MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-014J19
Chromosome	5 (Build37)
Map Location	108,452,355 - 108,453,443
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tgfbr3, LOC666518, Brdt, LOC666535, Abhd7, 4921521K07Rik, LOC72342, 1700028K03Rik, Glmn, AW060207, Gfi1, LOC100042473, Evi5, 1700013N18Rik, Rpl5, 2900024C23Rik
Downstream gene	LOC675566, Mtf2, Tmed5, Ccdc18, EG633606, LOC666614, Dr1, Pigg, Pde6b, Atp5k, Mfsd7, Pcgf3, LOC100042557, Cplx1, LOC100042571, Gak, Tmem175, Dgkq, Idua, Slc26a1, LOC100042616, Fgfrl1, LOC671564, 1810008K16Rik, EG627479, EG435864, EG667087, LOC100041615, V2r16, LOC545792
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tgfbr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21814 MGI:104637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Brdt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114642 MGI:1891374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC666535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Abhd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384214 MGI:2686228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921521K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70902 MGI:1918152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC72342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:72342
definition	note : LSM12 homolog (S. cerevisiae) pseudogene pseudo : _no_value

name	1700028K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76421 MGI:1923671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170823 MGI:2141180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW060207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231571 MGI:2141142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14581 MGI:103170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Evi5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14020 MGI:104736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013N18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73318 MGI:1920568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Rpl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19983 MGI:102854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900024C23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67266 MGI:1914516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 6 Proteins pseudo : _no_value

name	Mtf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17765 MGI:105050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73130 MGI:1921586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73254 MGI:1922974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG633606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633606 MGI:3648119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13486 MGI:1100515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pigg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433931 MGI:3576484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18587 MGI:97525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11958 MGI:106636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243197 MGI:2442629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcgf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69587 MGI:1916837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 645 ESTs, 5 Proteins

name	Cplx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12889 MGI:104727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Gak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231580 MGI:2442153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72392 MGI:1919642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgkq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110524 MGI:102918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idua (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15932 MGI:96418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231583 MGI:2385894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	Fgfrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116701 MGI:2150920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671564 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	1810008K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67366 MGI:1914616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627479 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627479 MGI:3642986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	EG435864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435864 MGI:3643093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 29 Proteins

name	EG667087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667087 MGI:3647958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	V2r16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22307 MGI:1316730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545792 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 4 Proteins pseudo : _no_value

name	Tgfbr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271510 GeneID:21814 MGI:104637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta receptor III transcript_id : NM_011578.2

name	Brdt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120431735 GeneID:114642 MGI:1891374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain, testis-specific transcript_id : NM_054054.2

name	Brdt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120431732 GeneID:114642 MGI:1891374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain, testis-specific transcript_id : NM_001079873.1

name	Abhd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134948535 GeneID:384214 MGI:2686228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 7 transcript_id : NM_001001804.2

name	4921521K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802365 GeneID:70902 MGI:1918152
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921521K07 gene transcript_id : NM_027599.2

name	1700028K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33286439 GeneID:76421 MGI:1923671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700028K03 gene transcript_id : NM_182745.1

name	Glmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875423 GeneID:170823 MGI:2141180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glomulin, FKBP associated protein transcript_id : NM_133248.1

name	AW060207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450300 GeneID:231571 MGI:2141142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW060207 transcript_id : NM_144911.1

name	Gfi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778929 GeneID:14581 MGI:103170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor independent 1 transcript_id : NM_010278.2

name	LOC100042473 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254152 GeneID:100042473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042473 transcript_id : XM_001478783.1

name	Evi5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185904 GeneID:14020 MGI:104736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecotropic viral integration site 5 transcript_id : NM_007964.2

name	Rpl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956081 GeneID:19983 MGI:102854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L5 transcript_id : NM_016980.1

name	2900024C23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352628 GeneID:67266 MGI:1914516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900024C23 gene transcript_id : NM_026062.3

name	Mtf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887768 GeneID:17765 MGI:105050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metal response element binding transcription factor 2 transcript_id : NM_013827.2

name	Tmed5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802491 GeneID:73130 MGI:1921586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 protein transport domain containing 5 transcript_id : NM_028876.2

name	Ccdc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037312 GeneID:73254 MGI:1922974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 18 transcript_id : NM_028481.1

name	Dr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129880 GeneID:13486 MGI:1100515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : down-regulator of transcription 1 transcript_id : NM_026106.4

