MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-432M19
Chromosome	4 (Build37)
Map Location	129,728,478 - 129,728,815
singlet/doublet	singlet
Overlap gene	Col16a1
Upstream gene	Ibrdc3, Tmem54, Hpca, Fndc5, S100pbp, Yars, C77080, Sync, Rbbp4, Zbtb8os, 2410081M15Rik, LOC100039588, Zbtb8, Bsdc1, Tssk3, 1700125D06Rik, Marcksl1, Hdac1, Lck, BC030183, Eif3s2, 2510006D16Rik, LOC667452, Iqcc, Ccdc28b, Txlna, Kpna6, Tmem39b, Khdrbs1, LOC100040532, Ptp4a2, LOC622469, LOC622480, 1700003M07Rik, Bai2
Downstream gene	Pef1, Hcrtr1, Tinagl, Gm853, Serinc2, Fabp3, Zcchc17, Wdr57, 2610200G18Rik, Pum1, LOC622577, Sdc3, Laptm5, Matn1, LOC622681, LOC100041575
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ibrdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75234 MGI:1922484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 83 ESTs, 5 Proteins

name	Tmem54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66260 MGI:1913510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hpca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15444 MGI:1336200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fndc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384061 MGI:1917614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S100pbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74648 MGI:1921898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107271 MGI:2147627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C77080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97130 MGI:2140651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sync (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68828 MGI:1916078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19646 MGI:1194912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb8os (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67106 MGI:1914356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410081M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73680 MGI:1920930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zbtb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215627 MGI:2387181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bsdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100383 MGI:1913466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58864 MGI:1929914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700125D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68233 MGI:1915483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs

name	Marcksl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17357 MGI:97143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433759 MGI:108086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16818 MGI:96756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC030183 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230766 MGI:2668032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54709 MGI:1860763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510006D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76799 MGI:1924049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Iqcc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230767 MGI:2446212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc28b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66264 MGI:1913514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txlna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109658 MGI:105968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kpna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16650 MGI:1100836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem39b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230770 MGI:2682939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Khdrbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20218 MGI:893579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 4 Proteins pseudo : _no_value

name	Ptp4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19244 MGI:1277117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622469 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 631 ESTs, 15 Proteins

name	LOC622480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	1700003M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72225 MGI:1919475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Bai2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230775 MGI:2451244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col16a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107581 MGI:1095396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67898 MGI:1915148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcrtr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230777 MGI:2385650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tinagl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94242 MGI:2137617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332942 MGI:2685699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serinc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230779 MGI:1919132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fabp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14077 MGI:95476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619605 MGI:1919955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66585 MGI:1913835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610200G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67149 MGI:1914399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pum1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80912 MGI:1931749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Sdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Laptm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16792 MGI:108046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17180 MGI:106591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ibrdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253106 GeneID:75234 MGI:1922484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 83 ESTs, 5 Proteins product : IBR domain containing 3 transcript_id : XM_204030.6

name	Tmem54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384079 GeneID:66260 MGI:1913510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 54 transcript_id : NM_025452.3

name	Hpca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254583 GeneID:15444 MGI:1336200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hippocalcin transcript_id : NM_010471.2

name	Fndc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087147 GeneID:384061 MGI:1917614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 5 transcript_id : NM_027402.2

name	S100pbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801813 GeneID:74648 MGI:1921898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : S100P binding protein transcript_id : NM_029036.2

name	Yars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351106 GeneID:107271 MGI:2147627
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosyl-tRNA synthetase transcript_id : NM_134151.3

name	C77080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361970 GeneID:97130 MGI:2140651
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C77080 transcript_id : NM_001033189.2

name	Sync (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059477 GeneID:68828 MGI:1916078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syncoilin transcript_id : NM_023485.3

name	Rbbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130570 GeneID:19646 MGI:1194912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma binding protein 4 transcript_id : NM_009030.3

name	Zbtb8os (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369625 GeneID:67106 MGI:1914356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 8 opposite strand transcript_id : NM_025970.2

name	2410081M15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802229 GeneID:73680 MGI:1920930
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410081M15 gene transcript_id : NM_028603.2

name	Zbtb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377519 GeneID:215627 MGI:2387181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 8 transcript_id : NM_153541.3

