MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-385L07
Chromosome	4 (Build37)
Map Location	126,175,176 - 126,175,590
singlet/doublet	singlet
Overlap gene	Eif2c4
Upstream gene	Grik3, Ftl2, Csf3r, Mrps15, 1810007P19Rik, LOC100039645, Lsm10, Stk40, 2610027C15Rik, 1700029G01Rik, Thrap3, Mtap7d1, Trappc3, Col8a2, EG667193, Adprhl2, Tekt2, Eif2c3, Eif2c1, LOC100039351
Downstream gene	Clspn, LOC665197, 5730409E04Rik, LOC620877, Psmb2, Tcfap2e, Ncdn, AU040320, Sfpq, Zmym1, LOC665245, Zmym6, LOC100039968, LOC621588, Dlgap3, BC003266, Gja4, Gjb3, Gjb4, Gjb5, LOC667296
Link	Open Mouse BAC browser

Click to get alignment info.

name	Grik3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14807 MGI:95816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14337 MGI:95590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf3r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12986 MGI:1339755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66407 MGI:1913657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810007P19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230751 MGI:1916308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1315 ESTs, 6 Proteins

name	Lsm10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116748 MGI:2151045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74178 MGI:1921428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610027C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230752 MGI:1922063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66938 MGI:1914188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thrap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230753 MGI:2442637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap7d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245877 MGI:2384297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27096 MGI:1351486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col8a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:329941 MGI:88464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667193 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667193 MGI:3643537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Adprhl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100206 MGI:2140364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24084 MGI:1346335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2c3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214150 MGI:2446634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236511 MGI:2446630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Eif2c4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76850 MGI:1924100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clspn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269582 MGI:2445153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins pseudo : _no_value

name	5730409E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230757 MGI:3609248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620877 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 mRNAs, 847 ESTs, 1 Protein pseudo : _no_value

name	Psmb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26445 MGI:1347045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcfap2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332937 MGI:2679630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncdn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26562 MGI:1347351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU040320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100317 MGI:2140475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Sfpq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71514 MGI:1918764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmym1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68310 MGI:1915560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 2 Proteins pseudo : _no_value

name	Zmym6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100177 MGI:106505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 54 ESTs, 1 Protein

name	LOC621588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 307 ESTs, 2 Proteins

name	Dlgap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242667 MGI:3039563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC003266 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80284 MGI:1933141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gja4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14612 MGI:95715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14620 MGI:95721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14621 MGI:95722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14622 MGI:95723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Grik3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487363 GeneID:14807 MGI:95816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 3 transcript_id : NM_001081097.1

name	Ftl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130485276 GeneID:14337 MGI:95590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin light chain 2 transcript_id : NM_008049.2

name	Csf3r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681050 GeneID:12986 MGI:1339755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 3 receptor (granulocyte) transcript_id : NM_007782.1

name	Mrps15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48526511 GeneID:66407 MGI:1913657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S15 transcript_id : NM_025544.2

name	1810007P19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244065 GeneID:230751 MGI:1916308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810007P19 gene transcript_id : NM_172701.2

name	LOC100039645 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253109 GeneID:100039645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1315 ESTs, 6 Proteins product : similar to ribosomal protein L28 transcript_id : XM_001473710.1

name	Lsm10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270250 GeneID:116748 MGI:2151045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U7 snRNP-specific Sm-like protein LSM10 transcript_id : NM_138721.1

name	Stk40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560066 GeneID:74178 MGI:1921428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 40 transcript_id : NM_028800.2

name	2610027C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353701 GeneID:230752 MGI:1922063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610027C15 gene transcript_id : NM_172145.3

name	1700029G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130252 GeneID:66938 MGI:1914188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029G01 gene transcript_id : NM_025856.2

name	Thrap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533245 GeneID:230753 MGI:2442637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor associated protein 3 transcript_id : NM_146153.3

name	Mtap7d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542191 GeneID:245877 MGI:2384297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 7 domain containing 1 transcript_id : NM_144941.2

name	Trappc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560502 GeneID:27096 MGI:1351486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 3 transcript_id : NM_013718.2

name	Col8a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130942 GeneID:329941 MGI:88464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type VIII, alpha 2 transcript_id : NM_199473.2

