MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-508L20
Chromosome	4 (Build37)
Map Location	148,558,792 - 148,559,300
singlet/doublet	singlet
Overlap gene	Kif1b
Upstream gene	Ptchd2, Ubiad1, Frap1, Angptl7, Exosc10, LOC100043151, Srm, Masp2, Tardbp, Gm572, LOC100041733, LOC100041742, LOC100041755, Casz1, Pex14, LOC670864, Dffa, Cort, Apitd1, LOC666774, Pgd
Downstream gene	LOC100041794, Ube4b, Rbp7, LOC627985, Nmnat1, Lzic, Ctnnbip1, Clstn1, Pik3cd, D4Ertd429e, Slc25a33, Spsb1, H6pd, Gpr157, Slc2a5, LOC435818
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ptchd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242748 MGI:2444403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubiad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71707 MGI:1918957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56717 MGI:1928394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654812 MGI:3605801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50912 MGI:1355322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043151 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Srm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20810 MGI:102690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Masp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17175 MGI:1330832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tardbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230908 MGI:2387629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Gm572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230909 MGI:2685418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100041733 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100041742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	LOC100041755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Casz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69743 MGI:1196251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56273 MGI:1927868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Dffa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13347 MGI:1196227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cort (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12854 MGI:109538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apitd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69928 MGI:1917178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2444 ESTs, 13 Proteins pseudo : _no_value

name	Pgd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110208 MGI:97553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16561 MGI:108426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041794 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Ube4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63958 MGI:1927086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63954 MGI:1890409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627985 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 152 ESTs, 6 Proteins

name	Nmnat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66454 MGI:1913704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lzic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69151 MGI:1916401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctnnbip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67087 MGI:1915756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clstn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65945 MGI:1929895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3cd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18707 MGI:1098211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	D4Ertd429e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc25a33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70556 MGI:1917806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spsb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74646 MGI:1921896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H6pd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100198 MGI:2140356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269604 MGI:2442046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56485 MGI:1928369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Ptchd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053934 GeneID:242748 MGI:2444403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patched domain containing 2 transcript_id : NM_001083342.1

name	Ubiad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801778 GeneID:71707 MGI:1918957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UbiA prenyltransferase domain containing 1 transcript_id : NM_027873.2

name	Frap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910227 GeneID:56717 MGI:1928394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 12-rapamycin associated protein 1 transcript_id : NM_020009.1

name	Angptl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349012 GeneID:654812 MGI:3605801
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 7 transcript_id : NM_001039554.2

name	Exosc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710081 GeneID:50912 MGI:1355322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 10 transcript_id : NM_016699.1

name	Srm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370065 GeneID:20810 MGI:102690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermidine synthase transcript_id : NM_009272.3

name	Masp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90962989 GeneID:17175 MGI:1330832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannan-binding lectin serine peptidase 2 transcript_id : NM_001003893.2

name	Masp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90962988 GeneID:17175 MGI:1330832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannan-binding lectin serine peptidase 2 transcript_id : NM_010767.3

name	Tardbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56682930 GeneID:230908 MGI:2387629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR DNA binding protein transcript_id : NM_001003899.1

name	Tardbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56682932 GeneID:230908 MGI:2387629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR DNA binding protein transcript_id : NM_001008546.1

name	Tardbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56682934 GeneID:230908 MGI:2387629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR DNA binding protein transcript_id : NM_001003898.1

name	Tardbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56682928 GeneID:230908 MGI:2387629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR DNA binding protein transcript_id : NM_001008545.1

name	Tardbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56682927 GeneID:230908 MGI:2387629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR DNA binding protein transcript_id : NM_145556.3

name	Gm572 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94372786 GeneID:230909 MGI:2685418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : gene model 572, (NCBI) transcript_id : XM_149554.5

name	LOC100041733 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253319 GeneID:100041733
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001476914.1

name	LOC100041742 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253321 GeneID:100041742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : similar to retinitis pigmentosa GTPase regulator transcript_id : XM_001476933.1

