MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-155E23
Chromosome	5 (Build37)
Map Location	3,060,536 - 3,061,191
singlet/doublet	singlet
Overlap gene	LOC624254
Upstream gene	LOC171266, LOC100040892, LOC667565
Downstream gene	LOC100040940, LOC667585, LOC100034726, Cdk6, 5830415L20Rik, 1700109H08Rik, C030048B08Rik, Pex1, Gatad1, 4930511M11Rik, Ankib1, Krit1, 4932412H11Rik, LOC100041009, LOC667617, Mterf, Akap9
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC171266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:171266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040892 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC624254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040940 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC100034726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Cdk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12571 MGI:1277162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830415L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68152 MGI:1915402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700109H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77036 MGI:1924286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030048B08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269623 MGI:2442653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71382 MGI:1918632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gatad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67210 MGI:1914460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930511M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75010 MGI:1922305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankib1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70797 MGI:1918047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79264 MGI:1930618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932412H11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242838 MGI:3045299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins pseudo : _no_value

name	LOC667617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 552 ESTs, 9 Proteins pseudo : _no_value

name	Mterf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545725 MGI:1918240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Akap9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100986 MGI:2178217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC171266 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21717772 GeneID:171266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, G10-like transcript_id : NM_134232.1

name	Cdk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892426 GeneID:12571 MGI:1277162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 6 transcript_id : NM_009873.2

name	5830415L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948294 GeneID:68152 MGI:1915402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830415L20 gene transcript_id : NM_001042501.1

name	1700109H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803495 GeneID:77036 MGI:1924286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700109H08 gene transcript_id : NM_029843.2

name	C030048B08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348977 GeneID:269623 MGI:2442653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030048B08 gene transcript_id : NM_172991.3

name	Pex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657894 GeneID:71382 MGI:1918632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 1 transcript_id : NM_027777.1

name	Gatad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956153 GeneID:67210 MGI:1914460
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA zinc finger domain containing 1 transcript_id : NM_026033.1

name	4930511M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803362 GeneID:75010 MGI:1922305
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930511M11 gene transcript_id : NM_029141.2

name	Ankib1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656164 GeneID:70797 MGI:1918047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and IBR domain containing 1 transcript_id : NM_001003909.2

name	Krit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475699 GeneID:79264 MGI:1930618
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KRIT1, ankyrin repeat containing transcript_id : NM_030675.2

name	4932412H11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377246 GeneID:242838 MGI:3045299
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932412H11 gene transcript_id : NM_172879.2

name	Mterf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111161294 GeneID:545725 MGI:1918240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial transcription termination factor transcript_id : NM_172135.2

name	Mterf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111161446 GeneID:545725 MGI:1918240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial transcription termination factor transcript_id : NM_001013023.2

name	Akap9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125661047 GeneID:100986 MGI:2178217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein (yotiao) 9 transcript_id : NM_194462.2

name	LOC171266 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21717773 GeneID:171266
definition	codon_start : 1 exception : unclassified translation discrepancy product : vomeronasal 1 receptor, G10-like protein_id : NP_598993.1

name	Cdk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149637 CCDS:CCDS19062.1 GeneID:12571 MGI:1277162
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 6 protein_id : NP_034003.1

name	5830415L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948295 GeneID:68152 MGI:1915402
definition	codon_start : 1 product : hypothetical protein LOC68152 protein_id : NP_001035966.1

name	1700109H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249218 GeneID:77036 MGI:1924286
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77036 protein_id : NP_084119.1

name	C030048B08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559873 CCDS:CCDS19064.1 GeneID:269623 MGI:2442653
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC269623 protein_id : NP_766579.2

name	Pex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657895 CCDS:CCDS19065.1 GeneID:71382 MGI:1918632
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : peroxin1 protein_id : NP_082053.1

name	Gatad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956154 CCDS:CCDS19066.1 GeneID:67210 MGI:1914460
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ocular development associated product : GATA zinc finger domain containing 1 protein_id : NP_080309.1