name	EG667193 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372516 GeneID:667193 MGI:3643537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG667193 transcript_id : XM_988918.1

name	Adprhl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129802 GeneID:100206 MGI:2140364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylhydrolase like 2 transcript_id : NM_133883.2

name	Tekt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755766 GeneID:24084 MGI:1346335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 2 transcript_id : NM_011902.1

name	Eif2c3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510274 GeneID:214150 MGI:2446634
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 3 transcript_id : NM_153402.1

name	Eif2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510268 GeneID:236511 MGI:2446630
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 1 transcript_id : NM_153403.1

name	LOC100039351 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253099 GeneID:100039351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Ep400 protein transcript_id : XM_001472738.1

name	Eif2c4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448546 GeneID:76850 MGI:1924100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2C, 4 transcript_id : NM_153177.2

name	Clspn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330171 GeneID:269582 MGI:2445153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claspin homolog (Xenopus laevis) transcript_id : NM_175554.3

name	5730409E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345197 GeneID:230757 MGI:3609248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730409E04Rik gene transcript_id : NM_001013755.2

name	Psmb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376021 GeneID:26445 MGI:1347045
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 2 transcript_id : NM_011970.3

name	Tcfap2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444919 GeneID:332937 MGI:2679630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor AP-2, epsilon transcript_id : NM_198960.2

name	Ncdn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560512 GeneID:26562 MGI:1347351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurochondrin transcript_id : NM_011986.2

name	AU040320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482608 GeneID:100317 MGI:2140475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU040320 transcript_id : NM_001035525.1

name	AU040320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482610 GeneID:100317 MGI:2140475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU040320 transcript_id : NM_001035526.1

name	AU040320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482606 GeneID:100317 MGI:2140475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU040320 transcript_id : NM_133886.2

name	Sfpq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709441 GeneID:71514 MGI:1918764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) transcript_id : NM_023603.2

name	Zmym1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129862 GeneID:68310 MGI:1915560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYM domain containing 1 transcript_id : NM_026670.4

name	Zmym6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364229 GeneID:100177 MGI:106505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYM-type 6 transcript_id : NM_177462.3

name	LOC100039968 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253118 GeneID:100039968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 54 ESTs, 1 Protein product : similar to transmembrane protein 35 transcript_id : XM_001474551.1

name	LOC621588 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372518 GeneID:621588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 307 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_885993.2

name	Dlgap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351843 GeneID:242667 MGI:3039563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large (Drosophila) homolog-associated protein 3 transcript_id : NM_198618.3

name	BC003266 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145577 GeneID:80284 MGI:1933141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC003266 transcript_id : NM_030252.2

name	Gja4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328122 GeneID:14612 MGI:95715
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein alpha 4 transcript_id : NM_008120.2

name	Gjb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680012 GeneID:14620 MGI:95721
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 3 transcript_id : NM_008126.1

name	Gjb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49355797 GeneID:14621 MGI:95722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 4 transcript_id : NM_008127.3

name	Gjb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353936 GeneID:14622 MGI:95723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 5 transcript_id : NM_010291.3

name	Grik3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487364 GeneID:14807 MGI:95816
definition	GO_component : GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence TAS] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 product : glutamate receptor 7 protein_id : NP_001074566.1

name	Ftl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130485277 GeneID:14337 MGI:95590
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA] codon_start : 1 product : ferritin light chain 2 protein_id : NP_032075.2

name	Csf3r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681051 CCDS:CCDS18640.1 GeneID:12986 MGI:1339755
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : colony stimulating factor 3 receptor protein_id : NP_031808.1

name	Mrps15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48526512 CCDS:CCDS18641.1 GeneID:66407 MGI:1913657
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S15 protein_id : NP_079820.2

name	1810007P19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244066 GeneID:230751 MGI:1916308
definition	codon_start : 1 note : organic solute carrier protein 1; novel protein similar to oxidored-nitro domain-containing protein NOR1; organic solute carrier 1 product : oxidored-nitro domain-containing protein protein_id : NP_766289.2

name	LOC100039645 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253110 GeneID:100039645
definition	codon_start : 1 product : similar to ribosomal protein L28 protein_id : XP_001473760.1