name	LOC100041755 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253323 GeneID:100041755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100041755 transcript_id : XM_001476949.1

name	Casz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377979 GeneID:69743 MGI:1196251
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : castor homolog 1, zinc finger (Drosophila) transcript_id : NM_027195.1

name	Pex14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891785 GeneID:56273 MGI:1927868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 14 transcript_id : NM_019781.2

name	Dffa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608118 GeneID:13347 MGI:1196227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA fragmentation factor, alpha subunit transcript_id : NM_001025296.1

name	Dffa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608143 GeneID:13347 MGI:1196227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA fragmentation factor, alpha subunit transcript_id : NM_010044.2

name	Cort (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376224 GeneID:12854 MGI:109538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cortistatin transcript_id : NM_007745.3

name	Apitd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312473 GeneID:69928 MGI:1917178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing, TAF9-like domain 1 transcript_id : NM_027263.1

name	Pgd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486894 GeneID:110208 MGI:97553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphogluconate dehydrogenase transcript_id : NM_001081274.1

name	Kif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990459 GeneID:16561 MGI:108426
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1B transcript_id : NM_207682.2

name	Kif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86990457 GeneID:16561 MGI:108426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 1B transcript_id : NM_008441.2

name	LOC100041794 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253325 GeneID:100041794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041794 transcript_id : XM_001477015.1

name	Ube4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376690 GeneID:63958 MGI:1927086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitination factor E4B, UFD2 homolog (S. cerevisiae) transcript_id : NM_022022.2

name	Rbp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379956 GeneID:63954 MGI:1890409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol binding protein 7, cellular transcript_id : NM_022020.2

name	LOC627985 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253358 GeneID:627985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 152 ESTs, 6 Proteins product : hypothetical LOC627985 transcript_id : XM_892701.3

name	Nmnat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57527869 GeneID:66454 MGI:1913704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicotinamide nucleotide adenylyltransferase 1 transcript_id : NM_133435.1

name	Lzic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801169 GeneID:69151 MGI:1916401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper and CTNNBIP1 domain containing transcript_id : NM_026963.3

name	Ctnnbip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158702 GeneID:67087 MGI:1915756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin beta interacting protein 1 transcript_id : NM_023465.3

name	Clstn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372647 GeneID:65945 MGI:1929895
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calsyntenin 1 transcript_id : NM_023051.2

name	Pik3cd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067113 GeneID:18707 MGI:1098211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase catalytic delta polypeptide transcript_id : NM_008840.2

name	Pik3cd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067115 GeneID:18707 MGI:1098211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase catalytic delta polypeptide transcript_id : NM_001029837.1

name	D4Ertd429e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68342031 GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 429, expressed transcript_id : NM_001025106.1

name	D4Ertd429e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68342039 GeneID:230917 MGI:1196277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 4, ERATO Doi 429, expressed transcript_id : NM_177672.3

name	Slc25a33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647274 GeneID:70556 MGI:1917806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 33 transcript_id : NM_027460.2

name	Spsb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541968 GeneID:74646 MGI:1921896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splA/ryanodine receptor domain and SOCS box containing 1 transcript_id : NM_029035.2

name	H6pd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382659 GeneID:100198 MGI:2140356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) transcript_id : NM_173371.3

name	Gpr157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815862 GeneID:269604 MGI:2442046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 157 transcript_id : NM_177366.3

name	Slc2a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801986 GeneID:56485 MGI:1928369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 5 transcript_id : NM_019741.3

name	LOC435818 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253359 GeneID:435818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : novel member of the solute carrier family 2 (facilitated glucose transporter) Slc2 family transcript_id : XM_001480126.1

name	Ptchd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053935 GeneID:242748 MGI:2444403
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008158 - hedgehog receptor activity [Evidence IEA] codon_start : 1 product : patched domain containing 2 protein_id : NP_001076811.1

name	Ubiad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311819 CCDS:CCDS18936.1 GeneID:71707 MGI:1918957
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004659 - prenyltransferase activity [Evidence IEA] codon_start : 1 product : transitional epithelia response protein protein_id : NP_082149.1

