MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-035D15
Chromosome	5 (Build37)
Map Location	33,540,130 - 33,541,025
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Plb1, EG665350, LOC545743, Ppp1cb, LOC634553, LOC675983, Yes1, LOC100039775, Pisd, C330019G07Rik, LOC100040141, Depdc5, Ywhah, LOC100040169, Slc5a1
Downstream gene	Spon2, Ctbp1, Maea, 4933407H18Rik, LOC672284, 2410018C17Rik, Slbp, Tmem129, Tacc3, Fgfr3, Letm1, LOC100040332, Whsc1, Whsc2, Gm1673, LOC100040427, Nat8l, Poln, BC023882, Mxd4, Zfyve28
Link	Open Mouse BAC browser

Click to get alignment info.

name	Plb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665270 MGI:1922406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665350 MGI:3644314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC545743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 73 ESTs, 14 Proteins pseudo : _no_value

name	Ppp1cb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19046 MGI:104871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC675983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Yes1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22612 MGI:99147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Pisd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320951 MGI:2445114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330019G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215476 MGI:2443658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Depdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277854 MGI:2141101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ywhah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22629 MGI:109194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040169 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 677 ESTs, 5 Proteins

name	Slc5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20537 MGI:107678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spon2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100689 MGI:1923724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maea (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672284 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 Proteins

name	2410018C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74504 MGI:1919225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20492 MGI:108402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68366 MGI:1915616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tacc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21335 MGI:1341163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgfr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14184 MGI:95524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Letm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56384 MGI:1932557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 403 ESTs, 4 Proteins

name	Whsc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107823 MGI:1276574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Whsc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24116 MGI:1346098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1673 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381633 MGI:2686519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Nat8l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269642 MGI:2447776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Poln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272158 MGI:2675617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC023882 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231123 MGI:2387633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17122 MGI:104991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231125 MGI:2684992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487226 GeneID:665270 MGI:1922406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase B1 transcript_id : NM_001081407.1

name	EG665350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374663 GeneID:665350 MGI:3644314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG665350 transcript_id : XM_976298.1

name	Ppp1cb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385377 GeneID:19046 MGI:104871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, catalytic subunit, beta isoform transcript_id : NM_172707.2

name	Yes1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130336 GeneID:22612 MGI:99147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 transcript_id : NM_009535.2

name	Pisd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722756 GeneID:320951 MGI:2445114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylserine decarboxylase transcript_id : NM_177298.3

name	C330019G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996496 GeneID:215476 MGI:2443658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330019G07 gene transcript_id : NM_194340.1

name	Depdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909319 GeneID:277854 MGI:2141101
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEP domain containing 5 transcript_id : NM_001025426.1

name	Depdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803514 GeneID:277854 MGI:2141101
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEP domain containing 5 transcript_id : NM_177786.3

name	Ywhah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756036 GeneID:22629 MGI:109194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide transcript_id : NM_011738.1

name	LOC100040169 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253848 GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 319 ESTs, 5 Proteins product : similar to ribosomal protein L35a, transcript variant 2 transcript_id : XM_001474659.1

name	LOC100040169 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253846 GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 675 ESTs, 5 Proteins product : similar to ribosomal protein L35a, transcript variant 1 transcript_id : XM_001474643.1

name	Slc5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802859 GeneID:20537 MGI:107678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 1 transcript_id : NM_019810.3

name	Spon2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981610 GeneID:100689 MGI:1923724
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spondin 2, extracellular matrix protein transcript_id : NM_133903.2

name	Ctbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129918 GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-terminal binding protein 1 transcript_id : NM_013502.2

name	Maea (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407042 GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage erythroblast attacher transcript_id : NM_021500.2

name	4933407H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487375 GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933407H18 gene transcript_id : NM_001081101.1

name	LOC672284 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253842 GeneID:672284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 99 Proteins product : similar to homeodomain protein Sax2 transcript_id : XM_001473635.1

