MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-177C13
Chromosome	5 (Build37)
Map Location	136,300,599 - 136,494,400
singlet/doublet	doublet
Overlap gene	2900083I11Rik, Hspb1, Ywhag, Srcrb4d, Zp3, Dtx2
Upstream gene	Wbscr28, Cldn13, Wbscr27, Cldn4, Cldn3, Abhd11, Stx1a, Wbscr22, Wbscr18, Vps37d, Mlxipl, Tbl2, Bcl7b, LOC100040069, Baz1b, Fzd9, Fkbp6, Trim50, Nsun5, Pom121, Hip1, Ccl26l, Ccl24, Rhbdd2, Por, 2010310D06Rik, Styxl1, Mdh2
Downstream gene	Upk3b, 2310043J07Rik, Rasa4, Polr2j, 1200011O22Rik, Alkbh4, Tmem142b, Prkrip1, LOC269718, Sh2b2, Cutl1, Mylc2pl, Emid2, LOC677021, Rabl5, Fis1, Cldn15, Znhit1, Plod3, LOC639992
Link	Open Mouse BAC browser

Click to get alignment info.

name	Wbscr28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cldn13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57255 MGI:1913102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79565 MGI:1933146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12740 MGI:1313314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12739 MGI:1329044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68758 MGI:1916008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20907 MGI:109355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66138 MGI:1913388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66114 MGI:1913364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps37d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194309 MGI:2159402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlxipl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58805 MGI:1927999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27368 MGI:1351652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12054 MGI:1332238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 102 ESTs

name	Baz1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22385 MGI:1353499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fzd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14371 MGI:1313278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 48 Proteins

name	Fkbp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94244 MGI:2137612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215061 MGI:2664992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsun5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100609 MGI:2140844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pom121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107939 MGI:2137624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215114 MGI:1099804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl26l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:541307 MGI:3589281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56221 MGI:1928953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215160 MGI:1915612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Por (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18984 MGI:97744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010310D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215210 MGI:2686991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Styxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76571 MGI:1923821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17448 MGI:97050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900083I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58212 MGI:1920309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15507 MGI:96240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ywhag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22628 MGI:108109
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srcrb4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109267 MGI:1924709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 10 Proteins

name	Zp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22788 MGI:99215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74198 MGI:1921448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upk3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100647 MGI:2140882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310043J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69665 MGI:1916915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Rasa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54153 MGI:1858600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Polr2j (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20022 MGI:109582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200011O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71735 MGI:1918985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alkbh4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72041 MGI:1919291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem142b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269717 MGI:2443195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkrip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66801 MGI:1914051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC269718 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:269718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 498 ESTs, 8 Proteins pseudo : _no_value

name	Sh2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23921 MGI:1345171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cutl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13047 MGI:88568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mylc2pl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59310 MGI:1891705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140709 MGI:2155345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Rabl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67286 MGI:1914536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fis1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66437 MGI:1913687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60363 MGI:1913103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znhit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70103 MGI:1917353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plod3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26433 MGI:1347008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Wbscr28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352481 GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 28 (human) transcript_id : NM_194065.2

name	Wbscr28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369449 GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 28 (human) transcript_id : NM_029681.2

name	Cldn13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385852 GeneID:57255 MGI:1913102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 13 transcript_id : NM_020504.3

name	Wbscr27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355998 GeneID:79565 MGI:1933146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams Beuren syndrome chromosome region 27 (human) transcript_id : NM_024479.2

name	Cldn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753439 GeneID:12740 MGI:1313314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 4 transcript_id : NM_009903.1

name	Cldn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802289 GeneID:12739 MGI:1329044
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 3 transcript_id : NM_009902.3

name	Abhd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644576 GeneID:68758 MGI:1916008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 11 transcript_id : NM_145215.1

name	Stx1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131152 GeneID:20907 MGI:109355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 1A (brain) transcript_id : NM_016801.3

name	Wbscr22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988404 GeneID:66138 MGI:1913388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams Beuren syndrome chromosome region 22 transcript_id : NM_025375.2