name	4930511M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312892 CCDS:CCDS19067.1 GeneID:75010 MGI:1922305
definition	codon_start : 1 product : hypothetical protein LOC75010 protein_id : NP_083417.1

name	Ankib1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656165 GeneID:70797 MGI:1918047
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ankyrin repeat and IBR domain containing 1 protein_id : NP_001003909.2

name	Krit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994219 GeneID:79264 MGI:1930618
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS]; GO:0005083 - small GTPase regulator activity [Evidence TAS] codon_start : 1 exception : mismatches in translation note : cerebral cavernous malformations 1 product : KRIT1, ankyrin repeat containing protein_id : NP_109600.1

name	4932412H11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370338 CCDS:CCDS19068.1 GeneID:242838 MGI:3045299
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC242838 protein_id : NP_766467.1

name	Mterf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111161447 GeneID:545725 MGI:1918240
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006353 - transcription termination [Evidence IEA] codon_start : 1 note : mitochondrial transcription termination factor 1 product : mitochondrial transcription termination factor precursor protein_id : NP_001013041.2

name	Mterf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006865 GeneID:545725 MGI:1918240
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006353 - transcription termination [Evidence IEA] codon_start : 1 note : mitochondrial transcription termination factor 1 product : mitochondrial transcription termination factor precursor protein_id : NP_742147.1

name	Akap9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125661048 CCDS:CCDS19070.1 GeneID:100986 MGI:2178217
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0000242 - pericentriolar material [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : A kinase (PRKA) anchor protein (yotiao) 9 protein_id : NP_919444.2

name	LOC100040892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040892
definition	number : 1 pseudo : _no_value

name	LOC100040892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040892
definition	number : 2 pseudo : _no_value

name	LOC100040892 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040892
definition	number : 3 pseudo : _no_value

name	LOC667565 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667565
definition	number : 1 pseudo : _no_value

name	LOC624254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624254
definition	number : 1 pseudo : _no_value

name	LOC624254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624254
definition	number : 2 pseudo : _no_value

name	LOC624254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624254
definition	number : 3 pseudo : _no_value

name	LOC624254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624254
definition	number : 4 pseudo : _no_value

name	LOC624254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624254
definition	number : 5 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 1 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 2 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 3 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 4 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 5 pseudo : _no_value

name	LOC100040940 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040940
definition	number : 6 pseudo : _no_value

name	LOC100041009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041009
definition	number : 1 pseudo : _no_value

name	LOC667585 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253507 GeneID:667585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to Speer4e protein pseudo : _no_value transcript_id : XR_032296.1

name	LOC100034726 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:130501680 GeneID:100034726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L26 pseudogene pseudo : _no_value transcript_id : NR_003373.1

name	LOC667617 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253508 GeneID:667617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 552 ESTs, 9 Proteins product : similar to ribosomal protein S4, X-linked X pseudo : _no_value transcript_id : XR_032360.1