name	Lsm10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270251 CCDS:CCDS18642.1 GeneID:116748 MGI:2151045
definition	GO_component : GO:0015030 - Cajal body [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005683 - snRNP U7 [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0017069 - snRNA binding [Evidence ISS] GO_process : GO:0006398 - histone mRNA 3'-end processing [Evidence TAS]; GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : U7 snRNP-specific Sm-like protein LSM10 protein_id : NP_620046.1

name	Stk40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560067 GeneID:74178 MGI:1921428
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : serine/threonine kinase 40 protein_id : NP_083076.2

name	2610027C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024305 CCDS:CCDS18643.1 GeneID:230752 MGI:1922063
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC230752 protein_id : NP_742157.1

name	1700029G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859688 CCDS:CCDS18644.1 GeneID:66938 MGI:1914188
definition	codon_start : 1 note : novel protein containing SH3 domains product : hypothetical protein LOC66938 protein_id : NP_080132.1

name	Thrap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68533246 CCDS:CCDS18645.1 GeneID:230753 MGI:2442637
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 product : thyroid hormone receptor associated protein 3 protein_id : NP_666265.3

name	Mtap7d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542192 CCDS:CCDS18646.1 GeneID:245877 MGI:2384297
definition	codon_start : 1 exception : mismatches in translation note : arginine/proline rich coiled-coil 1 product : proline arginine rich coiled coil 1 protein_id : NP_659190.2

name	Trappc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304929 CCDS:CCDS18647.1 GeneID:27096 MGI:1351486
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence IDA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Bet3 homolog product : trafficking protein particle complex 3 protein_id : NP_038746.1

name	EG667193 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94372517 GeneID:667193 MGI:3643537
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994012.1

name	Col8a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054950 CCDS:CCDS18649.1 GeneID:329941 MGI:88464
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050673 - epithelial cell proliferation [Evidence IGI]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IGI]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : endothelial collagen; procollagen type VIII alpha 2 product : procollagen, type VIII, alpha 2 protein_id : NP_955767.1

name	Adprhl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916671 CCDS:CCDS18650.1 GeneID:100206 MGI:2140364
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ADP-ribosylhydrolase 2 product : ecto ADP-ribosylhydrolase protein_id : NP_598644.1

name	Tekt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755767 CCDS:CCDS18651.1 GeneID:24084 MGI:1346335
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0001539 - ciliary or flagellar motility [Evidence IMP]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 exception : mismatches in translation product : tektin 2 protein_id : NP_036032.1

name	Eif2c3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510275 CCDS:CCDS18652.1 GeneID:214150 MGI:2446634
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : siRNA-mediated RNAi note : argonaute 3; Piwi/Argonaute family protein meIF2C3 product : eukaryotic translation initiation factor 2C, 3 protein_id : NP_700451.1

name	Eif2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510269 CCDS:CCDS18653.1 GeneID:236511 MGI:2446630
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : siRNA mediated RNAi note : Piwi/Argonaute family protein meIF2C1; argonaute 1 product : eukaryotic translation initiation factor 2C, 1 protein_id : NP_700452.1

name	LOC100039351 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253100 GeneID:100039351
definition	codon_start : 1 product : similar to Ep400 protein protein_id : XP_001472788.1

name	Eif2c4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448547 CCDS:CCDS18654.1 GeneID:76850 MGI:1924100
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : argonaute 4 product : Piwi/Argonaute family protein meIF2C4 protein_id : NP_694817.2

name	Clspn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330172 CCDS:CCDS18655.1 GeneID:269582 MGI:2445153
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000217 - DNA secondary structure binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0000076 - DNA replication checkpoint [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : claspin protein_id : NP_780763.2

name	5730409E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701450 CCDS:CCDS18656.1 GeneID:230757 MGI:3609248
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC230757 protein_id : NP_001013777.1

name	Psmb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981327 CCDS:CCDS18657.1 GeneID:26445 MGI:1347045
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proteasome (prosome, macropain) subunit, beta type 2 protein_id : NP_036100.2

name	Tcfap2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444920 CCDS:CCDS18658.1 GeneID:332937 MGI:2679630
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : transcription factor AP-2, epsilon protein_id : NP_945198.2