name	Frap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910228 CCDS:CCDS18937.1 GeneID:56717 MGI:1928394
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007281 - germ cell development [Evidence IDA]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : FKBP-rapamycin-associated protein; FKBP-rapamycin-associated protein FRAP; flat-top; angiopoietin-like factor CDT6 product : FK506 binding protein 12-rapamycin associated protein 1 protein_id : NP_064393.1

name	Angptl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196773 CCDS:CCDS18938.1 GeneID:654812 MGI:3605801
definition	codon_start : 1 product : angiopoietin-like 7 protein_id : NP_001034643.1

name	Exosc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710082 CCDS:CCDS18939.1 GeneID:50912 MGI:1355322
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation note : polymyositis/scleroderma autoantigen 2 product : exosome component 10 protein_id : NP_057908.1

name	Srm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678131 CCDS:CCDS18940.1 GeneID:20810 MGI:102690
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004766 - spermidine synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008295 - spermidine biosynthesis [Evidence IEA] codon_start : 1 product : spermidine synthase protein_id : NP_033298.1

name	Masp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54112422 CCDS:CCDS18941.1 GeneID:17175 MGI:1330832
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; mannan-binding lectin serine protease 2 product : mannan-binding lectin serine protease 2 isoform 1 protein_id : NP_001003893.1

name	Masp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754642 CCDS:CCDS18942.1 GeneID:17175 MGI:1330832
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mannan-binding lectin serine protease 2 product : mannan-binding lectin serine protease 2 isoform 2 protein_id : NP_034897.1

name	Tardbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56682933 GeneID:230908 MGI:2387629
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : TAR DNA binding protein isoform 4 protein_id : NP_001008546.1

name	Tardbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56682931 GeneID:230908 MGI:2387629
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : TAR DNA binding protein isoform 3 protein_id : NP_001003899.1

name	Tardbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56682935 GeneID:230908 MGI:2387629
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : TAR DNA binding protein isoform 5 protein_id : NP_001003898.1

name	Tardbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56682929 GeneID:230908 MGI:2387629
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : TAR DNA binding protein isoform 2 protein_id : NP_001008545.1

name	Tardbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704096 GeneID:230908 MGI:2387629
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : TAR DNA binding protein isoform 1 protein_id : NP_663531.1

name	Gm572 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51709688 GeneID:230909 MGI:2685418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_149554.3

name	LOC100041733 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253320 GeneID:100041733
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476964.1

name	LOC100041742 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253322 GeneID:100041742
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476983.1

name	LOC100041755 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253324 GeneID:100041755
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476999.1

name	Casz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124377980 GeneID:69743 MGI:1196251
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : castor product : castor homolog 1, zinc finger protein_id : NP_081471.1

name	Pex14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790153 CCDS:CCDS18950.1 GeneID:56273 MGI:1927868
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : peroxisomal protein Pex14 product : peroxisomal biogenesis factor 14 protein_id : NP_062755.1

name	Dffa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608119 CCDS:CCDS18951.1 GeneID:13347 MGI:1196227
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence IMP] [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : DNA fragmentation factor, alpha subunit isoform a protein_id : NP_001020467.1

name	Dffa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608144 CCDS:CCDS18952.1 GeneID:13347 MGI:1196227
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence IMP] [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : DNA fragmentation factor, alpha subunit isoform b protein_id : NP_034174.2

name	Cort (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680984 CCDS:CCDS18953.1 GeneID:12854 MGI:109538
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : cortistatin protein_id : NP_031771.1

name	Apitd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312474 CCDS:CCDS18954.1 GeneID:69928 MGI:1917178
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : ortholog of human apoptosis-inducing, TAF9-like domain 1 APITD1 product : apoptosis-inducing, TAF9-like domain 1 protein_id : NP_081539.1