name	Bsdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981602 GeneID:100383 MGI:1913466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BSD domain containing 1 transcript_id : NM_133889.2

name	Tssk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54144643 GeneID:58864 MGI:1929914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 3 transcript_id : NM_080442.2

name	1700125D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253108 GeneID:68233 MGI:1915483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 14 ESTs product : RIKEN cDNA 1700125D06 gene transcript_id : XM_485446.4

name	Marcksl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130156 GeneID:17357 MGI:97143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MARCKS-like 1 transcript_id : NM_010807.3

name	Hdac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130866 GeneID:433759 MGI:108086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 1 transcript_id : NM_008228.2

name	Lck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372058 GeneID:16818 MGI:96756
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte protein tyrosine kinase transcript_id : NM_010693.2

name	BC030183 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33354246 GeneID:230766 MGI:2668032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030183 transcript_id : NM_182783.1

name	Eif3s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055369 GeneID:54709 MGI:1860763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 2 (beta) transcript_id : NM_018799.1

name	2510006D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802797 GeneID:76799 MGI:1924049
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510006D16 gene transcript_id : NM_029748.2

name	LOC667452 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372530 GeneID:667452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Doublecortin domain containing 2B transcript_id : XM_990619.1

name	Iqcc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124126982 GeneID:230767 MGI:2446212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing C transcript_id : NM_198026.2

name	Ccdc28b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887805 GeneID:66264 MGI:1913514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled coil domain containing 28B transcript_id : NM_025455.2

name	Txlna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598585 GeneID:109658 MGI:105968
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taxilin alpha transcript_id : NM_001005506.2

name	Kpna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364978 GeneID:16650 MGI:1100836
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : karyopherin (importin) alpha 6 transcript_id : NM_008468.3

name	Tmem39b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556283 GeneID:230770 MGI:2682939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 39b transcript_id : NM_199305.1

name	Khdrbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626030 GeneID:20218 MGI:893579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KH domain containing, RNA binding, signal transduction associated 1 transcript_id : NM_011317.3

name	Ptp4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711341 GeneID:19244 MGI:1277117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase 4a2 transcript_id : NM_008974.3

name	LOC622469 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253123 GeneID:622469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 631 ESTs, 15 Proteins product : similar to SRp40-1 transcript_id : XM_886902.3

name	LOC622480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253111 GeneID:622480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to SPOC domain containing 1 transcript_id : XM_886912.3

name	1700003M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253113 GeneID:72225 MGI:1919475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700003M07 gene transcript_id : XM_001473353.1

name	Bai2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414502 GeneID:230775 MGI:2451244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain-specific angiogenesis inhibitor 2 transcript_id : NM_173071.1

name	Col16a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372516 GeneID:107581 MGI:1095396
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XVI, alpha 1 transcript_id : NM_028266.4

name	Pef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801848 GeneID:67898 MGI:1915148
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : penta-EF hand domain containing 1 transcript_id : NM_026441.3

name	Hcrtr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930592 GeneID:230777 MGI:2385650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypocretin (orexin) receptor 1 transcript_id : NM_198959.1

name	Tinagl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892626 GeneID:94242 MGI:2137617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulointerstitial nephritis antigen-like transcript_id : NM_023476.2

name	Gm853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371383 GeneID:332942 MGI:2685699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 853, (NCBI) transcript_id : NM_001034872.2

name	Serinc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802736 GeneID:230779 MGI:1919132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine incorporator 2 transcript_id : NM_172702.2

name	Fabp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753809 GeneID:14077 MGI:95476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid binding protein 3, muscle and heart transcript_id : NM_010174.1

name	Zcchc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981968 GeneID:619605 MGI:1919955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 17 transcript_id : NM_153160.2

name	Wdr57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115298669 GeneID:66585 MGI:1913835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 57 (U5 snRNP specific) transcript_id : NM_025645.2

name	2610200G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367659 GeneID:67149 MGI:1914399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610200G18 gene transcript_id : NM_025998.2

name	Pum1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507675 GeneID:80912 MGI:1931749
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pumilio 1 (Drosophila) transcript_id : NM_030722.1