name	Pigg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486986 GeneID:433931 MGI:3576484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class G transcript_id : NM_001081234.1

name	Pde6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930734 GeneID:18587 MGI:97525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide transcript_id : NM_008806.2

name	Atp5k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715997 GeneID:11958 MGI:106636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F1F0 complex, subunit e transcript_id : NM_007507.2

name	Mfsd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803112 GeneID:243197 MGI:2442629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 7 transcript_id : NM_172883.2

name	Pcgf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802615 GeneID:69587 MGI:1916837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 3 transcript_id : NM_172716.3

name	LOC100042557 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254155 GeneID:100042557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 645 ESTs, 5 Proteins product : similar to ribosomal protein L34 transcript_id : XM_001478936.1

name	Cplx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542415 GeneID:12889 MGI:104727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complexin 1 transcript_id : NM_007756.2

name	LOC100042571 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254157 GeneID:100042571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042571 transcript_id : XM_001478967.1

name	Gak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51317386 GeneID:231580 MGI:2442153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin G associated kinase transcript_id : NM_153569.1

name	Tmem175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982620 GeneID:72392 MGI:1919642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 175 transcript_id : NM_028223.2

name	Dgkq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39841022 GeneID:110524 MGI:102918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, theta transcript_id : NM_199011.1

name	Idua (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382287 GeneID:15932 MGI:96418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronidase, alpha-L- transcript_id : NM_008325.2

name	Slc26a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543720 GeneID:231583 MGI:2385894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26 (sulfate transporter), member 1 transcript_id : NM_174870.2

name	LOC100042616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254159 GeneID:100042616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100042616 transcript_id : XM_001479076.1

name	Fgfrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905100 GeneID:116701 MGI:2150920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor-like 1 transcript_id : NM_054071.1

name	LOC671564 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254116 GeneID:671564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to ring finger protein 212 transcript_id : XM_001476621.1

name	1810008K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71037400 GeneID:67366 MGI:1914616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810008K16 gene transcript_id : NM_026109.2

name	EG627479 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375089 GeneID:627479 MGI:3642986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG627479 transcript_id : XM_892149.2

name	EG435864 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82899196 GeneID:435864 MGI:3643093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 29 Proteins product : predicted gene, EG435864 transcript_id : XM_892161.1

name	LOC100041615 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254119 GeneID:100041615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041615 transcript_id : XM_001476691.1

name	V2r16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529455 GeneID:22307 MGI:1316730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 16 transcript_id : NM_009491.2

name	Tgfbr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271511 CCDS:CCDS19499.1 GeneID:21814 MGI:104637
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : betaglycan product : transforming growth factor, beta receptor III protein_id : NP_035708.2

name	Brdt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120431736 CCDS:CCDS19500.1 GeneID:114642 MGI:1891374
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence IDA]; GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant 1; female sterile homeotic-related gene 3; RING3-like protein product : bromodomain, testis-specific isoform A protein_id : NP_473395.2

name	Brdt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120431733 GeneID:114642 MGI:1891374
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence IDA]; GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant 2; female sterile homeotic-related gene 3; RING3-like protein product : bromodomain, testis-specific isoform B protein_id : NP_001073342.1

name	Abhd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134948536 CCDS:CCDS19501.1 GeneID:384214 MGI:2686228
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : epoxide hydrolase-related protein_id : NP_001001804.2

name	4921521K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037223 CCDS:CCDS19502.1 GeneID:70902 MGI:1918152
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70902 protein_id : NP_081875.1

name	1700028K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33286440 CCDS:CCDS19504.1 GeneID:76421 MGI:1923671
definition	codon_start : 1 product : hypothetical protein LOC76421 protein_id : NP_877422.1

name	Glmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875424 CCDS:CCDS19505.1 GeneID:170823 MGI:2141180
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005171 - hepatocyte growth factor receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0042692 - muscle cell differentiation [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0042130 - negative regulation of T cell proliferation [Evidence ISS]; GO:0050715 - positive regulation of cytokine secretion [Evidence ISS]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence ISS]; GO:0042327 - positive regulation of phosphorylation [Evidence ISS]; GO:0040029 - regulation of gene expression, epigenetic [Evidence ISS]; GO:0001570 - vasculogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : FKBP-associated protein product : glomulin, FKBP associated protein protein_id : NP_573511.1

