44 33 33 33 44 38 44 34 23 17 13 13 15 24 32 35 43 43 57 57 52 43 42 43 43 52 57 57 57 52 43 43 27 27 27 44 44 54 54 54 59 59 52 52 57 59 59 52 48 48 50 50 44 44 48 50 50 59 50 50 50 43 37 37 47 59 59 57 57 57 57 57 57 48 48 48 48 59 59 54 54 43 44 43 43 43 43 47 59 57 57 47 47 43 48 48 48 48 48 57 48 54 57 48 47 43 46 46 43 57 43 43 43 48 48 47 46 48 48 59 47 48 48 48 43 39 30 30 30 41 41 57 50 50 48 48 46 47 47 47 39 39 37 31 31 40 41 44 41 39 39 39 39 39 39 39 39 39 30 30 30 30 30 39 39 47 46 46 46 48 59 46 46 41 41 25 23 3 0 3 21 23 43 47 47 59 37 31 31 30 30 30 33 35 43 43 41 41 44 39 26 26 25 25 22 30 23 23 23 34 32 43 43 43 43 39 39 33 33 20 20 19 19 15 15 24 16 15 11 11 10 17 16 18 13 21 16 16 11 11 11 22 13 19 26 21 21 16 13 10 8 8 8 8 8 11 7 9 9 13 12 14 15 14 17 12 17 19 19 23 15 13 10 10 10 10 10 11 18 16 16 18 11 11 11 14 11 11 8 9 9 8 9 9 9 9 9 9 12 13 8 8 8 10 14 14 10 10 9 9 10 11 11 11 11 17 11 11 10 10 10 10 19 12 8 8 8 8 8 18 16 15 10 9 11 12 8 8 6 6 6 8 8 8 11 8 8 8 8 8 8 11 8 8 8 10 6 7 8 10 8 8 8 8 8 10 15 10 12 18 15 11 12 8 8 8 8 8 18 16 19 12 10 9 8 8 8 8 10 8 8 10 8 8 8 9 9 9 8 8 9 7 11 8 8 8 8 6 6 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 12 10 12 8 10 8 11 9 9 8 8 8 8 8 8 10 10 10 10 8 8 8 8 11 8 12 10 8 8 9 12 12 9 10 11 11 11 10 11 8 8 8 8 8 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no382_j16.g1 MSMg01no382_j16.g1 CHROMAT_FILE:
MSMg01no382_j16.g1 PHD_FILE: MSMg01no382_j16.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:24:24 2005
         (252 letters)



>mm_chr4_149646896_149647547
          Length = 652

 Score =  462 bits (239), Expect = e-135
 Identities = 247/250 (98%)
 Strand = Plus / Plus

                                                                       
Query: 3   cttaggtctcatctagaaggcatcctcgtgacttgagtcaatgtgactcaggaggagagc 62
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 203 cttaggtctcatctagaaggcatcctcgtgacttgagtcaatgtgactcaggaggagagc 262

                                                                       
Query: 63  atcaggccaccccagctgagcatgctggcaaacagaccgtaaaataaaattcagcagagt 122
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 263 atcaggccaccccagctgagcatgctggcaaacagaccgtaaaataaaattcagcagagt 322

                                                                       
Query: 123 gaaaggctgaactgggaacctcagctgctctgcacaatcagacccatacaaacaaaggaa 182
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 323 gaaaggctgaactgggaacctcagctgctctgcacaatcagacacatacaaacaaaggaa 382

                                                                       
Query: 183 aggggtgtctcatgcctcttctaanaaacattttattcttagtttttttaagataggttc 242
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 383 aggggtgtctcatgcctcttctaaaaaacattttattcttagtttttttaagataggttc 442

                     
Query: 243 ccatgtaatc 252
           | ||||||||
Sbjct: 443 ctatgtaatc 452


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 252
Length of database: 652
Length adjustment: 9
Effective length of query: 243
Effective length of database: 643
Effective search space:   156249
Effective search space used:   156249
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information