name	LOC622577 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372540 GeneID:622577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC622577 transcript_id : XM_897188.2

name	Sdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110349994 GeneID:20970 MGI:1349163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syndecan 3 transcript_id : NM_011520.3

name	Laptm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543110 GeneID:16792 MGI:108046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated protein transmembrane 5 transcript_id : NM_010686.2

name	Matn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857809 GeneID:17180 MGI:106591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrilin 1, cartilage matrix protein 1 transcript_id : NM_010769.1

name	LOC622681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94372541 GeneID:622681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC622681 transcript_id : XM_897250.2

name	LOC100041575 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253156 GeneID:100041575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041575 transcript_id : XM_001477132.1

name	Ibrdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253107 GeneID:75234 MGI:1922484
definition	codon_start : 1 product : IBR domain containing 3 protein_id : XP_204030.6

name	Tmem54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270299 CCDS:CCDS18681.1 GeneID:66260 MGI:1913510
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : beta-casein-like protein protein_id : NP_079728.2

name	Hpca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754240 CCDS:CCDS18682.1 GeneID:15444 MGI:1336200
definition	GO_function : GO:0003779 - actin binding [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence ISS] codon_start : 1 product : hippocalcin protein_id : NP_034601.1

name	Fndc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059145 CCDS:CCDS18683.1 GeneID:384061 MGI:1917614
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : peroxisomal protein product : fibronectin type III domain containing 5 protein_id : NP_081678.1

name	S100pbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62899073 CCDS:CCDS18684.1 GeneID:74648 MGI:1921898
definition	codon_start : 1 product : S100P binding protein protein_id : NP_083312.1

name	Yars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981647 CCDS:CCDS18685.1 GeneID:107271 MGI:2147627
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IEA]; GO:0004831 - tyrosine-tRNA ligase activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006437 - tyrosyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tyrosyl-tRNA synthetase protein_id : NP_598912.2

name	C77080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677516 CCDS:CCDS18686.1 GeneID:97130 MGI:2140651
definition	codon_start : 1 product : hypothetical protein LOC97130 protein_id : NP_001028361.1

name	Sync (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059478 CCDS:CCDS18687.1 GeneID:68828 MGI:1916078
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005882 - intermediate filament [Evidence ISS]; GO:0042383 - sarcolemma [Evidence IDA]; GO:0045202 - synapse [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0045103 - intermediate filament-based process [Evidence IDA] codon_start : 1 product : syncoilin protein_id : NP_075974.3

name	Rbbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059484 CCDS:CCDS18688.1 GeneID:19646 MGI:1194912
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0016581 - NuRD complex [Evidence IDA] GO_function : GO:0008094 - DNA-dependent ATPase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence ISS] [Evidence TAS]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : CAF-1 p48 subunit product : retinoblastoma binding protein 4 protein_id : NP_033056.2

name	Zbtb8os (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746142 CCDS:CCDS18689.1 GeneID:67106 MGI:1914356
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : archease; archease (Arch) product : zinc finger and BTB domain containing 8 opposite strand protein_id : NP_080246.1

name	2410081M15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312080 CCDS:CCDS18690.1 GeneID:73680 MGI:1920930
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : novel protein similar to zinc finger and BTB domain containing 8 product : zinc finger and BTB domain containing 8 protein_id : NP_082879.1

name	Zbtb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625944 CCDS:CCDS18691.1 GeneID:215627 MGI:2387181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 8 protein_id : NP_705769.2

name	Bsdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981603 CCDS:CCDS18692.1 GeneID:100383 MGI:1913466
definition	codon_start : 1 product : BSD domain containing 1 protein_id : NP_598650.2

name	Tssk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426825 CCDS:CCDS18693.1 GeneID:58864 MGI:1929914
definition	GO_component : GO:0005622 - intracellular [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence TAS] [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence NAS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0048240 - sperm capacitation [Evidence NAS]; GO:0007283 - spermatogenesis [Evidence IEP] [Evidence ISS] [Evidence IEA] codon_start : 1 note : testis specific serine kinase-3; spermiogenesis associated serine/threonine kinase 22D; testis-specific serine/threonine kinase 3b; testis-specific kinase 3; serine/threonine kinase 22C (spermiogenesis associated) product : spermiogenesis associated serine/threonine kinase 22C protein_id : NP_536690.1