name	AW060207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450301 CCDS:CCDS19506.1 GeneID:231571 MGI:2141142
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231571 protein_id : NP_659160.1

name	Gfi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753974 GeneID:14581 MGI:103170
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007638 - mechanosensory behavior [Evidence IMP]; GO:0009996 - negative regulation of cell fate specification [Evidence IMP]; GO:0042660 - positive regulation of cell fate specification [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : growth factor independent 1 protein_id : NP_034408.1

name	LOC100042473 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254153 GeneID:100042473
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478833.1

name	Evi5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185905 GeneID:14020 MGI:104736
definition	codon_start : 1 product : ecotropic viral integration site 5 protein_id : NP_031990.2

name	Rpl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956082 GeneID:19983 MGI:102854
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L5 protein_id : NP_058676.1

name	2900024C23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313032 GeneID:67266 MGI:1914516
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC67266 protein_id : NP_080338.1

name	Mtf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887769 GeneID:17765 MGI:105050
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : metal response element DNA-binding protein M96 product : metal response element binding transcription factor 2 protein_id : NP_038855.2

name	Tmed5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746165 CCDS:CCDS19508.1 GeneID:73130 MGI:1921586
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane emp24 protein transport domain containing 5 protein_id : NP_083152.1

name	Ccdc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037313 GeneID:73254 MGI:1922974
definition	GO_component : GO:0009279 - outer membrane (sensu Proteobacteria) [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : sarcoma antigen NY-SAR-41 protein_id : NP_082757.1

name	Dr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754097 CCDS:CCDS19509.1 GeneID:13486 MGI:1100515
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : down-regulator of transcription 1 protein_id : NP_080382.2

name	Pigg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486987 GeneID:433931 MGI:3576484
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] GO_function : GO:0051267 - CP2 mannose-ethanolamine phosphotransferase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0008484 - sulfuric ester hydrolase activity [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phosphatidylinositol glycan, class G product : phosphatidylinositol glycan anchor biosynthesis, class G protein_id : NP_001074703.1

name	Pde6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930735 CCDS:CCDS19510.1 GeneID:18587 MGI:97525
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0047555 - 3',5'-cyclic-GMP phosphodiesterase activity [Evidence IEA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0009583 - detection of light stimulus [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : phosphodiesterase, cGMP, rod receptor, beta polypeptide; retinal degeneration 1; cGMP-phosphodiesterase beta-subunit product : phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide protein_id : NP_032832.2

name	Atp5k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715998 GeneID:11958 MGI:106636
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F1F0 complex, subunit e protein_id : NP_031533.2

name	Mfsd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370346 CCDS:CCDS19511.1 GeneID:243197 MGI:2442629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : major facilitator superfamily domain containing 7 protein_id : NP_766471.1

name	Pcgf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044444 CCDS:CCDS19512.1 GeneID:69587 MGI:1916837
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : ring finger protein 3 product : polycomb group ring finger 3 protein_id : NP_766304.2

name	LOC100042557 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254156 GeneID:100042557
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478986.1

name	Cplx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542416 GeneID:12889 MGI:104727
definition	GO_component : GO:0031201 - SNARE complex [Evidence IDA] GO_function : GO:0005326 - neurotransmitter transporter activity [Evidence IMP]; GO:0019905 - syntaxin binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IMP]; GO:0016079 - synaptic vesicle exocytosis [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : complexin 1 protein_id : NP_031782.2

name	LOC100042571 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254158 GeneID:100042571
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479017.1

name	Gak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317387 CCDS:CCDS19513.1 GeneID:231580 MGI:2442153
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin G associated kinase protein_id : NP_705797.1

name	Tmem175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982621 CCDS:CCDS19514.1 GeneID:72392 MGI:1919642
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72392 protein_id : NP_082499.2

name	Dgkq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841023 CCDS:CCDS19515.1 GeneID:110524 MGI:102918
definition	GO_function : GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, delta (110 kDa) product : diacylglycerol kinase, theta protein_id : NP_950176.1

name	Idua (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680349 CCDS:CCDS19516.1 GeneID:15932 MGI:96418
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA]; GO:0003940 - L-iduronidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation function : a-L-iduronidase note : alpha-L-iduronidase product : iduronidase, alpha-L- protein_id : NP_032351.1