name	2410018C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341609 GeneID:74504 MGI:1919225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018C17 gene transcript_id : NM_178390.2

name	Slbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677986 GeneID:20492 MGI:108402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stem-loop binding protein transcript_id : NM_009193.1

name	Tmem129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73853455 GeneID:68366 MGI:1915616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 129 transcript_id : NM_026698.2

name	Tacc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430562 GeneID:21335 MGI:1341163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 3 transcript_id : NM_001040435.2

name	Fgfr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91932800 GeneID:14184 MGI:95524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 3 transcript_id : NM_008010.3

name	Letm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789996 GeneID:56384 MGI:1932557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine zipper-EF-hand containing transmembrane protein 1 transcript_id : NM_019694.1

name	LOC100040332 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253850 GeneID:100040332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 403 ESTs, 4 Proteins product : similar to 40S ribosomal protein S29 transcript_id : XM_001475194.1

name	Whsc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487396 GeneID:107823 MGI:1276574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1 (human) transcript_id : NM_001081102.1

name	Whsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130005 GeneID:24116 MGI:1346098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 2 (human) transcript_id : NM_011914.2

name	Gm1673 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801766 GeneID:381633 MGI:2686519
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1673, (NCBI) transcript_id : NM_001033458.2

name	LOC100040427 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253852 GeneID:100040427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100040427 transcript_id : XM_001475320.1

name	Nat8l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288911 GeneID:269642 MGI:2447776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 8-like transcript_id : NM_001001985.3

name	Poln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158584 GeneID:272158 MGI:2675617
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA polymerase N transcript_id : NM_181857.2

name	BC023882 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122692 GeneID:231123 MGI:2387633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023882 transcript_id : NM_146159.1

name	Mxd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560565 GeneID:17122 MGI:104991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Max dimerization protein 4 transcript_id : NM_010753.2

name	Zfyve28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62632712 GeneID:231125 MGI:2684992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 28 transcript_id : NM_001015039.1

name	Plb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487227 GeneID:665270 MGI:1922406
definition	codon_start : 1 product : phospholipase B1 protein_id : NP_001074876.1

name	EG665350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374664 GeneID:665350 MGI:3644314
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981392.1

name	Ppp1cb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28173568 CCDS:CCDS19193.1 GeneID:19046 MGI:104871
definition	EC_number : 3.1.3.16 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0000163 - protein phosphatase type 1 activity [Evidence IDA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : protein phosphatase 1, catalytic subunit, beta isoform protein_id : NP_766295.1

name	Yes1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678617 GeneID:22612 MGI:99147
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : viral oncogene yes homolog protein_id : NP_033561.1

name	Pisd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722757 CCDS:CCDS19194.1 GeneID:320951 MGI:2445114
definition	codon_start : 1 product : phosphatidylserine decarboxylase protein_id : NP_796272.2

name	C330019G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996497 CCDS:CCDS19195.1 GeneID:215476 MGI:2443658
definition	codon_start : 1 product : hypothetical protein LOC215476 protein_id : NP_919321.1

name	Depdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909320 CCDS:CCDS19196.1 GeneID:277854 MGI:2141101
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DEP domain containing 5 isoform 1 protein_id : NP_001020597.1

name	Depdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244316 CCDS:CCDS19197.1 GeneID:277854 MGI:2141101
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DEP domain containing 5 isoform 2 protein_id : NP_808454.1

name	Ywhah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756037 CCDS:CCDS19198.1 GeneID:22629 MGI:109194
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0035259 - glucocorticoid receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0006713 - glucocorticoid catabolism [Evidence ISS]; GO:0042921 - glucocorticoid receptor signaling pathway [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0050774 - negative regulation of dendrite morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS] codon_start : 1 note : 14-3-3 eta product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide protein_id : NP_035868.1

name	LOC100040169 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253847 GeneID:100040169
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474693.1