clone name	MSMg01-414J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-437A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372I16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-300I14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335H03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-423H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236O09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177H07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-477M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-332P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529H05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-393P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-155E23.b	B6Ng01-155E23.g
ACC	DH950130	DH950131
length	972	1,152
definition	DH950130\|Mus musculus domesticus DNA, BAC clone: B6Ng01-155E23, 5' end.	DH950131\|Mus musculus domesticus DNA, BAC clone: B6Ng01-155E23, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaattgttctgcaacatattagatgttacaggcagagcagagtca tataacgttatctgtatcctgtgtaggctcaccagctaatgtacaaggat tggacagtgttccagtaccacagtcacagaaaaacctatcaggtctaatg aattctacacatgatgtcattttttaacagccaagtaatactcaattgtg taaatgtaccacagtttctttattccttcttctgttaaaggacacatagg ctattttcagtttctggttaatataattagagcaaaaataacatagttga gcatgtccttatggtaaaattaagcatcctcagggtatagatccaagttg gatcttgaagtagattgattctcaacttcctgaggaaccaccatattgat tctaataatggaagtgcaagtttgcactcccaccagcaacggaggactgt tcttcctgttccataacctcacttctgttgttgatttctgataggtctgt ctttttaagttcctctgccatttcccttgcagttttgaatattctctttt agttttgtgtacttagtgttttgattgttatatgtcaaggagagtctctt ttctgttttaattaactggttttcagcctgattcttctacctttgcaagt attactttctctagaatgggaaatttttcttctctggtttactttaaaat atagctgaaatatccaacaaaggggagagagggcctgtagagaccatatc cagaggttaggttactcagaatgatagtttctagtttccttccaattgcc tgtaaatagtatgaagtcattgtttttaattgctgagtagtactctattg tattaatataccacattttctgtatccattcttcggttgggagtcatctg tgttgtttccagcttctggctattataaatatgtctgctataaacatagt ggagcatgtgtcctgttatgtt	gaattctcacctgaggaataccaaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccccctcacaccagtcagaatggctaagatcaaaaattcaggtgacagt agatgctggcatggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgcctcaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctatcaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa gaaactcacacaatatgtactcactgataagtggatattagccccaaacc taggatacccaagatataagatataatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtggacactatgcccctccttagatttgggaa caaaacacccatggaaggagttacagagacaaagtttggagctgagatga aaggatggaccatgtaaagactgccatatccagggatccaccccataatc agcatccaaacgctgacaccattgcatacactagcaagattttgatgaaa ggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaac acagaagtggatgctcacaatcagctaatggatggatcatagggctccca atgacgagctagagaagtagccaggagctaaagggatctgcaccctatag gtggaacaacatatgactaacagtatctcgagcctctgactctagctgca tattaatcaaagatggctagtcgccatcacttggaagagagtaatgattg cactttatatgcccagtacatgggacatctaagcctaaagggaatgtctt gc
quality values	Open. Hide. 61 47 24 35 53 35 31 55 61 61 47 61 61 61 47 35 61 55 61 55 61 61 61 61 61 49 18 52 30 30 30 43 36 41 38 38 61 61 59 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 55 61 61 61 61 61 59 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 59 59 61 61 61 59 61 61 61 61 61 61 61 55 44 44 55 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 44 55 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 55 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 59 59 61 59 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 55 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 55 55 55 55 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 50 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 55 61 61 61 61 61 55 55 50 55 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 47 52 61 61 61 53 50 61 53 61 61 61 61 53 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 47 61 61 61 46 61 61 61 61 61 53 61 61 61 61 61 53 57 57 53 57 53 57 57 57 57 57 53 57 57 53 53 53 53 57 57 57 57 52 53 53 47 47 53 37 57 52 57 53 57 50 57 57 57 53 42 57 57 30 57 57 43 47 53 47 53 43 57 47 57 57 57 52 57 57 53 50 42 45 