name	Ncdn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560513 CCDS:CCDS18659.1 GeneID:26562 MGI:1347351
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045453 - bone resorption [Evidence IDA] codon_start : 1 exception : mismatches in translation note : neurochondrin-1; neurochondrin-2; minisatellite 10ae detected by probe MMS10 product : neurochondrin protein_id : NP_036116.2

name	AU040320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482609 CCDS:CCDS18660.1 GeneID:100317 MGI:2140475
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 2; likely ortholog of H. sapiens polycystic kidney disease 1-like (PKD1-like) product : polycystic kidney disease 1-like isoform 1 protein_id : NP_001030602.1

name	AU040320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482611 CCDS:CCDS18660.1 GeneID:100317 MGI:2140475
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; likely ortholog of H. sapiens polycystic kidney disease 1-like (PKD1-like) product : polycystic kidney disease 1-like isoform 1 protein_id : NP_001030603.1

name	AU040320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956264 CCDS:CCDS18661.1 GeneID:100317 MGI:2140475
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; likely ortholog of H. sapiens polycystic kidney disease 1-like (PKD1-like) product : polycystic kidney disease 1-like isoform 2 protein_id : NP_598647.1

name	Sfpq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956214 CCDS:CCDS18662.1 GeneID:71514 MGI:1918764
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : PTB-associated splicing factor product : splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) protein_id : NP_076092.1

name	Zmym1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227135 CCDS:CCDS18663.1 GeneID:68310 MGI:1915560
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, MYM domain containing 1 protein_id : NP_080946.3

name	Zmym6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29126191 CCDS:CCDS18664.1 GeneID:100177 MGI:106505
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transposase-like protein; probably fused to an N terminal zinc finger domain; likely ortholog of H. sapiens zinc finger protein 258 (ZNF258) product : zinc finger protein 258 protein_id : NP_803413.1

name	LOC100039968 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253119 GeneID:100039968
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474601.1

name	LOC621588 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895184 GeneID:621588
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_891086.1

name	Dlgap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348480 CCDS:CCDS18665.1 GeneID:242667 MGI:3039563
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_process : GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : PSD-95/SAP90-binding protein 3; SAP90/PSD 95 associated protein 3 product : disks large-associated protein 3 protein_id : NP_941020.1

name	BC003266 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384892 GeneID:80284 MGI:1933141
definition	codon_start : 1 product : hypothetical protein LOC80284 protein_id : NP_084528.1

name	Gja4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680003 CCDS:CCDS18667.1 GeneID:14612 MGI:95715
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 37 product : gap junction membrane channel protein alpha 4 protein_id : NP_032146.1

name	Gjb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680013 CCDS:CCDS18668.1 GeneID:14620 MGI:95721
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0001890 - placenta development [Evidence IMP] codon_start : 1 note : connexin 31; gap junction protein beta 3 product : gap junction membrane channel protein beta 3 protein_id : NP_032152.1

name	Gjb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680015 CCDS:CCDS18669.1 GeneID:14621 MGI:95722
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 30.3 product : gap junction membrane channel protein beta 4 protein_id : NP_032153.1

name	Gjb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753996 CCDS:CCDS18670.1 GeneID:14622 MGI:95723
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 31.1 product : gap junction membrane channel protein beta 5 protein_id : NP_034421.1

name	LOC667296 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667296
definition	number : 1 pseudo : _no_value

name	LOC665197 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253115 GeneID:665197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to hCG1787519 pseudo : _no_value transcript_id : XR_031684.1

name	LOC620877 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253116 GeneID:620877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 mRNAs, 847 ESTs, 1 Protein product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_031698.1

name	LOC665245 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253117 GeneID:665245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 2 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_001775.2