name	Wbscr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988406 GeneID:66114 MGI:1913364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 18 homolog (human) transcript_id : NM_025362.3

name	Vps37d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362978 GeneID:194309 MGI:2159402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37D (yeast) transcript_id : NM_177574.2

name	Mlxipl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472008 GeneID:58805 MGI:1927999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MLX interacting protein-like transcript_id : NM_021455.3

name	Tbl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543844 GeneID:27368 MGI:1351652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 2 transcript_id : NM_013763.2

name	Bcl7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753173 GeneID:12054 MGI:1332238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 7B transcript_id : NM_009745.1

name	LOC100040069 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254613 GeneID:100040069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 102 ESTs product : hypothetical protein LOC100040069 transcript_id : XM_001474834.1

name	Baz1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755992 GeneID:22385 MGI:1353499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain adjacent to zinc finger domain, 1B transcript_id : NM_011714.1

name	Fzd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375704 GeneID:14371 MGI:1313278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 48 Proteins product : frizzled homolog 9 (Drosophila) transcript_id : XM_284144.5

name	Fkbp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892617 GeneID:94244 MGI:2137612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 6 transcript_id : NM_033571.2

name	Trim50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130549 GeneID:215061 MGI:2664992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 50 transcript_id : NM_178240.2

name	Nsun5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703825 GeneID:100609 MGI:2140844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOL1/NOP2/Sun domain family, member 5 transcript_id : NM_145414.1

name	Pom121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507336 GeneID:107939 MGI:2137624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear pore membrane protein 121 transcript_id : NM_148932.1

name	Hip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122460 GeneID:215114 MGI:1099804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : huntingtin interacting protein 1 transcript_id : NM_146001.1

name	Ccl26l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374165 GeneID:541307 MGI:3589281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 26-like transcript_id : NM_001013412.2

name	Ccl24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351670 GeneID:56221 MGI:1928953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 24 transcript_id : NM_019577.4

name	Rhbdd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872209 GeneID:215160 MGI:1915612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid domain containing 2 transcript_id : NM_146002.2

name	Por (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679420 GeneID:18984 MGI:97744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : P450 (cytochrome) oxidoreductase transcript_id : NM_008898.1

name	2010310D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365942 GeneID:215210 MGI:2686991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010310D06 gene transcript_id : NM_172541.2

name	Styxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802896 GeneID:76571 MGI:1923821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine/tyrosine interacting-like 1 transcript_id : NM_029659.3

name	Mdh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982185 GeneID:17448 MGI:97050
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : malate dehydrogenase 2, NAD (mitochondrial) transcript_id : NM_008617.2

name	2900083I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802495 GeneID:58212 MGI:1920309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900083I11 gene transcript_id : NM_021403.2

name	Hspb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305172 GeneID:15507 MGI:96240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 1 transcript_id : NM_013560.1

name	Ywhag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543975 GeneID:22628 MGI:108109
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide transcript_id : NM_018871.2

name	Srcrb4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375690 GeneID:109267 MGI:1924709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 10 Proteins product : scavenger receptor cysteine rich domain containing, group B (4 domains), transcript variant 1 transcript_id : XM_355648.5

name	Zp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756082 GeneID:22788 MGI:99215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida glycoprotein 3 transcript_id : NM_011776.1

name	Dtx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963808 GeneID:74198 MGI:1921448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 2 homolog (Drosophila) transcript_id : NM_023742.1

name	Upk3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387427 GeneID:100647 MGI:2140882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 3B transcript_id : NM_175309.4

name	2310043J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254621 GeneID:69665 MGI:1916915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 2310043J07 gene transcript_id : XM_485688.4

name	Rasa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686092 GeneID:54153 MGI:1858600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS p21 protein activator 4 transcript_id : NM_001039103.2

name	Rasa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993719 GeneID:54153 MGI:1858600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS p21 protein activator 4 transcript_id : NM_133914.2

name	Polr2j (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755361 GeneID:20022 MGI:109582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide J transcript_id : NM_011293.1

name	1200011O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366786 GeneID:71735 MGI:1918985
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200011O22 gene transcript_id : NM_027891.2