46 28 47 53 52 36 52 45 53 52 50 52 45 24 26 44 52 53 53 47 50 52 53 52 52 47 39 52 47 47 47 57 45 53 42 53 53 53 52 47 37 46 41 57 50 57 53 31 57 57 57 53 50 50 57 45 53 50 53 53 52 33 57 46 37 35 37 57 40 29 57 57 53 39 33 33 53 50 53 53 38 52 57 37 40 50 50 37 34 17 40 30 24 47 53 33 34 33 57 52 20 52 37 40 31 38 41 15 23 38 53 35 52 36 46 30 33 16 19 24 40 37 47 36 52 25 37 33 12 53 33 43 27 12 33 25 37 29 29 44 34 27 20 57 27 32 48 37 27 41 37 39 57 37 40 34 37 35 37 57 32 25 48 30 23 15 41 30 30 30 43 31 24 26 30 47 22 12 46 38 31 26 36 39 39 37 29 32 48 37 29 30 24 27 29 48 21 46 46 46 18 8 39 30 29 29 27 29 29 48 19 29 46 31 28 29 28 29 29 29 46 36 29 33 15 46 27 43 27 24 30 29 29 29 29 29 29 27 35 38 51 51 43 35 28 39 20 28 29 27 33 24 30 31 33 25 29 35 22 51 20 23 46 46 20 30 20 34 34 29 29 28 28 41 25 36 25 31 36 23 38 21 25 29 20 30 33 35 28 23 20 27 32 23 28 25 18 32 28 23 21 51 31 26 16 14 23 24 28 34 30 27 27 10 8 9 35 18 7 10 31 28 17 13 27 23 23 12 32 20 22 26 19 28 26 23 14 30 9 13 9 28 19 30 15 44	Open. Hide. 61 49 52 49 61 61 61 49 28 52 49 43 43 43 37 61 59 59 49 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 59 59 59 55 59 59 61 61 61 59 55 61 61 61 61 61 61 61 61 61 44 35 44 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 55 59 61 61 61 55 44 55 59 59 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 61 61 61 61 52 61 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 55 44 59 59 59 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 55 59 59 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 55 55 61 61 55 61 61 61 55 55 55 55 55 55 55 61 61 61 61 61 61 61 61 55 61 55 61 52 55 61 61 55 61 61 61 55 61 61 55 52 52 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 55 61 61 55 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 50 61 61 61 61 61 61 61 55 61 55 55 55 55 55 50 61 55 61 55 55 55 55 55 55 53 53 61 53 50 61 61 61 61 61 61 61 61 61 61 53 61 50 52 61 61 61 61 61 61 61 61 52 50 53 50 50 53 53 53 52 61 50 53 50 53 61 61 61 61 45 50 52 50 53 50 50 50 50 52 45 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 52 45 42 47 47 42 47 47 43 53 53 61 57 47 53 52 47 47 47 27 47 53 52 57 47 40 57 53 50 53 53 50 42 52 50 47 47 47 53 53 53 57 53 39 47 45 52 47 53 50 52 53 53 47 53 45 53 50 47 47 53 46 47 42 47 53 50 53 53 52 53 39 53 57 53 57 53 53 53 53 53 52 45 53 53 52 41 53 53 47 57 53 57 53 41 45 42 52 47 52 45 52 53 47 52 45 43 50 47 47 50 50 30 41 47 37 50 43 43 47 27 43 47 52 36 50 53 50 57 50 46 27 53 52 52 47 41 53 53 52 47 52 36 43 43 47 45 50 42 52 57 13 14 41 37 53 42 43 46 50 46 38 23 57 50 38 53 37 50 37 46 19 53 53 57 37 37 57 57 50 52 53 31 25 36 53 39 47 52 53 33 25 25 35 38 24 34 34 36 36 36 37 31 25 25 40 57 45 44 52 37 25 45 44 39 37 36 35 25 37 35 36 52 52 48 40 13 57 35 24 26 37 29 44 33 36 53 29 31 32 35 44 40 30 41 57 43 48 27 40 23 31 47 36 43 15 29 22 30 45 46 32 19 21 28 25 31 32 22 10 26 24 35 43 39 39 51 31 30 30 31 32 39 24 31 24 36 29 30 18 38 22 30 51 46 28 27 19 33 28 29 29 27 23 23 37 27 29 29 28 31 37 29 24 29 23 29 28 29 36 41 31 29 29 29 29 19 16 29 26 14 21 37 29 29 24 26 25 35 25 29 29 29 19 31 21 33 28 35 31 51 46 30 17 20 15 28 41 51 30 28 23 27 22 30 29 18 14 26 15 29 28 31 31 31 31 29 17 22 33 25 15 26 31 14 20 28 18 35 23 30 28 28 36 25 27 24 41 46 30 13 17 25 35 19 29 29 43 27 20 14 25 24 23 39 31 20 23 32 21 29 14 22 21 29 27 27 28 12 13 28 31 27 27 28 30 20 22 27 30 28 20 22 28 21 12 30 26 25 27 13 16 42 16 15 35 13 38 22 4 12 19 14 5 4 5 11 10 26 34 14 15 8 7 28 29 6 13 13 12 16 8 8 5 4 15 7 18 27 6 44 14 8 36 12 4 13 15 9 20 10 21 8 18 14 29 13 16 9 25 7 9 21 20 22 9 9 23 7 9 12 31 11 29 16 31 9 28 16 6 14 9 25 11 11 19 10 5 5 23 7 4 7 4 4 5 27 14 14 7 9 8 6 11 11 23 24 20 24 9 10 14 5 2 3 6 7 16 12 31 18 8 26 9 19 11 8 6 16 6 6 6 16 6 4 6 19 9 11 19 7 6 9 4 4 2 1 6 5 5 4 1 1 4 17 9 3 3 13 5 5 15 6 10 23 18 4 4 6 20 5 3 3 13 4 7 11 7 5 4 3 23 13 6 13 4 3 3 9 4 2 3 4 3 7 4 18 30 19 18 7 5 11 8 4 5 1 1 1 1 4 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_3060536_3061191
seq2: B6Ng01-155E23.b_48_703