name	Pgd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486895 GeneID:110208 MGI:97553
definition	EC_number : 1.1.1.44 GO_function : GO:0050661 - NADP binding [Evidence IEA]; GO:0016646 - oxidoreductase activity, acting on the CH-NH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0008114 - phosphogluconate 2-dehydrogenase activity [Evidence IEA]; GO:0004616 - phosphogluconate dehydrogenase (decarboxylating) activity [Evidence IDA] [Evidence IEA] GO_process : GO:0006098 - pentose-phosphate shunt [Evidence IEA]; GO:0009051 - pentose-phosphate shunt, oxidative branch [Evidence IEA] codon_start : 1 note : 6-phosphogluconate dehydrogenase product : phosphogluconate dehydrogenase protein_id : NP_001074743.1

name	Kif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990460 CCDS:CCDS18956.1 GeneID:16561 MGI:108426
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IDA]; GO:0019894 - kinesin binding [Evidence ISS]; GO:0008017 - microtubule binding [Evidence TAS]; GO:0003777 - microtubule motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0009790 - embryonic development [Evidence NAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0047497 - mitochondrion transport along microtubule [Evidence IDA]; GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2; kinesin heavy chain member 1B; Kif1b beta; Kif1b alpha; N-3 kinesin product : kinesin family member 1B isoform b protein_id : NP_997565.2

name	Kif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86990458 CCDS:CCDS18957.1 GeneID:16561 MGI:108426
definition	GO_component : GO:0030659 - cytoplasmic vesicle membrane [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IDA]; GO:0019894 - kinesin binding [Evidence ISS]; GO:0008017 - microtubule binding [Evidence TAS]; GO:0003777 - microtubule motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008089 - anterograde axon cargo transport [Evidence IMP]; GO:0009790 - embryonic development [Evidence NAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0047497 - mitochondrion transport along microtubule [Evidence IDA]; GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1; kinesin heavy chain member 1B; Kif1b beta; Kif1b alpha; N-3 kinesin product : kinesin family member 1B isoform a protein_id : NP_032467.2

name	LOC100041794 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253326 GeneID:100041794
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477065.1

name	Ube4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968158 CCDS:CCDS18958.1 GeneID:63958 MGI:1927086
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence TAS] [Evidence IEA] GO_function : GO:0019899 - enzyme binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence TAS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0051082 - unfolded protein binding [Evidence NAS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0006457 - protein folding [Evidence NAS]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence TAS]; GO:0009411 - response to UV [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : ubiquitination factor E4B (homologous to yeast UFD2) product : ubiquitination factor E4B protein_id : NP_071305.1

name	Rbp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11968156 CCDS:CCDS18959.1 GeneID:63954 MGI:1890409
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence IDA]; GO:0019841 - retinol binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cytosolic binding protein; cellular retinol binding protein type III product : retinol binding protein 7, cellular protein_id : NP_071303.1

name	LOC627985 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82896077 GeneID:627985
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897794.1

name	Nmnat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57527870 CCDS:CCDS18960.1 GeneID:66454 MGI:1913704
definition	EC_number : 2.7.7.1 GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000309 - nicotinamide-nucleotide adenylyltransferase activity [Evidence IEA] [Evidence ISS]; GO:0004515 - nicotinate-nucleotide adenylyltransferase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0009435 - NAD biosynthesis [Evidence IDA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : nicotinamide mononucleotide adenylyl transferase; NMN adenylyltransferase; nicotinamide mononucleotide adenylyl transferase; NAD(+) diphosphorylase; NAD(+) pyrophosphorylase; deamido-NAD(+) diphosphorylase; deamido-NAD(+) pyrophosphorylase; nicotinate-nucleotide adenylyltransferase; nicotinamide/nicotinate mononucleotide adenylyltransferase 1 product : nicotinamide nucleotide adenylyltransferase 1 protein_id : NP_597679.1

name	Lzic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229082 CCDS:CCDS18961.1 GeneID:69151 MGI:1916401
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008013 - beta-catenin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : leucine zipper and CTNNBIP1 domain containing protein_id : NP_081239.1