name	1700125D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51709474 GeneID:68233 MGI:1915483
definition	codon_start : 1 product : hypothetical protein LOC68233 protein_id : XP_485446.1

name	Marcksl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754706 CCDS:CCDS18695.1 GeneID:17357 MGI:97143
definition	GO_function : GO:0005516 - calmodulin binding [Evidence IEA] codon_start : 1 product : MARCKS-like protein protein_id : NP_034937.1

name	Hdac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680193 CCDS:CCDS18696.1 GeneID:433759 MGI:108086
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0000118 - histone deacetylase complex [Evidence IPI]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] GO_function : GO:0004407 - histone deacetylase activity [Evidence IEA] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0007492 - endoderm development [Evidence IMP] [Evidence IDA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 1 protein_id : NP_032254.1

name	Lck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859570 CCDS:CCDS18697.1 GeneID:16818 MGI:96756
definition	GO_component : GO:0045121 - lipid raft [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0000242 - pericentriolar material [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence ISS]; GO:0004713 - protein-tyrosine kinase activity [Evidence ISS] [Evidence IEA]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006919 - caspase activation [Evidence ISS]; GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS] [Evidence IEA]; GO:0050870 - positive regulation of T cell activation [Evidence ISS]; GO:0050862 - positive regulation of T cell receptor signaling pathway [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0051249 - regulation of lymphocyte activation [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence ISS]; GO:0050856 - regulation of T cell receptor signaling pathway [Evidence IDA]; GO:0051209 - release of sequestered calcium ion into cytosol [Evidence IDA]; GO:0042493 - response to drug [Evidence ISS]; GO:0030217 - T cell differentiation [Evidence ISS]; GO:0006882 - zinc ion homeostasis [Evidence ISS] codon_start : 1 product : lymphocyte protein tyrosine kinase protein_id : NP_034823.1

name	BC030183 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33354247 GeneID:230766 MGI:2668032
definition	codon_start : 1 product : hypothetical protein LOC230766 protein_id : NP_877584.1

name	Eif3s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055370 CCDS:CCDS18698.1 GeneID:54709 MGI:1860763
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : TGF-beta receptor binding protein; eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD) product : eukaryotic translation initiation factor 3, subunit 2 (beta) protein_id : NP_061269.1

name	2510006D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267454 CCDS:CCDS18699.1 GeneID:76799 MGI:1924049
definition	codon_start : 1 product : hypothetical protein LOC76799 protein_id : NP_084024.1

name	LOC667452 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94372531 GeneID:667452
definition	codon_start : 1 product : similar to Doublecortin domain containing 2B protein_id : XP_995713.1

name	Iqcc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124126983 GeneID:230767 MGI:2446212
definition	codon_start : 1 product : IQ motif containing C protein_id : NP_932143.2

name	Ccdc28b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887806 CCDS:CCDS18700.1 GeneID:66264 MGI:1913514
definition	codon_start : 1 product : coiled coil domain containing 28B protein_id : NP_079731.2

name	Txlna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598586 GeneID:109658 MGI:105968
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA] codon_start : 1 note : taxilin; interleukin 14; taxilin Txln product : taxilin alpha protein_id : NP_001005506.2

name	Kpna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370260 CCDS:CCDS18701.1 GeneID:16650 MGI:1100836
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : karyopherin (importin) alpha 5 product : karyopherin (importin) alpha 6 protein_id : NP_032494.2

name	Tmem39b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556284 CCDS:CCDS18702.1 GeneID:230770 MGI:2682939
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 39b protein_id : NP_955009.1

name	Khdrbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626031 CCDS:CCDS18703.1 GeneID:20218 MGI:893579
definition	GO_component : GO:0016020 - membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0005070 - SH3/SH2 adaptor activity [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0046831 - regulation of RNA export from nucleus [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : src associated in mitosis, 68 kDa product : KH domain containing, RNA binding, signal transduction associated 1 protein_id : NP_035447.3

name	Ptp4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679545 CCDS:CCDS18704.1 GeneID:19244 MGI:1277117
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase 4a2 protein_id : NP_033000.1