name	Slc26a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543721 CCDS:CCDS19517.1 GeneID:231583 MGI:2385894
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015108 - chloride transporter activity [Evidence IDA]; GO:0019531 - oxalate transporter activity [Evidence IDA]; GO:0008271 - sulfate porter activity [Evidence IEA]; GO:0015116 - sulfate transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IDA]; GO:0019532 - oxalate transport [Evidence IDA]; GO:0008272 - sulfate transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sulfate anion transporter-1; solute carrier family 26, member 1 product : solute carrier family 26 (sulfate transporter), member 1 protein_id : NP_777359.2

name	LOC100042616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254160 GeneID:100042616
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479126.1

name	Fgfrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905101 CCDS:CCDS19518.1 GeneID:116701 MGI:2150920
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0001571 - non-tyrosine kinase fibroblast growth factor receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 note : fibroblast growth factor receptor 5 product : fibroblast growth factor receptor-like 1 protein_id : NP_473412.1

name	LOC671564 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254117 GeneID:671564
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476671.1

name	1810008K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71037401 CCDS:CCDS19519.1 GeneID:67366 MGI:1914616
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : glycoprotein 25L protein_id : NP_080385.2

name	EG627479 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375090 GeneID:627479 MGI:3642986
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_897242.2

name	EG435864 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899197 GeneID:435864 MGI:3643093
definition	codon_start : 1 product : similar to predicted gene, EG623734 protein_id : XP_897254.1

name	LOC100041615 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254120 GeneID:100041615
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476741.1

name	V2r16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529456 GeneID:22307 MGI:1316730
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 16 product : vomeronasal 2, receptor, 16 protein_id : NP_033517.2

name	LOC666518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666518
definition	number : 1 pseudo : _no_value

name	LOC666535 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666535
definition	number : 1 pseudo : _no_value

name	EG633606 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633606
definition	number : 2 pseudo : _no_value

name	EG633606 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633606
definition	number : 1 pseudo : _no_value

name	LOC666614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666614
definition	number : 1 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 7 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 6 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 5 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 4 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 3 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 2 pseudo : _no_value

name	EG667087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667087
definition	number : 1 pseudo : _no_value

name	1700013N18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253971 GeneID:73318 MGI:1920568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700013N18 gene pseudo : _no_value transcript_id : XR_035129.1

name	LOC675566 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254154 GeneID:675566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 6 Proteins product : similar to ribosomal protein S19 pseudo : _no_value transcript_id : XR_033890.1

name	LOC545792 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254161 GeneID:545792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 4 Proteins product : similar to survival motor neuron domain containing 1 pseudo : _no_value transcript_id : XR_034056.1