name	Ctnnbip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13374561 GeneID:67087 MGI:1915756
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IPI] codon_start : 1 product : catenin, beta interacting protein 1 protein_id : NP_075954.1

name	Clstn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746426 CCDS:CCDS18963.1 GeneID:65945 MGI:1929895
definition	GO_component : GO:0005576 - extracellular region [Evidence IEP]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEP] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA] [Evidence NAS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence TAS]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence NAS] codon_start : 1 note : calsyntenin-1; alcadein alpha product : calsyntenin 1 protein_id : NP_075538.1

name	Pik3cd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067116 GeneID:18707 MGI:1098211
definition	GO_component : GO:0005942 - phosphoinositide 3-kinase complex [Evidence IEA] GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IEA]; GO:0046934 - phosphatidylinositol-4,5-bisphosphate 3-kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IMP]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : p100 delta; phosphatidylinositol 3-kinase catalytic subunit delta; phosphatidylinositol 3-kinase p110 delta; phosphoinositide 3 kinase P110delta product : phosphatidylinositol 3-kinase catalytic delta polypeptide protein_id : NP_001025008.1

name	Pik3cd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067114 GeneID:18707 MGI:1098211
definition	GO_component : GO:0005942 - phosphoinositide 3-kinase complex [Evidence IEA] GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IEA]; GO:0046934 - phosphatidylinositol-4,5-bisphosphate 3-kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IMP]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : p100 delta; phosphatidylinositol 3-kinase catalytic subunit delta; phosphatidylinositol 3-kinase p110 delta; phosphoinositide 3 kinase P110delta product : phosphatidylinositol 3-kinase catalytic delta polypeptide protein_id : NP_032866.2

name	D4Ertd429e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68342032 CCDS:CCDS18964.1 GeneID:230917 MGI:1196277
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hypothetical protein LOC230917 isoform a protein_id : NP_001020277.1

name	D4Ertd429e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68342040 CCDS:CCDS18965.1 GeneID:230917 MGI:1196277
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC230917 isoform b protein_id : NP_808340.2

name	Slc25a33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647275 GeneID:70556 MGI:1917806
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : novel mitochondrial carrier protein domains containing protein product : mitochondrial carrier protein protein_id : NP_081736.2

name	Spsb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18141301 CCDS:CCDS18966.1 GeneID:74646 MGI:1921896
definition	codon_start : 1 product : SPRY domain-containing SOCS box protein SSB-1 protein_id : NP_083311.1

name	H6pd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982147 CCDS:CCDS18967.1 GeneID:100198 MGI:2140356
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0017057 - 6-phosphogluconolactonase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0047936 - glucose 1-dehydrogenase activity [Evidence IEA]; GO:0004345 - glucose-6-phosphate 1-dehydrogenase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006098 - pentose-phosphate shunt [Evidence IDA] codon_start : 1 note : glucose-6-phosphate dehydrogenase 1 product : hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) protein_id : NP_775547.2

name	Gpr157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815863 GeneID:269604 MGI:2442046
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : novel 7 transmembrane receptor (Secretin family) domain containing protein product : G protein-coupled receptor 157 protein_id : NP_796340.2

name	Slc2a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543728 CCDS:CCDS18968.1 GeneID:56485 MGI:1928369
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fructose transporter product : solute carrier family 2 (facilitated glucose transporter), member 5 protein_id : NP_062715.2

name	LOC435818 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253360 GeneID:435818
definition	codon_start : 1 product : similar to novel member of the solute carrier family 2 (facilitated glucose transporter) Slc2 family protein_id : XP_001480176.1

name	LOC670864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670864
definition	number : 1 pseudo : _no_value

name	LOC100043151 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253356 GeneID:100043151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_034507.1

name	LOC666774 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253357 GeneID:666774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 2444 ESTs, 13 Proteins product : similar to ribosomal protein SA pseudo : _no_value transcript_id : XR_034527.1