name	LOC100040169 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253849 GeneID:100040169
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474709.1

name	Slc5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543739 CCDS:CCDS19199.1 GeneID:20537 MGI:107678
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005903 - brush border [Evidence IDA] GO_function : GO:0005355 - glucose transporter activity [Evidence IMP]; GO:0005412 - glucose:sodium symporter activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence ISS] [Evidence IMP]; GO:0050892 - intestinal absorption [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0001656 - metanephros development [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sodium-glucose cotransporter 1; sodium glucose cotransporter 1; solute carrier family 5, member alpha 1; solute carrier family 5, member 1 product : solute carrier family 5 (sodium/glucose cotransporter), member 1 protein_id : NP_062784.2

name	Spon2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981611 CCDS:CCDS19200.1 GeneID:100689 MGI:1923724
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : spondin 2, extracellular matrix protein protein_id : NP_598664.2

name	Ctbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304989 CCDS:CCDS19201.1 GeneID:13016 MGI:1201685
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : C-terminal binding protein 1 protein_id : NP_038530.1

name	Maea (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407043 GeneID:59003 MGI:1891748
definition	codon_start : 1 product : erythroblast macrophage protein protein_id : NP_067475.2

name	4933407H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487376 GeneID:71101 MGI:1918351
definition	codon_start : 1 product : hypothetical protein LOC71101 protein_id : NP_001074570.1

name	LOC672284 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253843 GeneID:672284
definition	codon_start : 1 product : similar to homeodomain protein Sax2 protein_id : XP_001473685.1

name	2410018C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409990 CCDS:CCDS19203.1 GeneID:74504 MGI:1919225
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dorsal neural-tube nuclear protein protein_id : NP_848477.1

name	Slbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677987 CCDS:CCDS19205.1 GeneID:20492 MGI:108402
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006398 - histone mRNA 3'-end processing [Evidence IDA]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 function : RNA binding protein function : involved in histone mRNA metabolism product : stem-loop binding protein protein_id : NP_033219.1

name	Tmem129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73853456 CCDS:CCDS19206.1 GeneID:68366 MGI:1915616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68366 protein_id : NP_080974.2

name	Tacc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94681040 GeneID:21335 MGI:1341163
definition	GO_component : GO:0005813 - centrosome [Evidence IDA] [Evidence TAS]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0042994 - cytoplasmic sequestering of transcription factor [Evidence IDA]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IGI]; GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : Arnt interacting protein product : transforming, acidic coiled-coil containing protein 3 protein_id : NP_001035525.1

name	Fgfr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877057 GeneID:14184 MGI:95524
definition	GO_component : GO:0009898 - internal side of plasma membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IDA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0043065 - positive regulation of apoptosis [Evidence IMP]; GO:0045597 - positive regulation of cell differentiation [Evidence IMP]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : fibroblast growth factor receptor 3 protein_id : NP_032036.2

name	Letm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789997 CCDS:CCDS19207.1 GeneID:56384 MGI:1932557
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : leucine zipper-EF-hand containing transmembrane protein 1 product : leucine zipper-EF-hand containing transmembrane protein 1 protein_id : NP_062668.1

name	LOC100040332 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253851 GeneID:100040332
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_001475244.1

name	Whsc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487397 GeneID:107823 MGI:1276574
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : IL5 promoter REII region-binding protein; trithorax/ash1-related protein 5; Wolf-Hirschhorn syndrome candidate 1-like product : Wolf-Hirschhorn syndrome candidate 1 protein_id : NP_001074571.1

name	Whsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859652 CCDS:CCDS19208.1 GeneID:24116 MGI:1346098
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Wolf-Hirschhorn syndrome candidate 2 homolog protein_id : NP_036044.1

name	Gm1673 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701981 CCDS:CCDS19209.1 GeneID:381633 MGI:2686519
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381633 protein_id : NP_001028630.1

name	LOC100040427 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253853 GeneID:100040427
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475370.1