clone name	MSMg01-120O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-455H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-520M11
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-181C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-014J19.b	B6Ng01-014J19.g
ACC	DH849105	DH849106
length	1,074	1,121
definition	DH849105\|Mus musculus domesticus DNA, BAC clone: B6Ng01-014J19, 5' end.	DH849106\|Mus musculus domesticus DNA, BAC clone: B6Ng01-014J19, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcacttatatgagagaacaagccaaagcttatggcctgggcattta ttgataattagtttcagtcattattccgggagcgggggctgggaaggaaa agcttgggatttattttttacagatttgtctgggtaaccctgactgacct gggaactctgtagatcagtctggactttaactcagagacatctgcctgtc tctgtctcccatctaaaggcaggcaacaccactgccctttgaaaatcttt tcttaaacagatttccagagctagaaaacaactacaggttttgggagttg catttgattcacttagatccttctcaagacttctgcctctccccactcgc aagtctcttacactaagggcacggccaatcactcaggctgttctggtaga tacctcacagatgtagatgtagtcccaggacccctttctcttcagggaaa gactaccttttcttctggagtatgtttttcctgctacaaactctgctctt tggttacacttcatgactgctggaaccatgagccaagcaggccaatctga ccccagcacaggacagacctgttaaggcaaggtctaaccacaagctcagc atttatccccagtttttttttcccctttggaatgtagaaagaaaaactat tcctctaagaaggcaaagctgcaagccccaaggcaggggagtgctaatag cgttcttggcaatcccgatttgcagtgaagctacctgaaagaataaactg aataagcagaaagattctaaggatagggaggctaactagccctcttgggt tccagatctcttcagattcctatttaaccctactgcaattccaagaactg ctaaatccctacctctgcctaatctaattgcatttctgtcctgagaaaag tgtcccagtgcaatgtcttctctacattgactcaagttctaattaaaccc catctccttccctcgctataaattcctctctaagtcctaggagaactatc aactactgcttggactagtcctctggatacaggtttctcttgcagatatg aagtagcacttggcgacgagagac	gaattctcacccgaggaataccgaatggctgagaagcacctgaaaaaata ttcaacatccttaatcatcagttaaatacaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaaggtcaaaaactgacagcagatg ctggcgaggatgtggagaaagaggaacactccttcattgctggtggtatt gcaagcttgtgcaaccactcttgaaatcagtttggcgattcctcagaaaa ttggacatagaactaccggaagatccagctatacctctcctgggcatata ttcagaagatgttccaatttgtaataaggacacatgctccactatgttca tatcagccttatttataatagtcagaagctggaaagaacccagatgtccc tcaacagaggaatggatacagaaaatgtggtacatttacacaatggagta ctactcagcaattaaaaacaataaatttatgaaattcttaggcaaatgga tgggtctggattgtatcatcctgagtgagataacccaatcacaaaagaat acacatgaaatgcattcactgataagtgagtattaggccagacatttaga ataaccaagatacaatttgcaaaacacatgaaactcaagaagaaggaaga ccaaagtgtgtataattcgttccttcttagaatggggaacaaaataccca tggaaagagttacaaagttcggaactgagactgaaggaaggaccatccag agattgccccactcggggacccatcccataaacaatcaccaaacctagac actattgcatatgccagcaagattttgctgacaggaccctgatacagctg tctcctgtgaggctatgccagaggctggcaaatacagaagtggatgctca cagtcatctattggatggaacataggatctcaatgaggagctagagaagt acccaggagctaagggtctgcaccctataggtgaacacaatatgactggt gtttctagctgcatatttagcagaggatgggcctagtcgagaagttcctg atcttggaagatctatgcccagatacaggtgattgccaggacaggaaggt gagtgtgggtggttgtaaaat