clone name	MSMg01-344B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095I23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-508L20.T7 (MSMg01no508_l20.b1)	MSMg01-508L20.TJ (MSMg01no508_l20.g1)
ACC	AG582581	AG582582
length	776	780
length of high quality (start - end)	511 (76 - 586)	204 (81 - 284)
definition	CHROMAT_FILE: MSMg01no508_l20.b1 PHD_FILE: MSMg01no508_l20.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:37:45 2005	CHROMAT_FILE: MSMg01no508_l20.g1 PHD_FILE: MSMg01no508_l20.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:37:45 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	GGGGNACTCAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XCGCGGAATTCCAGGACAGTCCGGGCTACACAGAGAAATCCTGTCTCAGA AAACTAAAAAAAAAAAAAAAAAGCAGCCAGTTCTCTTAACCACTGAGACA TATTTCTGACCCTACTATCTGGTACTTTTTGGTTTTGTTCTATTTACTTA TTCATTTGTTCATTCATTCATTCGTTCGTTCGTTCATTTGGGTTTTTTGC GACATGGTCTAACTGTGTATCATGGGCCTGACCATCTGGCACGTTTTGAA AGTCTGTCTCCCTTCTTCACTAATGTATGCTCCGCTCCATGAGTGCAGGA CTTTGCCATGTGCTTTGAACAATAGGTGCTTGGCGTGTGTGTGCAGGCTA TGTAATAGCAGGGAGAATTAGAGACACATATAGCTTCTCATTCTTTCTCT CCCCTCCCTCATCTCTCTCCTTCCTCCTCCTCCTCTTCTTCTTCACTCTG GGGACAGAAACAAGGGTTTGGTGCGTTGCCTATGAGCAGTAATAATTGTG TTACAGAGGCTTGTTTTCTTTAATGACTTTGAATCAGCCTTAAAAAGATG GCTATCTTAGACGACTTTTGCTGCTCTCTGTGGCAGAGGCAGACGTAAAG TGCTTGTCATATTAGTGTGAGAACCTGCGTTCAGATCCACAGCGCCCGTG TAAAAAAAGTCGGCTCTGATCCCCTGGCTGAGGCGCGGGAACCGGAAATC CTGTGCTTGCTTGTGTCTAGACAAAT	NTTGGGCGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTGAGTGACTAAAAAGACAAC AGGGGAGGCTGGCTAGATGGCTCAGTGGGTAAGAGCACTGACTGCTCTTC CAGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGTTCACAACTAC TCATAATGAGATCTGATACCCTCCTTCTGGTACGTCTGAAGTAAGCTACT ATTATGGAAAGGAGAGGAGGGGAGGGGAGGGGANNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNTTTTTTTTTTNTNTTTTTNTTTTTTTTNTTTTT TTTTTTTTTTTTTTTTTTTGTCCCCCCCCCCCNTNCCCTTGTTGCGCCCT TTTTTTTTTGTCNCGCCTTTTTGCCCTGCCCGCTGTTGCTGCCCTCTGTT GCCCCTGTTTTGGTGTTTTTTCTTCTTGCGTGTGTTGTTGGTTGCTTTTT TTCCTCTTTTTTTTTTTTTGCGCTTTCTCCTTTTTTCGGTTTTTTTGTTC CTTTTTTTTTCTGTCTCTTTTTGGGGTGTTTTTTTTTTTCTTTTCTCTTT GTTTCGNGCCCGCTCGGTGTGTTTTTTTGTTTCTTCTTTCTTTTGTGCTC GTTGTTCTTTTTCGTTACCTTTTTGTTTTCCTCTTTTCTGTTGGCGCGTT CTCCTGTTTTTCTATTGTAGTGAATAAGGA
quality values	Open. Hide. 7 7 7 3 0 3 6 6 6 8 8 10 12 16 16 28 34 37 34 27 18 18 25 26 19 15 15 19 24 24 41 22 19 18 18 16 19 27 9 9 9 9 10 9 8 8 8 8 8 11 11 14 19 30 30 31 31 36 31 31 28 28 28 25 21 19 11 9 9 9 9 9 9 9 12 27 22 28 33 33 31 31 36 36 57 36 36 36 50 50 50 59 57 57 47 37 42 37 37 48 59 48 57 50 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 44 44 35 35 39 39 47 57 57 57 57 68 57 57 68 57 57 57 57 50 50 57 57 48 50 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 38 43 20 26 17 17 18 27 38 43 62 62 62 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 59 57 57 57 57 57 57 54 54 57 59 57 57 57 57 57 57 57 50 50 42 36 28 27 27 27 27 27 33 33 43 44 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 57 57 48 48 48 48 