name	LOC622469 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895195 GeneID:622469
definition	codon_start : 1 product : similar to SRp40-1 protein_id : XP_891995.1

name	LOC622480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253112 GeneID:622480
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892005.3

name	1700003M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253114 GeneID:72225 MGI:1919475
definition	codon_start : 1 product : hypothetical protein LOC72225 protein_id : XP_001473403.1

name	Bai2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414503 GeneID:230775 MGI:2451244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016527 - brain-specific angiogenesis inhibitor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007422 - peripheral nervous system development [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : G protein-coupled receptor; G protein-coupled receptor brain-specific angiogenesis inhibitor 1 product : brain-specific angiogenesis inhibitor 2 protein_id : NP_775094.1

name	Col16a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410760 GeneID:107581 MGI:1095396
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : [a]1 (XVI) collagen product : procollagen, type XVI, alpha 1 protein_id : NP_082542.2

name	Pef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980937 CCDS:CCDS18706.1 GeneID:67898 MGI:1915148
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : PEF protein with a long N-terminal hydrophobic domain protein_id : NP_080717.2

name	Hcrtr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930593 CCDS:CCDS18707.1 GeneID:230777 MGI:2385650
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016499 - orexin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : orexin receptor type 1 product : hypocretin (orexin) receptor 1 protein_id : NP_945197.1

name	Tinagl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963691 CCDS:CCDS18708.1 GeneID:94242 MGI:2137617
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 note : lipocalin 7, AZ-1; adrenocortical zonation factor 1; androgen-regulated gene 1 product : tubulointerstitial nephritis antigen-like protein_id : NP_075965.1

name	Gm853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702213 GeneID:332942 MGI:2685699
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0006596 - polyamine biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC332942 protein_id : NP_001030044.1

name	Serinc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370016 GeneID:230779 MGI:1919132
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006658 - phosphatidylserine metabolism [Evidence ISS]; GO:0051347 - positive regulation of transferase activity [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : tumor differentially expressed 2-like protein_id : NP_766290.1

name	Fabp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753810 CCDS:CCDS18709.1 GeneID:14077 MGI:95476
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006656 - phosphatidylcholine biosynthesis [Evidence IGI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fatty acid binding protein heart 4; fatty acid binding protein heart 1 product : fatty acid binding protein 3, muscle and heart protein_id : NP_034304.1

name	Zcchc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346607 GeneID:619605 MGI:1919955
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : putative S1 RNA binding domain protein protein_id : NP_694800.1

name	Wdr57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115298670 GeneID:66585 MGI:1913835
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : U5 snRNP-specific protein (Prp8-binding) protein_id : NP_079921.2

name	2610200G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385502 GeneID:67149 MGI:1914399
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67149 protein_id : NP_080274.1

name	LOC622577 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895205 GeneID:622577
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902281.1

name	Pum1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507676 CCDS:CCDS18710.1 GeneID:80912 MGI:1931749
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pumilio 1 protein_id : NP_109647.1

name	Sdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476310 GeneID:20970 MGI:1349163
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence IEA] codon_start : 1 product : syndecan 3 protein_id : NP_035650.2

name	Laptm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754504 CCDS:CCDS18712.1 GeneID:16792 MGI:108046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lysosomal-associated protein transmembrane 5 protein_id : NP_034816.1

name	Matn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857810 CCDS:CCDS18713.1 GeneID:17180 MGI:106591
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0005518 - collagen binding [Evidence IEA]; GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : matrilin 1, cartilage matrix protein 1 protein_id : NP_034899.1

name	LOC622681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82895207 GeneID:622681
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902343.1

name	LOC100041575 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253157 GeneID:100041575
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477182.1

name	LOC100039588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039588
definition	number : 1 pseudo : _no_value

name	LOC100039588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039588
definition	number : 2 pseudo : _no_value

name	LOC100040532 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253122 GeneID:100040532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 4 Proteins product : similar to ribosomal protein L37 pseudo : _no_value transcript_id : XR_032427.1