quality values	Open. Hide. 47 28 21 27 53 32 14 53 61 61 35 61 35 47 61 61 50 61 55 61 37 50 35 47 55 43 35 31 34 37 24 33 50 34 41 49 61 61 52 55 61 61 55 61 59 59 61 61 61 59 59 59 61 59 59 59 59 59 59 59 52 59 59 59 59 59 59 59 59 52 59 59 59 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 59 61 61 61 59 59 59 59 61 61 61 59 61 61 61 59 61 61 55 55 59 59 61 61 59 61 55 55 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 61 59 59 59 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 59 52 45 59 59 59 52 45 59 59 59 61 59 61 59 61 61 59 59 59 59 59 59 43 29 61 52 61 59 52 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 59 59 59 61 59 59 59 61 59 59 59 61 59 61 61 59 59 59 59 59 59 59 61 61 61 59 59 59 59 55 61 55 61 61 61 61 61 55 55 52 52 55 55 52 52 61 61 61 61 61 61 41 52 55 50 55 55 55 55 61 55 55 55 55 52 52 61 61 61 61 52 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 55 61 61 61 61 61 47 61 61 55 61 61 61 61 50 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 50 55 55 55 55 61 61 61 61 61 61 53 61 50 53 61 47 47 47 37 50 53 53 61 53 61 61 61 61 61 61 61 53 61 61 61 50 37 61 61 61 61 61 61 61 61 61 61 53 53 47 61 61 61 61 61 61 61 53 61 53 50 61 61 61 53 50 45 61 61 61 61 43 52 61 61 61 61 61 61 61 34 47 61 61 61 61 61 61 61 61 61 61 61 61 47 24 37 47 53 47 53 53 57 47 57 50 57 57 57 57 47 57 57 57 57 57 53 57 57 57 40 52 50 52 57 57 57 57 57 57 57 57 57 57 57 57 50 57 36 47 53 57 57 57 57 57 57 57 57 57 57 47 52 47 52 52 37 53 50 53 53 57 57 50 53 53 47 53 53 57 57 57 57 47 57 47 50 47 23 43 26 16 23 42 52 37 38 50 53 50 27 41 27 53 45 47 43 53 53 53 46 45 53 53 52 30 50 52 50 53 43 37 41 41 45 38 50 52 33 53 53 53 39 35 38 52 27 57 30 53 37 37 57 30 57 53 52 50 40 52 24 53 37 47 37 53 53 50 30 36 53 35 52 52 53 28 53 37 57 57 53 28 37 44 57 57 57 57 57 57 57 36 42 57 57 42 33 57 37 36 38 37 52 32 53 23 41 29 33 57 44 40 41 57 57 57 38 44 40 35 40 30 46 37 37 53 37 25 47 28 53 43 14 41 22 33 53 45 28 41 48 30 30 30 37 30 30 51 46 48 36 25 10 26 23 31 13 46 44 43 30 18 27 32 27 31 27 34 39 29 28 34 31 30 30 44 30 17 29 47 32 29 30 29 28 51 48 23 36 21 51 46 34 35 39 31 28 30 17 26 17 39 36 29 43 39 37 29 29 51 41 28 32 31 29 35 51 32 29 29 34 18 22 29 22 27 22 35 23 17 43 51 29 32 29 18 30 29 29 24 23 14 15 25 26 24 28 51 33 26 26 31 20 38 23 27 34 30 16 28 33 51 33 20 28 21 29 6 41 19 30 22 27 28 18 20 27 25 23 28 29 27 29 31 23 14 23 12 33 27 34 33 29 28 51 29 8 13 20 44 28 34 25 25 24 34 31 27 14 21 23 14 29 12 26 30 36 36 15 21 41 23 31 24 51 24 29 29 51 29 23 19 23 26 27 29 28 25 20 27 14 12 33 31 31 19 25 20 23 17 26 26 27 28 51 29 33 27 28 19 28 22 29 34 31 15 30 51 51 28 17 22 22 17 28 51 33 19 17 27 28 25 22 13 23 30 16 25 14 13 25 4 12 18 17 27 18 26 26 31 19 23 27 28 14 21 31 22 6 24 11 6 6 4 9 16 44 16 14 44 39 29 18 16 13 16 28 25 4 9 9 36 14 23 25 20 19 9 15 6 17 37 26 4 8 25 14 9 13 5 8 17 29 23 10 14 13 22 12 17 14 9 25 5 21 17 14 12 31 20 26 5 12 21 29 31 13 11 11 7 6 10 14 8 17 20 23 24 11 25 12 24 5 6 5 5 9 12 6 6 9 14 8 5 23 31 10 13 6 10 14 23 7 5 3 4 6 2 7 9 16 4 6 4 4 22 11 16 15 10 9 15 11 8 6 1 3 3 1 3 4 15 6 7 5	Open. Hide. 50 47 35 38 55 61 43 39 14 32 26 20 14 22 15 50 47 37 55 52 55 55 52 55 55 55 61 61 52 61 61 61 43 61 55 52 55 52 55 55 59 61 59 59 59 59 59 59 59 59 59 52 59 37 49 52 52 61 59 61 59 59 59 59 61 61 59 59 59 59 52 59 59 59 