name	Alkbh4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625893 GeneID:72041 MGI:1919291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 4 (E. coli) transcript_id : NM_028070.1

name	Tmem142b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815864 GeneID:269717 MGI:2443195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 142B transcript_id : NM_178751.3

name	Prkrip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384829 GeneID:66801 MGI:1914051
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Prkr interacting protein 1 (IL11 inducible) transcript_id : NM_025774.2

name	Sh2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130730 GeneID:23921 MGI:1345171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 2 transcript_id : NM_018825.3

name	Cutl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815858 GeneID:13047 MGI:88568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cut-like 1 (Drosophila) transcript_id : NM_198602.2

name	Cutl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835728 GeneID:13047 MGI:88568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cut-like 1 (Drosophila) transcript_id : NM_009986.3

name	Mylc2pl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11072102 GeneID:59310 MGI:1891705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin light chain 2, precursor lymphocyte-specific transcript_id : NM_021611.1

name	Emid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19263337 GeneID:140709 MGI:2155345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EMI domain containing 2 transcript_id : NM_024474.2

name	Rabl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129879 GeneID:67286 MGI:1914536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 5 transcript_id : NM_026073.3

name	Fis1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384108 GeneID:66437 MGI:1913687
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fission 1 (mitochondrial outer membrane) homolog (yeast) transcript_id : NM_025562.2

name	Cldn15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384546 GeneID:60363 MGI:1913103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 15 transcript_id : NM_021719.2

name	Znhit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386060 GeneID:70103 MGI:1917353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT domain containing 1 transcript_id : NM_027318.2

name	Plod3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560515 GeneID:26433 MGI:1347008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 transcript_id : NM_011962.2

name	Wbscr28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732713 GeneID:76629 MGI:1923879
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; Williams-Beuren syndrome critical region 28 product : hypothetical protein LOC76629 isoform a protein_id : NP_919041.1

name	Wbscr28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732715 GeneID:76629 MGI:1923879
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; Williams-Beuren syndrome critical region 28 product : hypothetical protein LOC76629 isoform b protein_id : NP_083957.1

name	Cldn13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048432 GeneID:57255 MGI:1913102
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : claudin-13 product : claudin 13 protein_id : NP_065250.1

name	Wbscr27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355999 CCDS:CCDS19727.1 GeneID:79565 MGI:1933146
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : Williams-Beuren syndrome chromosome region 27 homolog product : Williams-Beuren syndrome critical region protein 27 protein_id : NP_077799.2

name	Cldn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753440 CCDS:CCDS19728.1 GeneID:12740 MGI:1313314
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 4 protein_id : NP_034033.1

name	Cldn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753438 CCDS:CCDS19729.1 GeneID:12739 MGI:1329044
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence IDA] codon_start : 1 product : claudin 3 protein_id : NP_034032.1

name	Abhd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644577 CCDS:CCDS19730.1 GeneID:68758 MGI:1916008
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 note : Williams-Beuren syndrome critical region 21; Williams Beuren syndrome chromosome region 21 product : abhydrolase domain containing 11 protein_id : NP_660250.1

name	Stx1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011853 CCDS:CCDS19731.1 GeneID:20907 MGI:109355
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0000149 - SNARE binding [Evidence IDA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin 1 a product : syntaxin 1A (brain) protein_id : NP_058081.2

name	Wbscr22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988405 CCDS:CCDS19732.1 GeneID:66138 MGI:1913388
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : Williams-Beuren syndrome critical region protein 22 protein_id : NP_079651.2

name	Wbscr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644569 GeneID:66114 MGI:1913364
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : Williams-Beuren syndrome critical region 18 protein_id : NP_079638.2

name	Vps37d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243920 CCDS:CCDS19733.1 GeneID:194309 MGI:2159402
definition	codon_start : 1 note : Williams-Beuren syndrome critical region protein 24; Williams-Beuren syndrome chromosome region 24 homolog product : vacuolar protein sorting 37D protein_id : NP_808242.1