clone name	MSMg01-486B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-432M19.T7 (MSMg01no432_m19.b1)	MSMg01-432M19.TJ (MSMg01no432_m19.g1)
ACC	AG524732	AG524733
length	794	775
length of high quality (start - end)	338 (69 - 406)	51 (73 - 123)
definition	CHROMAT_FILE: MSMg01no432_m19.b1 PHD_FILE: MSMg01no432_m19.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:56:40 2005	CHROMAT_FILE: MSMg01no432_m19.g1 PHD_FILE: MSMg01no432_m19.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:56:40 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CAAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTCAGGATTCCACATGTCCATAGTCTTTCTTCGGGACCTTTAACCTA GTCTGCCTTAATGCTGTGCTCAAGCTTGGCCTCTGACCTGGCTGCGCAGG GAGAACCCAGCACATAGCAGGGAGGGCTGAGATCTGGGATCTGTCCCAAA GCTGCTGAGTGAATCAACAGCAGAACAGGACCAGAGTCCGGAGACCCCAG TCTCCCAACAACCCCAGCTGGGGCTGGGACTATGACAGGGAGTGAAAGAA ACAAGAAATGCTAGGTGGGTCTGAGCCCAGGCAGTGAGGAGCGTGCTCAT GTTCTTTCTAGTGTTATTCCTAAGGAACAGAAGAAATGAGCTTTGTGCAC CCTTGGTGTTACCCGCACCGCCGTATACTTGACTTATACCGCATGAACTA TTGCATCCCATGTCCCCCAGGCTTGCTTCGTGGAAAGTCCACCTTGTTCC CTTGGTCCTTTGGTAGGTTTTCCTTCTTCCCTATCCTTCTTAACATTTTC TTCCTGGTTCTTTTCCCCCTTTTCTCGCTTCTTTTACTTTTATCTTCTTT TTCCCTCCCCTTTTTTTCTTTTTCTATTTTTTCCCCTCTTTCCCCTTCTT CCCCCTCTTTCTCTTCCTCTCCCCCTTTCTACTTTTTCTCTCTCTTATCC CTTTTTTTTTCATTGCTTTCTTACCTTCTTCTTCTTTTCCTCCCCCCCTC TTTTCCCACTTCCTATTTCCTTACCCTTCTCTTTCTCTCTCCCT	TACTTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXATTCCCTANANATAACATCTATTTTGCA TCTATAAATATATATTTACATAAAATGNNCTTATGCAACAGACNGGGTTT TCTAACCTATTTTTCCCCCTTTCCCTCCTATTANCNCNTCNCNACCTCCT CCCNNTAATCTTCTCCTCCCCCCCCTAANCCTGGTTGGNNNNNATCNGGN AAAATTTCCANNNNNNNACTTCCCNNCTTANNNNNNNTTAANNNNNCCTT TTTTTAANNNNNNNCCTTNNNNNNNNNNNCCCCCCCCTCCCCCNNNNNNN NNNNNTCNNNNNGTTTTTGGGGGGGAGGTGTGTGGGGGGGGGGTGGGTGG AGTGGGGTTGTTGGGGCTGGTTGTTTTGGGTGGTGTTGTTTGTGTTGTGT GTGTGTGGTGTGTGGGGGGCAGGGGGGGAGGGGGGGGAAGGAGGTGGGGG GGGGGGGGGGGGGGGGGGGGAGTGAGAGGGGGGGGAGCGGGGGGGTGGGG GNNNNNNNNNNNNCNNAACGCGCGGGNNNCTTTNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNCNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN CNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNCCNNNNNNNNNC NNNNNCCNNNNNNNNNCNNNNCNNNNNNCNNNNNNCCCNNCCCCCNCNNN NCCCATCCCCCCGGTGTTTTTTGTG
quality values	Open. Hide. 10 10 11 11 13 12 12 10 18 14 14 10 12 12 12 15 20 22 24 24 24 28 41 41 21 15 9 9 9 12 15 10 14 16 10 10 14 18 20 13 12 13 13 17 17 34 34 43 21 19 18 21 23 24 23 21 16 15 10 12 12 14 12 11 11 10 16 13 26 21 28 30 30 33 33 44 50 57 57 57 59 59 59 59 59 59 53 47 47 48 48 50 59 57 57 57 57 54 54 57 54 54 54 54 54 68 68 68 68 68 68 53 53 50 68 57 57 57 57 43 39 37 37 43 59 59 57 54 57 57 57 59 59 68 68 68 68 57 59 59 57 57 68 57 68 68 68 59 57 50 50 50 48 48 68 68 57 57 59 59 59 57 57 57 57 57 57 57 59 57 50 50 50 50 50 57 68 68 68 50 51 50 68 68 57 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 59 59 68 68 68 57 57 57 57 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 59 59 59 68 68 68 68 57 57 47 47 57 57 57 57 57 57 48 47 57 47 57 43 47 47 54 57 57 57 57 68 68 68 68 68 68 68 68 59 59 59 59 59 48 48 48 50 48 57 59 57 48 48 42 42 39 35 32 42 39 48 48 59 59 59 57 44 43 40 39 39 43 39 47 47 47 41 41 59 