59 59 59 61 61 59 61 61 61 59 59 59 59 59 59 59 59 59 59 59 59 59 37 41 59 59 59 61 61 59 61 61 61 61 59 59 59 59 59 59 52 59 59 59 52 61 59 59 61 59 59 59 59 59 43 61 59 59 59 59 59 59 59 59 61 59 61 59 59 59 59 59 49 61 59 59 59 59 61 61 59 52 61 59 59 37 59 61 61 61 55 61 59 61 61 61 59 55 59 61 61 59 59 59 59 59 61 61 59 59 59 49 55 55 61 52 55 55 61 55 61 61 61 61 61 61 61 55 55 55 55 61 61 61 61 55 61 61 55 55 55 55 52 61 61 61 61 55 55 55 55 55 55 55 49 52 55 61 61 61 55 52 52 61 55 55 61 61 61 61 55 43 61 55 55 55 55 55 61 55 61 55 55 61 55 49 61 61 55 61 61 61 61 55 55 61 55 55 61 61 55 61 43 49 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 50 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 53 61 50 61 61 61 50 61 53 52 52 53 61 61 61 61 53 61 53 61 53 61 61 53 50 61 61 61 61 53 61 61 61 50 52 50 50 50 47 50 53 50 50 50 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 53 53 61 61 50 61 39 46 61 33 39 61 61 61 52 52 57 47 47 57 53 53 46 52 57 57 57 57 53 53 57 50 57 57 57 47 57 50 53 39 53 53 57 47 57 52 53 45 47 53 53 53 53 53 47 37 46 47 47 53 53 43 53 53 53 47 53 43 47 52 53 53 53 53 57 53 53 53 53 47 47 45 41 57 57 51 43 47 30 43 53 41 41 53 53 52 52 53 47 57 47 57 53 57 57 57 57 38 32 53 57 50 42 41 53 53 53 57 57 46 52 52 45 45 57 52 32 52 38 36 53 53 57 52 50 46 57 47 57 57 50 47 32 35 30 47 30 38 53 57 50 57 52 53 52 41 38 39 33 57 47 30 46 46 53 50 57 53 47 34 50 34 46 38 40 39 57 38 50 40 38 30 50 17 21 17 52 29 38 52 33 36 52 53 52 37 28 53 37 40 27 24 37 52 24 46 37 37 35 37 52 27 22 52 37 33 37 47 34 53 53 52 40 35 47 31 38 41 44 45 53 41 44 39 27 39 37 53 53 33 41 15 8 53 33 37 23 26 13 43 24 57 44 35 31 53 28 40 33 36 47 34 37 25 43 33 14 25 45 39 32 18 18 40 22 21 28 25 43 44 32 44 51 51 30 26 37 30 24 39 41 32 34 27 29 51 48 31 30 47 12 10 51 9 10 30 27 37 30 21 30 35 51 33 28 31 34 31 16 31 26 26 29 29 29 47 17 29 23 29 34 29 18 10 48 24 33 24 29 29 22 33 20 35 29 46 32 17 46 19 14 13 38 36 29 46 41 30 15 28 43 38 28 46 39 31 27 18 51 33 22 38 35 51 29 18 29 26 41 31 28 14 24 28 29 18 24 33 16 51 30 30 26 28 20 16 23 15 15 28 15 13 28 28 38 26 29 33 23 28 31 30 13 22 18 36 23 23 23 29 22 51 46 29 28 29 27 16 29 19 19 25 15 28 15 51 33 24 28 31 25 26 11 51 16 28 30 30 29 31 20 19 38 23 22 13 18 29 24 22 16 29 19 28 29 16 24 16 6 25 5 28 26 20 13 31 12 27 34 11 15 20 28 14 14 38 20 14 19 13 30 19 14 34 31 27 33 15 19 13 20 15 28 13 10 14 8 17 14 25 27 28 31 16 15 22 19 8 13 6 18 9 13 17 16 9 24 4 11 13 15 19 20 12 5 4 9 8 19 28 12 6 16 15 26 20 6 23 23 22 33 26 8 7 13 28 9 12 14 13 15 17 36 30 8 17 21 16 14 30 10 37 18 23 5 16 8 22 7 6 27 14 13 5 23 7 8 29 20 11 10 6 26 14 25 4 12 8 12 8 37 24 7 5 11 14 21 24 13 7 5 9 8 4 4 4 6 10 13 5 6 25 5 9 10 5 8 29 10 14 8 11 24 9 14 20 5 3 3 4 7 5 5 5 16 11 3 3 1 2 8 11 23 7 4 4 4 4 9 11 11 13 10 16 10 16 25 20 4 3 4 8 5 5 4 4 5 6 10 8 6 4 6 7 12 13 8 13 1 3 3 3 3 17 5 1 2 4 9 20 5 5 7 6 9 19 4 9 13 10 12 5 5 9 8 4 13 12 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_108452355_108453443
seq2: B6Ng01-014J19.b_46_1119