48 57 59 59 59 59 44 37 43 36 39 37 39 37 31 31 39 32 37 43 59 59 59 59 41 41 41 43 43 43 43 57 57 48 48 48 37 37 28 28 28 37 37 37 37 37 39 43 43 43 43 43 36 36 36 37 34 32 24 26 17 17 17 30 28 34 25 25 25 34 34 36 36 35 32 27 29 37 37 37 41 39 39 43 32 29 24 21 17 10 10 10 11 15 21 22 22 18 23 15 15 15 23 17 15 16 11 21 19 22 17 19 9 10 11 12 12 11 15 12 25 27 28 28 28 34 28 28 20 24 28 24 18 14 12 14 12 16 11 11 9 9 9 20 15 13 11 11 11 11 17 24 16 17 12 13 14 16 16 12 13 11 11 11 10 9 9 9 9 9 9 10 10 10 11 11 11 11 11 18 12 15 11 11 8 8 7 8 7 8 10 9 11 8 7 8 8 10 8 16 9 11 9 9 10 9 9 11 24 30 22 12 10 12 10 9 9 9 13 15 12 10 11 12 10 10 6 6 6 6 6 8 10 11 11 12 11 13 11 11 10 9 8 8 8 8 8 9 9 16 8 8 8 8 8 10 6 6 6 8 8 12 10 6 6 7 6 8 6 6 8 8 6 6 6 8 8 10 10 10	Open. Hide. 0 3 7 7 6 6 6 7 10 10 11 11 11 11 24 21 39 30 27 25 24 21 22 25 21 23 3 0 3 25 19 39 44 44 25 25 8 3 0 3 6 6 8 8 8 12 8 10 8 12 12 23 19 30 33 33 37 33 33 50 47 47 40 27 23 6 6 6 6 6 6 6 6 17 16 21 25 28 30 30 37 37 39 39 47 47 53 53 53 53 59 59 59 59 53 53 50 50 50 50 53 47 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 48 48 29 37 28 28 28 44 44 59 59 57 57 57 68 68 68 68 57 57 57 57 57 57 59 68 68 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 54 57 57 57 57 57 57 57 57 52 59 57 57 57 68 57 68 68 68 57 57 54 52 50 50 50 54 57 57 57 57 57 57 59 59 59 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 59 59 59 59 59 59 54 54 54 59 59 68 68 68 68 68 68 68 68 68 59 59 57 57 57 68 68 68 68 68 68 59 59 59 59 59 59 59 57 48 48 48 57 57 57 57 53 53 53 53 50 50 50 59 59 59 44 25 25 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 11 11 19 19 19 19 15 8 8 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 8 11 17 8 8 8 10 10 3 0 3 0 3 15 10 10 3 0 3 10 11 14 12 10 8 3 0 3 11 15 10 10 8 13 11 10 8 8 8 10 8 10 10 10 13 15 13 9 9 6 6 6 6 6 6 11 15 8 8 8 19 19 15 3 0 3 0 3 11 8 8 6 6 8 8 10 8 8 8 10 8 9 16 26 28 31 18 11 8 8 8 8 6 3 0 3 9 11 8 8 8 8 13 10 10 10 10 10 6 6 8 10 10 10 8 8 8 8 13 10 10 8 8 8 8 10 10 8 8 8 8 10 12 8 8 8 10 10 10 10 23 23 14 13 8 8 8 8 12 12 9 13 10 8 9 10 8 8 8 8 8 8 8 8 10 10 10 10 10 10 8 8 10 10 8 7 8 8 9 13 15 12 12 11 11 9 9 9 11 10 12 13 15 19 8 8 10 10 8 10 8 8 8 8 8 8 13 9 9 8 8 8 9 9 15 17 19 14 10 10 10 12 13 14 16 18 17 15 10 8 7 7 8 8 11 17 12 11 11 10 12 10 9 10 10 9 9 9 8 8 13 12 13 9 9 9 11 11 16 12 11 9 10 12 12 9 9 9 9 10 10 8 8 8 12 13 20 10 10 6 6 6 7 8 8 10 10 3 0 3 8 13 13 11 10 8 8 8 8 6 6 6 6 8 8 19 10 11 11 11 13 11 15 13 8 8 6 6 8 11 8 7 6 8 8 8 8 6 6 8 10 8 8 8 8 8 8 8 8 8 9 13 19 10 10 10 10 7 7 8 8 10 10 6 8 6 6 8 8 9 9 8 8 8 8 8 8 15 11 16 11 11 8 8 8 8 6 6 6 6 8 10 8 8 8 6 6 6 6 8 12 8 8 6 6 8 8 6 6 8 8 8 8 8 9 8 8 8 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no508_l20.b1 MSMg01no508_l20.b1 CHROMAT_FILE:
MSMg01no508_l20.b1 PHD_FILE: MSMg01no508_l20.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:37:45 2005
         (511 letters)