47 47 47 29 21 11 11 11 12 11 12 13 13 21 19 28 28 32 39 47 48 48 48 48 48 48 48 48 48 48 48 48 57 59 59 48 47 47 43 43 43 48 48 57 54 48 46 39 37 32 32 28 28 28 37 37 48 43 29 21 23 19 28 29 36 43 39 31 32 20 20 20 31 32 28 32 23 23 32 34 39 30 26 16 16 21 27 34 33 27 25 23 17 16 18 25 19 17 10 8 8 8 8 10 10 10 13 10 10 8 8 8 10 8 9 10 11 12 17 21 9 8 8 10 8 8 8 8 10 10 17 22 27 15 20 10 10 10 14 12 10 9 9 10 12 10 11 11 11 11 11 10 11 8 10 10 10 9 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 6 6 6 6 8 10 8 9 9 14 9 9 9 12 10 10 8 11 10 8 8 10 10 8 8 8 7 7 7 10 11 11 11 11 11 11 8 10 8 8 8 8 10 8 8 8 8 9 11 8 10 10 8 8 8 10 10 10 11 13 10 10 8 8 8 8 10 13 16 10 10 11 13 12 9 12 8 8 8 8 11 10 11 10 9 8 8 8 6 6 8 8 8 8 9 10 10 10 8 8 8 12 15 10 10 10 10 10 12 10 10 10 14 10 12 8 8 8 11 9 11 11 23 16 13 9 8 10 8 11 15 26 28 24 21 15 12 10 10 10 12 12 10 17 19 19 16 16 19 16 12 11 11 19 19 22 22 11 8 8 8 12 17 18 21 19 19 18 14 16 15 15 11 7 7 8 10 10 10 10 9 9 9 12 12 10 10 11 10 8 8 6 6 6 6 9 10 11 13 8 8 6 6 8 8 8 8 8 8 8 8 8 12 13 11 17 19 19 14 19 10 11 10 10 10 10 10 10 10 10 13 19 15 11 8 8 8 8 8 8 8 8 8 11 17 14 10 10 8 8 8 8 8 8 10 10 10 15 15 10 10 10 10 13 19 30 26 18 12 11 10 10 10 10 13 14 17 9 8 10 8 10 10 10 10 10 10 11 13 15 10 11 14 12 12 13 12 10 10 9 9 10 16 15 11 12 12	Open. Hide. 6 8 6 6 6 6 9 9 7 7 3 0 0 3 8 7 7 3 0 0 0 0 3 29 18 17 9 7 8 6 7 6 6 3 0 3 15 15 29 21 27 3 0 0 3 21 21 33 33 33 33 27 27 3 0 3 10 6 6 6 8 8 9 12 12 3 0 3 13 17 29 27 31 33 33 59 44 27 27 3 0 3 0 3 21 21 33 30 33 33 33 50 50 59 59 59 36 36 32 32 32 42 44 57 57 57 57 57 57 59 59 59 50 59 50 50 29 29 22 18 13 9 9 9 7 14 3 0 0 3 21 21 39 39 39 39 21 16 16 12 10 18 3 0 3 7 7 9 9 32 32 37 37 29 33 33 22 27 30 28 28 28 32 28 28 24 24 13 16 16 18 25 25 17 13 13 13 18 19 19 8 8 3 0 3 0 3 0 3 3 0 3 0 3 9 9 9 10 12 13 8 8 3 0 0 3 11 7 6 8 8 8 8 8 6 6 9 8 7 21 12 12 9 6 7 8 9 3 0 3 6 6 8 8 8 8 7 3 0 0 0 0 0 3 9 3 0 3 3 0 3 11 7 9 9 12 12 11 9 3 0 0 0 0 0 0 0 3 9 9 10 10 9 3 0 0 3 8 7 3 0 0 0 0 0 0 0 3 9 9 3 0 0 0 0 0 3 9 9 9 9 11 12 13 9 12 3 0 0 0 0 0 0 0 3 8 8 3 0 0 0 0 0 0 0 0 0 0 0 3 8 8 7 8 7 6 8 8 8 15 18 27 3 0 0 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 3 6 6 6 7 7 8 15 8 8 6 7 6 6 6 8 6 8 8 8 15 8 8 8 8 8 9 9 11 15 19 16 9 9 9 9 9 7 7 7 11 11 8 11 6 6 6 6 6 6 8 8 8 10 10 11 10 10 8 8 9 8 8 8 9 9 6 8 8 8 8 8 9 8 8 6 6 6 8 8 8 8 8 10 10 10 10 10 10 10 11 17 15 8 8 8 8 8 14 16 15 17 25 27 10 9 6 6 6 6 7 8 10 8 8 9 9 9 8 8 8 8 8 8 6 6 7 7 6 6 7 8 8 10 10 15 16 17 8 8 7 7 7 8 9 29 29 29 17 13 11 11 11 11 12 11 9 8 8 8 11 6 9 9 14 9 8 8 8 8 8 8 8 8 6 7 9 12 8 8 8 8 15 17 26 21 13 13 3 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 3 6 6 6 6 6 6 6 7 3 0 0 0 3 7 7 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 3 3 0 0 0 0 0 0 0 0 0 3 0 0 0 0 3 0 0 0 0 0 0 3 0 0 0 0 0 0 3 15 3 0 0 3 11 8 8 3 0 3 0 0 0 0 3 6 6 6 6 10 10 11 11 9 7 8 8 8 8 8 8 8 10 9 9 11 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no432_m19.b1 MSMg01no432_m19.b1 CHROMAT_FILE:
MSMg01no432_m19.b1 PHD_FILE: MSMg01no432_m19.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:56:40 2005
         (338 letters)