name	Nat8l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288912 CCDS:CCDS19210.1 GeneID:269642 MGI:2447776
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : N-acetyltransferase 8-like protein_id : NP_001001985.3

name	Poln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309579 GeneID:272158 MGI:2675617
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence ISS] [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006261 - DNA-dependent DNA replication [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : DNA polymerase N protein_id : NP_862905.1

name	BC023882 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122693 CCDS:CCDS19211.1 GeneID:231123 MGI:2387633
definition	codon_start : 1 product : hypothetical protein LOC231123 protein_id : NP_666271.1

name	Mxd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560566 CCDS:CCDS19212.1 GeneID:17122 MGI:104991
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Max dimerization protein 4 protein_id : NP_034883.2

name	Zfyve28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62632713 GeneID:231125 MGI:2684992
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005215 - transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 28 protein_id : NP_001015039.1

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 3 pseudo : _no_value

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 2 pseudo : _no_value

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 1 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 1 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 2 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 3 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 4 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 5 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 1 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 2 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 3 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 4 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 5 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 6 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 7 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 8 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 9 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 10 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 11 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 12 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 13 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 14 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 15 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 16 pseudo : _no_value

name	LOC100040141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040141
definition	number : 1 pseudo : _no_value

name	LOC545743 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253840 GeneID:545743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 73 ESTs, 14 Proteins product : similar to CLP36 pseudo : _no_value transcript_id : XR_031762.1