seq1  GAATTCAATTGTTCTGCAACATATTAGATGTTACAGGCAGAGCAGAGTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATTGTTCTGCAACATATTAGATGTTACAGGCAGAGCAGAGTCA  50

seq1  TATAACGTTATCTGTATCCTGTGTAGGCTCACCAGCTAATGTACAAGGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAACGTTATCTGTATCCTGTGTAGGCTCACCAGCTAATGTACAAGGAT  100

seq1  TGGACAGTGTTCCAGTACCACAGTCACAGAAAAACCTATCAGGTCTAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACAGTGTTCCAGTACCACAGTCACAGAAAAACCTATCAGGTCTAATG  150

seq1  AATTCTACACATGATGTCATTTTTTAACAGCCAAGTAATACTCAATTGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCTACACATGATGTCATTTTTTAACAGCCAAGTAATACTCAATTGTG  200

seq1  TAAATGTACCACAGTTTCTTTATTCCTTCTTCTGTTAAAGGACACATAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGTACCACAGTTTCTTTATTCCTTCTTCTGTTAAAGGACACATAGG  250

seq1  CTATTTTCAGTTTCTGGTTAATATAATTAGAGCAAAAATAACATAGTTGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTTCAGTTTCTGGTTAATATAATTAGAGCAAAAATAACATAGTTGA  300

seq1  GCATGTCCTTATGGTAAAATTAAGCATCCTCAGGGTATAGATCCAAGTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGTCCTTATGGTAAAATTAAGCATCCTCAGGGTATAGATCCAAGTTG  350

seq1  GATCTTGAAGTAGATTGATTCTCAACTTCCTGAGGAACCACCATATTGAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTGAAGTAGATTGATTCTCAACTTCCTGAGGAACCACCATATTGAT  400

seq1  TCTAATAATGGAAGTGCAAGTTTGCACTCCCACCAGCAACGGAGGACTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAATAATGGAAGTGCAAGTTTGCACTCCCACCAGCAACGGAGGACTGT  450

seq1  TCTTCCTGTTCCATAACCTCACTTCTGTTGTTGATTTCTGATAGGTCTGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTGTTCCATAACCTCACTTCTGTTGTTGATTTCTGATAGGTCTGT  500

seq1  CTTTTTAAGTTCCTCTGCCATTTCCCTTGCAGTTTTGAATATTCTCTTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTAAGTTCCTCTGCCATTTCCCTTGCAGTTTTGAATATTCTCTTTT  550

seq1  AGTTTTGTGTACTTAGTGTTTTGATTGTTATATGTCAAGGAGAGTCTCTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTTGTGTACTTAGTGTTTTGATTGTTATATGTCAAGGAGAGTCTCTT  600

seq1  TTCTGTTTTAATTAACTGGTTTTCAGCCTGATTCTTCTACCTTTGCAAGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGTTTTAATTAACTGGTTTTCAGCCTGATTCTTCTACCTTTGCAAGT  650

seq1  ATTACT  656
      ||||||
seq2  ATTACT  656

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information