>mm_chr4_129728278_129729015
          Length = 738

 Score =  646 bits (334), Expect = 0.0
 Identities = 337/338 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   gtccatagtctttcttcgggacctttaacctagtctgccttaatgctgtgctcaagcttg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 538 gtccatagtctttcttcgggacctttaacctagtctgccttaatgctgtgctcaagcttg 479

                                                                       
Query: 61  gcctctgacctggctgcgcagggagaacccagcacatagcagggagggctgagatctggg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 478 gcctctgacctggctgcgcagggagaacccagcacatagcagggagggctgagatctggg 419

                                                                       
Query: 121 atctgtcccaaagctgctgagtgaatcaacagcagaacaggaccagagtccggagacccc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 418 atctgtcccaaagctgctgagtgaatcaacagcagaacaggaccagagtccggagacccc 359

                                                                       
Query: 181 agtctcccaacaaccccagctggggctgggactatgacagggagtgaaagaaacaagaaa 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 358 agtctcccaacaaccccagctggggctgggactatgacagggagtgaaagaaacaagaaa 299

                                                                       
Query: 241 tgctaggtgggtctgagcccaggcagtgaggagcgtgctcatgttctttctagtgttatt 300
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 298 tgctaggtgggtcagagcccaggcagtgaggagcgtgctcatgttctttctagtgttatt 239

                                                 
Query: 301 cctaaggaacagaagaaatgagctttgtgcacccttgg 338
           ||||||||||||||||||||||||||||||||||||||
Sbjct: 238 cctaaggaacagaagaaatgagctttgtgcacccttgg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 17
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 338
Length of database: 738
Length adjustment: 9
Effective length of query: 329
Effective length of database: 729
Effective search space:   239841
Effective search space used:   239841
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information