clone name	MSMg01-348I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440I05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-312C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-495L12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143H17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355K01
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-222B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086L13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-035D15.b	B6Ng01-035D15.g
ACC	DH863755	DH863756
length	885	890
definition	DH863755\|Mus musculus domesticus DNA, BAC clone: B6Ng01-035D15, 5' end.	DH863756\|Mus musculus domesticus DNA, BAC clone: B6Ng01-035D15, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccttaagtatggctgtgtagaattccgttgtctccagcggtgtga gtggagagtgtcgctgacagagcctccagctttcttctgtcagtccctgg aaagcacctctggactctgtttccccgtgtgtccttgacatgaataacag gaatgaagaactagtgaacatttgagttctcattgtgtgtcaagtactgt gctggattcttaaggacatggtctcagtcagctctccaagtgtgcctgag tgaaatatgttactattacgggatgtatatttttgcaggagtggaggaca agcaagtgtgtgatatgggcagtagtgagagcaccctaggaggagacaag agtcagagtgggacactcagacgtttttcacacagagatgaccttaagaa atggagggctgaagatagtatagatacttacgtatgacatatttacaata agacacaagtattataaacatttatgaggctgagagaaaagggcactgta gaggctgcgtttgaatactgactcactataccatgtgaccttgggtatgc ctctttttctttgctttagtttcatcacatacaaagtcttaaattgtccc tatgtgaataagttgataccatgaggattcatatatgtgtaaaaggctcc ctcacattgggttggcacataaaaagaccggatcttatgtttaaattttt aatgtgcctaaaattttatatattttatatgcagaggtaaaaaacttata atattgttacatatactatattgataattgtagaccatcttttttcaatc acacatttcggaataagtccctggggaaagattattatatttaggaaaca tgcaaagccttgggcagtgatgctaagatactgaa	gaattcaaaaggggcaggaacctggatttgggagctggtgcagaggccat ggaaggtgctactggtttactactcatagctttttccagcctatcccacc agcccagggagagcaccactcatgatggtctgggtcctccttcattacac tataagaaaattccctgacaacaggttgtccaagaggagtcctggtgagg atccagtattgatggtgtggcagaagccaggggtctcagaccagaccaat gactcactgcaatcaatatttgcaagtaaagatgtgtagaccaatgagta tactgtgtaacacatcataaaacaccatagattccacagtgaggttttgg ttttttgtttctaacttttatttttttgttttctttttttttttttcttt tcttttgtgaggaaggttgcaagggtagagggttgatatgaaggtcctgg gagatgaatggggttccagtgcatgatgtgaaattcacaagaatcaatac attttattttaattaaaaaaaggaaagccgggcagtggtggtgcacccct ttaatgccagcacttgggaaggcgaggcaggcggatttctgagttcgagg ccgcctggtctcagatgaactccagactgcctttcaagacaggaaccttg tctcgaaaaccaaacaaaaccaaaacaacaaccaaaaagaatggccctgg gactggaagatacttattggtaaaaccccggctgctctttaaaggcccag ttcagttcatgcctctggcacttccaatatctaagtcagttccaggatga aaccctcacacgaacccatacagcaacaccatgcctaataaagaatcttt taaattgtatatatgtatggggtattatgtatatgaaatc
quality values	Open. Hide. 61 47 33 38 61 61 61 61 61 61 61 61 61 50 49 61 47 61 61 47 49 61 61 61 61 38 31 38 36 36 28 15 28 28 32 55 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 59 59 61 49 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 52 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 57 53 57 50 53 47 53 53 52 43 57 47 39 57 57 45 51 53 53 53 57 57 47 57 57 53 53 57 53 57 57 57 57 57 53 50 47 53 53 45 36 53 53 50 53 57 57 57 52 50 45 53 52 53 45 45 52 38 37 47 53 52 47 47 47 52 53 57 50 57 57 45 47 43 41 46 31 41 41 35 53 53 57 35 43 41 30 52 53 53 42 52 52 52 31 39 40 53 53 53 40 52 42 52 42 50 53 53 50 38 52 44 53 46 57 30 41 22 37 52 44 52 40 40 40 38 