name	Mlxipl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328263 GeneID:58805 MGI:1927999
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : putative hepatic transcription factor; Williams-Beuren syndrome chromosome region 14 homolog product : WBSCR14 protein protein_id : NP_067430.2

name	Tbl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543845 CCDS:CCDS19735.1 GeneID:27368 MGI:1351652
definition	codon_start : 1 product : transducin (beta)-like 2 protein_id : NP_038791.2

name	Bcl7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753174 GeneID:12054 MGI:1332238
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B-cell CLL/lymphoma 7B protein_id : NP_033875.1

name	LOC100040069 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254614 GeneID:100040069
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474884.1

name	Baz1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755993 CCDS:CCDS19736.1 GeneID:22385 MGI:1353499
definition	GO_component : GO:0005721 - centric heterochromatin [Evidence IDA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IDA]; GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Williams-Beuren syndrome chromosome region 9 homolog product : bromodomain adjacent to zinc finger domain, 1B protein_id : NP_035844.1

name	Fzd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38081080 GeneID:14371 MGI:1313278
definition	codon_start : 1 product : frizzled 9 protein_id : XP_284144.2

name	Fkbp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809008 CCDS:CCDS19738.1 GeneID:94244 MGI:2137612
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005528 - FK506 binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IDA] GO_process : GO:0018208 - peptidyl-proline modification [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506-binding protein 6 (36kD); FK506 binding protein 6 (36kD) product : FK506 binding protein 6 protein_id : NP_291049.1

name	Trim50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142677 CCDS:CCDS19739.1 GeneID:215061 MGI:2664992
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 50 protein_id : NP_839971.1

name	Nsun5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703826 CCDS:CCDS19740.1 GeneID:100609 MGI:2140844
definition	codon_start : 1 exception : mismatches in translation note : Williams-Beuren syndrome critical region protein 20; Williams Beuren syndrome chromosome region 20A homolog product : NOL1R protein protein_id : NP_663389.1

name	Pom121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507337 GeneID:107939 MGI:2137624
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear pore membrane protein 121 protein_id : NP_683734.1

name	Hip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122461 GeneID:215114 MGI:1099804
definition	GO_component : GO:0030136 - clathrin-coated vesicle [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS]; GO:0005543 - phospholipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0006919 - caspase activation [Evidence ISS]; GO:0048268 - clathrin cage assembly [Evidence ISS]; GO:0006897 - endocytosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS] codon_start : 1 product : huntingtin interacting protein 1 protein_id : NP_666113.1

name	Ccl26l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374166 CCDS:CCDS19741.1 GeneID:541307 MGI:3589281
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : eotaxin 3-like product : chemokine (C-C motif) ligand 26-like protein_id : NP_001013430.2

name	Ccl24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625035 CCDS:CCDS19742.1 GeneID:56221 MGI:1928953
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : eotaxin-2; CC chemokine CCL24; small inducible cytokine A24 product : chemokine (C-C motif) ligand 24 protein_id : NP_062523.1

name	Rhbdd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122463 CCDS:CCDS19743.1 GeneID:215160 MGI:1915612
definition	codon_start : 1 note : rhomboid, veinlet-like 7; upregulated during skeletal muscle growth 1 product : rhomboid domain containing 2 protein_id : NP_666114.1

name	Por (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679421 GeneID:18984 MGI:97744
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003958 - NADPH-hemoprotein reductase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IMP] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH cytochrome P450 oxydoreductase product : cytochrome P450 reductase protein_id : NP_032924.1

name	2010310D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789387 CCDS:CCDS19744.1 GeneID:215210 MGI:2686991
definition	codon_start : 1 product : transmembrane protein induced by tumor necrosis factor alpha protein_id : NP_766129.1

name	Styxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15805022 CCDS:CCDS19745.1 GeneID:76571 MGI:1923821
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : dual specificity phosphatase 24 (putative) product : map kinase phosphatase-like protein MK-STYX protein_id : NP_083935.2