>mm_chr4_148558582_148559492
          Length = 911

 Score =  951 bits (492), Expect = 0.0
 Identities = 506/512 (98%), Gaps = 4/512 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctacacagagaaatcctgtctcagaaaact-aaaaaaaaaaaaaaaaagcagccagttct 59
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 719 ctacacagagaaatcctgtctcagaaaactaaaaaaaaaaaaaaaaaagcagccagttct 660

                                                                       
Query: 60  cttaaccactgagacatatttctgaccctactatctggtactttttggttttgttctatt 119
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 659 cttaaccactgagacatatttctgaccctactatctggtactttttggttttgttctatt 600

                                                                       
Query: 120 tacttattcatttgttcattcattcattcgttcgttcgttcatttgggttttttgcgaca 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 599 tacttattcatttgttcattcattcattcgttcgttcgttcatttgggttttttgcgaca 540

                                                                       
Query: 180 tggtctaactgtgtatcatgggcctgaccatctggcacgttttgaaagtctgtctccctt 239
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 539 tggtctaactgtgtatcatgggcctgaccatctggcacgttttgaaagtctgtctccctt 480

                                                                       
Query: 240 cttcactaatgtatgctccgctccatgagtgcaggactttgccatgtgctttgaacaata 299
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 cttcactaatgtatgctccgctccatgagtgcaggactttgccatgtgctttgaacaata 420

                                                                       
Query: 300 ggtgcttggcgtgtgtgtgcaggctatgtaatagcagggagaattagagacacatatagc 359
           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||
Sbjct: 419 ggtgcttggcgtgtgtgtgcaggctgtgtaatagcagggagaattagagacacatagagc 360

                                                                       
Query: 360 ttctcattctttctctcccctccctcatctctctccttcctcctcctcctcttcttcttc 419
           |||||||||||||||||||||||||||||||||||||||||||||||||   ||||||||
Sbjct: 359 ttctcattctttctctcccctccctcatctctctccttcctcctcctcc---tcttcttc 303

                                                                       
Query: 420 actctggggacagaaacaagggtttggtgcgttgcctatgagcagtaataattgtgttac 479
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 actctggggacagaaacaagggtttggtgcgttgcctatgagcagtaataattgtgttac 243

                                           
Query: 480 agaggcttgttttctttaatgactttgaatca 511
           ||||||||||||||||||||||||||||||||
Sbjct: 242 agaggcttgttttctttaatgactttgaatca 211


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 32
Number of extensions: 3
Number of successful extensions: 3
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 511
Length of database: 911
Length adjustment: 10
Effective length of query: 501
Effective length of database: 901
Effective search space:   451401
Effective search space used:   451401
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information