57 33 52 53 40 35 43 53 40 53 37 52 53 53 29 53 57 48 41 40 32 53 18 30 28 53 37 34 10 57 37 48 57 57 47 27 57 53 31 41 48 47 53 31 47 24 34 25 38 32 43 44 31 29 47 46 31 41 48 33 30 36 48 30 46 30 30 33 29 29 33 37 29 36 29 33 29 24 29 46 29 41 39 31 48 29 37 29 51 46 27 37 28 30 25 43 29 29 30 51 51 43 34 33 24 46 30 27 29 28 51 30 29 24 36 51 31 31 19 31 29 28 29 15 29 28 33 26 46 25 12 14 19 17 29 29 51 15 27 25 29 20 28 39 30 28 28 28 29 28 30 33 15 27 31 9 8 5 29 28 29 17 18 29 39 18 28 34 29 27 21 28 21 25 33 19 28 22 28 19 28 34 23 20 17 26 51 51 18 25 23 6 9 10 38 23 21 17 9 19 12 43 21 28 51 31 17 17 22 21 14 10 25 17 22 25 38 51 36 28 13 28 14 32 15 30 18 19 12 5 30 18 22 10 16 51 30 18 51 16 14 34 51 39 33 7 18 12 32 9 27 27 31 18 27 39 39 20 20 39 39 25 16 8 9 11 12 12 35 44 14 14 6 22 10 23 13 11 9 35 7 8 9 26 44 35 34 34 16 4 7 15 14 11 14 23 10 17 27 20 20 8 17 12 28 9 15 7 7 9 34 11 16 9 12 17 28 7 10 10 29 31 8 7 13 6 31 7 29 12 15 6 8 4 5 17 19 6 4 6 12 19 12 12 18 9 14 6 4 3 9 22 17 10 5 6 11 13 29 10 15 6 6 26 24 20 15 29 37 33 14 8 28 11 5 14 22 23 13 29 7 6 7 5 3 4 4 4 2 5 9 14 24 8 7 12 23 15 5 4 2 3 4 10 5 5 25 30 18 12 9 11 6 16 12 10 20 14 7 1 2 3 4 10 5 7 7 9 24 8	Open. Hide. 61 61 43 47 61 47 16 18 24 21 19 28 28 28 28 31 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 59 59 61 59 61 59 59 59 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 52 61 52 61 61 59 61 61 61 61 61 61 61 61 61 55 61 49 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 52 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 50 61 52 53 50 53 53 61 61 61 61 61 61 61 53 53 52 61 61 61 61 61 61 61 50 50 50 47 47 50 53 61 53 61 52 53 50 47 35 50 50 46 53 61 53 61 61 45 61 61 61 61 61 50 61 61 61 61 61 47 53 61 61 53 39 47 47 57 53 47 47 35 47 50 57 57 57 57 57 47 57 50 53 53 53 57 53 57 47 57 57 57 47 47 47 53 53 53 47 52 52 47 42 33 50 50 53 53 50 47 27 32 42 26 33 26 47 23 47 19 47 45 42 34 25 37 33 33 39 35 15 50 12 17 17 9 11 16 27 20 19 32 24 52 40 32 47 25 21 21 23 50 38 23 26 11 47 24 28 52 52 31 52 57 38 38 27 23 38 50 23 36 30 37 28 23 38 32 37 24 42 31 37 30 57 19 10 9 8 10 11 14 27 20 40 33 30 18 10 13 25 27 28 10 23 32 33 37 15 18 27 23 11 11 21 23 12 7 17 23 18 37 33 15 15 23 28 47 37 12 25 22 8 33 14 18 10 7 9 14 33 11 32 30 12 14 12 8 9 9 27 11 29 30 28 9 24 20 19 22 30 10 12 11 7 14 21 29 18 11 16 9 13 18 17 8 5 10 5 17 9 10 19 18 12 27 10 17 20 33 16 15 25 12 29 5 21 25 20 5 15 16 10 10 7 7 9 16 7 15 10 15 14 10 10 9 5 10 5 8 5 10 9 7 10 13 9 12 8 8 7 10 23 7 9 36 29 14 29 14 7 16 7 21 28 24 29 20 28 15 8 20 11 13 9 9 10 12 29 32 23 15 6 6 14 17 17 17 6 12 11 12 13 15 22 20 20 8 19 13 14 30 10 7 10 7 13 31 31 26 10 10 36 12 12 6 9 16 26 15 15 13 15 6 16 14 7 13 10 11 16 6 19 9 9 11 9 6 9 10 6 5 6 9 8 12 10 11 12 10 14 4 7 6 5 5 6 8 8 10 10 11 8 4 4 4 7 7 10 16 8 7 7 4 12 8 8 5 4 12 5 9 6 8 4 8 4 5 7 4 5 4 6 5 5 8 6 7 11 9 11 4 4 5 10 9 11 10 10 9 7 3 5 10 9 6 4 8 10 6 6 5 7 10 10 10 14 14 7 7 6 10 4 2 4 4 4 7 7 4 8 10 7 3 7 6 7 4 9 4 4 8 6 5 4 9 5 4 4 5 3 1 4 3 4 4 13 6 8 5 2 16 4 4 4 17 5 13 8 5 3 8 6 4 5 9 9 10 6 9 9 5 10 4 4 2 5 4 3 4 7 9 6 8 6 9 3 3 4 3 3 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_33540130_33541025
seq2: B6Ng01-035D15.b_48_932