clone name	MSMg01-349D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059N13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-384P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488H24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-376E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303B18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529H10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233M17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-385L07.T7 (MSMg01no385_l07.b1)	MSMg01-385L07.TJ (MSMg01no385_l07.g1)
ACC	AG488843	AG488844
length	761	775
length of high quality (start - end)	418 (26 - 443)	414 (55 - 468)
definition	CHROMAT_FILE: MSMg01no385_l07.b1 PHD_FILE: MSMg01no385_l07.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:28:21 2005	CHROMAT_FILE: MSMg01no385_l07.g1 PHD_FILE: MSMg01no385_l07.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:28:21 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCCTGANACCACAGCTT TCAGTAAAAGATAACATGAAGTTCTTCAAACTGGTTCACCAGGTTCAACA AAACTAATGTTGTATGCTCAGTCCTATGTCTTTGTCTATGTCCATGTCCA TGTCTTCATGTCTATGTCTATGTCTATGTCTATGTCTATGTCTATGTCTA TGTCTATGTCATTGTCTATGTCTACGTCTATGTCTTCATCTCTATGTCTA TGTCTTCATCTTTGTCTATTCTTTGTCAATGTCATGTCTATGTCTTTATG TCTATTTCTTTTTCTATGTGATGTCTATGTCTTGGTCTTGTCTTCGTATT CATTTATGTCTACGTCTTTGTCATGTCCATTTCTATGTTTATGTCTGTCT ATGTCTATAGCACATGATTATCAGAAGCCTCTGATGACATGGAGACTGAG AAGATAGTTCAGAGCCAGGCCAGTACTCATAATCTTGAACAGAGCAGAAT ATCTTTGTGCCCCAATCTAATCATCTATAAAAAAAATCAGGTCATGATCT TTTGTATTTCTANATACCTAATGCTCTAAATAGGGGATCGGTACACTGCT GCAATGCTCTGACCATCAACAAATTTAAATTTCGTTTCTGTCTTGCTTTA CTATGATAAAGTTTATTATCTCCTAAGCTTATTTTTCTCCTCGTCTTTTT TCTACACACTCTTTAACCATAATGCCTTCCCTTTTTCTTTTGTATTTATT ACCACCGCCTT	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXCTGATAAGGAGATTTGGTGAAGACAGTTTCTTTCCAGAGGTCGGGG GTCAGGTAGCTCTAAGTCTTGGAGATGGCATCAAAGGTGGCCTTAGCAAA GTTGCCCAGAGTGGCAGTGCAGCCTCTGGCTGAAGTGTAACAGTCATCTA TACCGGCCATCATCAGGAGCTTCTTGGGCACAGGAGCAGAGACAATTCCA GTGCCTCTGGGGGCAGGGATGAGACGCACCAGCACAGAGCCACAGCGGCC TGTCACCTTGCATGGAACAGTGTGGGGCTTGCCAATCTTGTTTCCCCAGT AGCCTCTCCGCACGGGGACGATGGAAAGCTTGGCTAAGATGATGGCCCCT CGGATGGCAGTGGCACCCTCCTTGGAGAACTTAACACCAAGACCAACGTG ACCATTGTAGTCCCCAATAGCGACGATAGCCTTGAATCTGGTCCGCTGGT CAGCCCGATTCTGCTTCTGCACTGGCTTGATTTTCATAACCTTATCCCTT AGGGACGCATTCTAGGAATAAGCCAGTGATCTCAGACCCCTTTATTAATC AGTATAACAGCGTATATTCTCTTTAAGGATTTTAATCTTCATGCACTTTA ATATGTTGGTCTAATTTATGTTACTGTTTTTCCTCTCCTTTCCTTTTTTT TTCTTCCCCTCTCTAACTCTTTTTTTCCATTTTATTATCATATCATACTC TTTTTCCTCTTATTATCTCTCTCCG
quality values	Open. Hide. 6 6 8 6 8 15 10 9 9 14 15 15 9 9 9 12 12 13 24 30 24 19 18 21 21 28 30 34 59 31 32 32 30 37 29 39 27 23 3 0 3 8 8 10 11 28 34 37 59 33 36 33 33 33 34 43 57 57 37 37 34 43 34 43 43 47 47 47 47 43 68 68 68 68 51 42 42 42 42 47 57 57 54 57 50 53 50 50 50 50 54 57 68 50 51 50 50 50 50 50 50 51 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 57 57 57 57 68 68 68 68 68 57 57 57 57 57 50 51 51 50 57 57 57 57 57 57 57 57 57 57 57 57 57 54 54 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 43 39 39 59 59 68 68 68 68 68 68 59 59 59 59 57 57 57 57 57 57 59 59 59 59 57 59 59 68 68 68 68 68 68 68 68 68 68 68 62 62 62 52 52 62 62 62 68 68 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 44 62 52 52 52 62 62 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 59 59 59 57 59 59 59 59 59 59 59 59 57 52 52 52 59 59 57 57 57 57 57 59 59 59 68 57 57 52 52 52 57 57 57 57 59 59 59 59 68 68 68 