seq1  GAATTCACTTATATGAGAGAACAAGCCAAAGCTTATGGCCTGGGCATTTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTATATGAGAGAACAAGCCAAAGCTTATGGCCTGGGCATTTA  50

seq1  TTGATAATTAGTTTCAGTCATTATTCCGGGAGCGGGGGCTGGGAAGGAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATAATTAGTTTCAGTCATTATTCCGGGAGCGGGGGCTGGGAAGGAAA  100

seq1  AGCTTGGGATTTATTTTTTACAGATTTGTCTGGGTAACCCTGACTGACCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTGGGATTTATTTTTTACAGATTTGTCTGGGTAACCCTGACTGACCT  150

seq1  GGGAACTCTGTAGATCAGTCTGGACTTTAACTCAGAGACATCTGCCTGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAACTCTGTAGATCAGTCTGGACTTTAACTCAGAGACATCTGCCTGTC  200

seq1  TCTGTCTCCCATCTAAAGGCAGGCAACACCACTGCCCTTTGAAAATCTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCTCCCATCTAAAGGCAGGCAACACCACTGCCCTTTGAAAATCTTT  250

seq1  TCTTAAACAGATTTCCAGAGCTAGAAAACAACTACAGGTTTTGGGAGTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAACAGATTTCCAGAGCTAGAAAACAACTACAGGTTTTGGGAGTTG  300

seq1  CATTTGATTCACTTAGATCCTTCTCAAGACTTCTGCCTCTCCCCACTCGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGATTCACTTAGATCCTTCTCAAGACTTCTGCCTCTCCCCACTCGC  350

seq1  AAGTCTCTTACACTAAGGGCACGGCCAATCACTCAGGCTGTTCTGGTAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTCTTACACTAAGGGCACGGCCAATCACTCAGGCTGTTCTGGTAGA  400

seq1  TACCTCACAGATGTAGATGTAGTCCCAGGACCCCTTTCTCTTCAGGGAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTCACAGATGTAGATGTAGTCCCAGGACCCCTTTCTCTTCAGGGAAA  450

seq1  GACTACCTTTTCTTCTGGAGTATGTTTTTCCTGCTACAAACTCTGCTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTACCTTTTCTTCTGGAGTATGTTTTTCCTGCTACAAACTCTGCTCTT  500

seq1  TGGTTACACTTCATGACTGCTGGAACCATGAGCCAAGCAGGCCAATCTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTACACTTCATGACTGCTGGAACCATGAGCCAAGCAGGCCAATCTGA  550

seq1  CCCCAGCACAGGACAGACCTGTTAAGGCAAGGTCTAACCACAAGCTCAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGCACAGGACAGACCTGTTAAGGCAAGGTCTAACCACAAGCTCAGC  600

seq1  ATTTATCCCCAGTTTTTTTTTCCCCTTTGGAATGTAGAAAGAAAAACTAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATCCCCAGTTTTTTTTTCCCCTTTGGAATGTAGAAAGAAAAACTAT  650

seq1  TCCTCTAAGAAGGCAAAGCTGCAAGCCCCAAGGCAGGGGAGTGCTAATAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTAAGAAGGCAAAGCTGCAAGCCCCAAGGCAGGGGAGTGCTAATAG  700

seq1  CGTTCTTGGCAATCCCGATTTGCAGTGAAGCTACCTGAAAGAATAAACTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTCTTGGCAATCCCGATTTGCAGTGAAGCTACCTGAAAGAATAAACTG  750

seq1  AATAAGCAGAAAGATTCTAAGGATAGGGAGGCTAACTAGCCCTCTT-GGT  799
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  AATAAGCAGAAAGATTCTAAGGATAGGGAGGCTAACTAGCCCTCTTGGGT  800

seq1  TCCAGATCTCTTCAGATTCCTATTTAACCCTACTGCAATTCCAAGAAACT  849
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  TCCAGATCTCTTCAGATTCCTATTTAACCCTACTGCAATTCCAAG-AACT  849

seq1  GCTAAATCCCTACCTCTGCCTAATCTAATTGCATTTCTGTCCTGAGAAAA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAAATCCCTACCTCTGCCTAATCTAATTGCATTTCTGTCCTGAGAAAA  899

seq1  GTGTCCCAGTGCAATGTCTTCCTCTACATTGACTCAAGTTCTAAAATTAA  949
      |||||||||||||||||||| |||||||||||||||||||||||   | |
seq2  GTGTCCCAGTGCAATGTCTT-CTCTACATTGACTCAAGTTCTAA---TTA  945

seq1  AACCCCATCTCCCTTCCCTCGCTAAATAAAATTCCTCTCTAAAGTCCTAG  999
      |||||||||| |||||||||||||    |||||||||||| |||||||||
seq2  AACCCCATCT-CCTTCCCTCGCTA---TAAATTCCTCTCT-AAGTCCTAG  990

seq1  GAGAAACTAATCCAACTAACTGCTTGGACTAGTTCCCTCTGAGATACA-G  1048
      ||| |||||   ||||| |||||||||||||||  |||||| |||||| |
seq2  GAG-AACTA--TCAACT-ACTGCTTGGACTAGT--CCTCTG-GATACAGG  1033

seq1  TTTCTCTTTGCAGATAATGGAAGGTAAGCACTTG-----CAGAGAC  1089
      |||||| |||||||||   ||||   ||||||||      ||||||
seq2  TTTCTC-TTGCAGATA--TGAAG--TAGCACTTGGCGACGAGAGAC  1074

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information