seq1  GAATTCCTTAAGTATGGCTGTGTAGAATTCCGTTGTCTCCAGCGGTGTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTAAGTATGGCTGTGTAGAATTCCGTTGTCTCCAGCGGTGTGA  50

seq1  GTGGAGAGTGTCGCTGACAGAGCCTCCAGCTTTCTTCTGTCAGTCCCTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAGAGTGTCGCTGACAGAGCCTCCAGCTTTCTTCTGTCAGTCCCTGG  100

seq1  AAAGCACCTCTGGACTCTGTTTCCCCGTGTGTCCTTGACATGAATAACAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCACCTCTGGACTCTGTTTCCCCGTGTGTCCTTGACATGAATAACAG  150

seq1  GAATGAAGAACTAGTGAACATTTGAGTTCTCATTGTGTGTCAAGTACTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGAAGAACTAGTGAACATTTGAGTTCTCATTGTGTGTCAAGTACTGT  200

seq1  GCTGGATTCTTAAGGACATGGTCTCAGTCAGCTCTCCAAGTGTGCCTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGATTCTTAAGGACATGGTCTCAGTCAGCTCTCCAAGTGTGCCTGAG  250

seq1  TGAAATATGTTACTATTACGGGATGTATATTTTTGCAGGAGTGGAGGACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAATATGTTACTATTACGGGATGTATATTTTTGCAGGAGTGGAGGACA  300

seq1  AGCAAGTGTGTGATATGGGCAGTAGTGAGAGCACCCTAGGAGGAGACAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAGTGTGTGATATGGGCAGTAGTGAGAGCACCCTAGGAGGAGACAAG  350

seq1  AGTCAGAGTGGGACACTCAGACGTTTTTCACACAGAGATGACCTTAAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAGAGTGGGACACTCAGACGTTTTTCACACAGAGATGACCTTAAGAA  400

seq1  ATGGAGGGCTGAAGATAGTATAGATACTTACGTATGACATATTTACAATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGGCTGAAGATAGTATAGATACTTACGTATGACATATTTACAATA  450

seq1  AGACACAAGTATTATAAACATTTATGAGGCTGAGAGAAAAGGGCACTGTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACACAAGTATTATAAACATTTATGAGGCTGAGAGAAAAGGGCACTGTA  500

seq1  GAGGCTGCGTTTGAATACTGACTCACTATACCATGTGACCTTGGGTATGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCTGCGTTTGAATACTGACTCACTATACCATGTGACCTTGGGTATGC  550

seq1  CTCTTTTTCTTTGCTTTAGTTTCATCACATACAAAGTCTTAAATTGTCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTTTCTTTGCTTTAGTTTCATCACATACAAAGTCTTAAATTGTCCC  600

seq1  TATGTGAATAAGGTTGATACCATGAGGATTCATATATGTGTAAAAGGCTC  650
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  TATGTGAATAA-GTTGATACCATGAGGATTCATATATGTGTAAAAGGCTC  649

seq1  CCTCACATTGGGTTGGCACATAAAAAAGACCGGATCTTATGTTTAAATTT  700
      ||||||||||||||||||||| ||||||||||||||||||||||||| ||
seq2  CCTCACATTGGGTTGGCACAT-AAAAAGACCGGATCTTATGTTTAAA-TT  697

seq1  TTTAATGTGCCTAAAATTTTAATATATTTATAATGCAGAAGTAAAAAAAC  750
      |||||||||||||||||||| ||||||||   ||||||| ||||||||  
seq2  TTTAATGTGCCTAAAATTTT-ATATATTTTATATGCAGAGGTAAAAAACT  746

seq1  TATAAATATTGTTACATATACTATATTTGATAAATGTAAGACCATC-TTT  799
      ||| ||||||||||||||||||||| ||||||| ||| |||||||| |||
seq2  TAT-AATATTGTTACATATACTATA-TTGATAATTGT-AGACCATCTTTT  793

seq1  CTCAATCACACATTTCGCGATTAGTCCCTGGGGAAAGATTATTATATTTA  849
       ||||||||||||||||  || ||||||||||||||||||||||||||||
seq2  TTCAATCACACATTTCGGAATAAGTCCCTGGGGAAAGATTATTATATTTA  843

seq1  GGAGAACATGCAAAGGGCCTGGGGCAGGTGATGCTCAGAGTACTGAA  896
      ||| ||||||||||  |||| ||||| |||||||| ||| |||||||
seq2  GGA-AACATGCAAA--GCCTTGGGCA-GTGATGCTAAGA-TACTGAA  885

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information