68 68 57 68 68 57 57 57 57 57 59 59 54 54 54 57 57 44 57 43 42 35 43 43 57 57 59 59 59 59 47 50 43 57 57 57 57 57 57 57 48 59 59 43 37 37 43 43 57 57 48 57 57 54 54 47 34 34 24 30 24 28 21 23 32 32 46 48 43 43 42 36 37 28 33 33 19 19 12 12 12 25 23 26 12 13 18 24 23 26 21 15 20 26 27 15 11 9 12 11 10 10 13 10 14 24 26 28 22 26 15 16 12 11 11 11 12 18 26 34 39 39 37 28 19 19 14 14 14 22 18 13 11 11 23 23 34 34 43 43 43 31 31 22 22 22 25 26 28 20 23 16 25 15 12 11 12 11 11 19 25 34 37 30 24 24 26 15 16 16 18 24 21 22 17 19 19 19 23 15 15 22 26 28 28 28 24 17 24 12 12 12 22 26 21 14 13 3 0 3 6 6 8 15 10 8 6 8 10 12 10 14 8 8 8 8 8 8 8 10 10 8 8 10 8 7 9 9 9 9 9 10 13 15 12 6 6 6 6 10 10 10 8 8 8 11 12 12 12 12 12 12 11 10 10 10 10 10 12 10 8 8 8 8 6 6 10 8 8 8 8 12 13 13 8 9 9 14 15 14 18 18 19 19 9 10 10 9 13 8 8 8 12 12 11 11 11 11 18 11 11 9 8 10 10 12 8 8 11 10 10 8 8 8 10 8 6 6 12 12 17 6 6 6 8 8 8 9 9 10 13 11 11 15 15 14 9 8 8 8 6 6 6 7 10 6 6 6 8 8 8 8 10 8 6 10 11 10 10 12 10 8 8 10 10 13 16 15 19 11 16 11 11 10 9 11 8 6 6 10 12 13 10 10 8 8 8 8 8 10 8 8 8 8 6 6 6	Open. Hide. 31 35 37 39 31 32 41 59 27 27 9 9 9 11 11 12 16 21 10 13 10 21 21 47 47 47 48 36 36 36 37 33 33 41 41 39 43 33 27 12 15 23 23 30 30 34 34 41 32 33 36 36 50 36 57 50 50 50 50 57 57 59 57 37 42 37 36 36 37 42 47 48 48 51 68 51 47 47 47 50 50 68 68 68 68 68 51 51 50 50 50 50 68 59 57 57 57 54 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 59 59 57 57 57 57 57 68 68 68 68 57 57 57 57 52 57 57 52 52 52 57 59 59 52 54 52 57 52 52 52 59 59 59 59 57 57 57 57 57 57 57 57 59 68 68 68 57 57 57 57 45 45 52 57 57 57 68 57 57 57 59 57 59 57 57 59 59 59 68 59 62 62 62 62 62 62 68 68 68 62 62 62 62 52 52 62 62 62 62 62 62 62 62 62 62 52 52 62 52 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 52 52 52 52 52 62 62 68 68 62 62 62 52 52 52 62 62 52 52 43 43 35 35 39 43 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 52 57 59 59 59 52 52 43 57 35 43 43 44 39 39 39 57 57 52 52 52 57 57 57 57 59 59 57 57 59 57 57 43 41 39 57 43 43 52 59 44 57 44 38 24 20 18 32 38 43 52 52 43 52 57 57 57 57 52 37 37 46 50 50 52 57 43 43 33 32 32 37 44 43 50 41 43 43 36 44 23 23 23 38 38 43 43 32 37 43 36 43 42 32 32 16 19 19 32 30 29 39 36 28 24 15 15 9 9 9 15 23 41 57 44 34 26 12 12 25 25 44 57 44 44 36 19 19 17 14 18 26 26 30 30 23 28 23 23 18 26 26 33 33 32 32 37 31 37 37 21 21 13 13 28 28 43 48 30 30 12 12 12 12 11 15 16 12 12 15 30 18 14 14 14 22 25 22 19 10 10 10 19 17 28 37 35 37 23 21 11 9 9 11 11 12 12 11 11 11 12 12 15 15 24 28 37 37 37 47 35 35 21 19 10 10 10 9 10 10 10 9 14 15 18 14 11 9 13 10 10 10 14 15 23 23 28 25 16 12 10 10 9 18 10 10 11 10 10 12 12 14 12 11 13 10 8 8 8 8 8 8 8 9 8 8 11 11 11 12 12 21 15 13 13 9 9 9 9 9 9 9 10 10 10 8 8 8 8 10 7 6 8 8 9 8 8 8 12 8 8 8 10 10 6 6 8 11 10 8 8 8 8 10 10 10 11 8 8 8 9 9 9 9 9 13 9 10 10 10 15 12 16 12 12 12 10 9 9 10 8 8 9 9 9 8 8 8 9 9 8 8 8 8 8 7 9 11 10 8 15 15 13 15 8 9 8 8 6 6 6 8 8 8 8 8 8 9 14 10 8 8 15 13 8 8 8 10 10 17 22 26 12 9 8 10 8 9 8 10 10 10 10 13 13 12 12 10 10 8 8 10 10 9 12 18 18 15 15 12 8 8 8 8 12 14 23 13 14 15 17 11 14 18 11 15 9 9 8 8 8 8 8 8 8 8 9 18 16 12 8 8 6 6 8 8 8 6 6 8 10 8 10 13 10 10 9 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no385_l07.b1 MSMg01no385_l07.b1 CHROMAT_FILE:
MSMg01no385_l07.b1 PHD_FILE: MSMg01no385_l07.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:28:21 2005
         (418 letters)



>mm_chr4_126174972_126175790
          Length = 819

 Score =  774 bits (400), Expect = 0.0
 Identities = 411/415 (99%), Gaps = 1/415 (0%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattcctganac-cacagctttcagtaaaagataacatgaagttcttcaaactggttca 63
           |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 gaattcctgaaacacacagctttcagtaaaagataacatgaagttcttcaaactggttca 264

                                                                       
Query: 64  ccaggttcaacaaaactaatgttgtatgctcagtcctatgtctttgtctatgtccatgtc 123
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 ccaggttcaacaaaactaatgttgtatgctcagtcctatgtctttgtctatgtccatgtc 324

                                                                       
Query: 124 catgtcttcatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatg 183
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 catgtcttcatgtctatgtctatgtctatgtctatgtctatgtctatgtctatgtctatg 384

                                                                       
Query: 184 tcattgtctatgtctacgtctatgtcttcatctctatgtctatgtcttcatctttgtcta 243
           |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 385 tcattgcctatgtctacgtctatgtcttcatctctttgtctatgtcttcatctttgtcta 444

                                                                       
Query: 244 ttctttgtcaatgtcatgtctatgtctttatgtctatttctttttctatgtgatgtctat 303
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 445 ttctttgtcaatgtcatgtctatgtctttatgtctatttctttttctatgtgatgtctat 504

                                                                       
Query: 304 gtcttggtcttgtcttcgtattcatttatgtctacgtctttgtcatgtccatttctatgt 363
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 505 gtcttggtcttgtcttcgtattcatttatgtctacgtctttgtcatgtccatttctatgt 564

                                                                  
Query: 364 ttatgtctgtctatgtctatagcacatgattatcagaagcctctgatgacatgga 418
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 565 ttatgtctgtctatgtctatagcacatgattatcagaagcctctgatgacatgga 619


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 91
Number of extensions: 9
Number of successful extensions: 9
Number of sequences better than 10.0: 1
Number of HSP's gapped: 8
Number of HSP's successfully gapped: 1
Length of query: 418
Length of database: 819
Length adjustment: 9
Effective length of query: 409
Effective length of database: 810
Effective search space:   331290
Effective search space used:   331290
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information