name	Mdh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982186 CCDS:CCDS19746.1 GeneID:17448 MGI:97050
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0030060 - L-malate dehydrogenase activity [Evidence IDA]; GO:0016615 - malate dehydrogenase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0006108 - malate metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : malate dehydrogenase, mitochondrial; mitochondrial malate dehydrogenase 2, NAD product : malate dehydrogenase 2, NAD (mitochondrial) protein_id : NP_032643.2

name	2900083I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946754 GeneID:58212 MGI:1920309
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC58212 protein_id : NP_067378.1

name	Hspb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305173 GeneID:15507 MGI:96240
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : heat shock protein, 25 kDa; heat shock 27kDa protein 1 product : heat shock protein 1 protein_id : NP_038588.1

name	Ywhag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543976 CCDS:CCDS19748.1 GeneID:22628 MGI:108109
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence ISS]; GO:0005159 - insulin-like growth factor receptor binding [Evidence ISS]; GO:0019904 - protein domain specific binding [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence ISS]; GO:0008426 - protein kinase C inhibitor activity [Evidence ISS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0006469 - negative regulation of protein kinase activity [Evidence ISS]; GO:0006605 - protein targeting [Evidence IDA]; GO:0007088 - regulation of mitosis [Evidence ISS]; GO:0045664 - regulation of neuron differentiation [Evidence ISS]; GO:0009966 - regulation of signal transduction [Evidence ISS]; GO:0048167 - regulation of synaptic plasticity [Evidence ISS] codon_start : 1 note : 14-3-3 protein gamma; tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide; 3-monooxgenase/tryptophan 5-monooxgenase activation protein, gamma polypeptide product : 3-monooxgenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide protein_id : NP_061359.2

name	Srcrb4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375691 GeneID:109267 MGI:1924709
definition	codon_start : 1 product : scavenger receptor cysteine rich domain containing, group B (4 domains) isoform 1 protein_id : XP_355648.5

name	Zp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756083 CCDS:CCDS19749.1 GeneID:22788 MGI:99215
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IDA] codon_start : 1 product : zona pellucida glycoprotein 3 protein_id : NP_035906.1

name	Dtx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963809 GeneID:74198 MGI:1921448
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007219 - Notch signaling pathway [Evidence TAS] [Evidence IDA] codon_start : 1 product : deltex 2 protein_id : NP_076231.1

name	Upk3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202017 CCDS:CCDS19750.1 GeneID:100647 MGI:2140882
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : uroplakin IIIb protein_id : NP_780518.1

name	2310043J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254622 GeneID:69665 MGI:1916915
definition	codon_start : 1 product : hypothetical protein LOC69665 protein_id : XP_485688.3

name	Rasa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993720 GeneID:54153 MGI:1858600
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Ca2+promoted Ras inactivator; calcium-promoted RAS inactivator product : RAS p21 protein activator 4 isoform 1 protein_id : NP_598675.2

name	Rasa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993718 GeneID:54153 MGI:1858600
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Ca2+promoted Ras inactivator; calcium-promoted RAS inactivator product : RAS p21 protein activator 4 isoform 2 protein_id : NP_001034192.1

name	Polr2j (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755362 CCDS:CCDS19751.1 GeneID:20022 MGI:109582
definition	GO_component : GO:0005666 - DNA-directed RNA polymerase III complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RNA polymerase II 4 (14 kDa subunit); RNA polymerase II subunit RPB14; polymerase (RNA) II (DNA directed) polypeptide I product : polymerase (RNA) II (DNA directed) polypeptide J protein_id : NP_035423.1

name	1200011O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312147 GeneID:71735 MGI:1918985
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71735 protein_id : NP_082167.1

name	Alkbh4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625894 CCDS:CCDS19753.1 GeneID:72041 MGI:1919291
definition	codon_start : 1 product : alkB, alkylation repair homolog 4 protein_id : NP_082346.1

name	Tmem142b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815865 GeneID:269717 MGI:2443195
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : calcium release-activated calcium channel 2 product : transmembrane protein 142B protein_id : NP_848866.2

name	Prkrip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385244 CCDS:CCDS19754.1 GeneID:66801 MGI:1914051
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA]; GO:0004860 - protein kinase inhibitor activity [Evidence IDA] GO_process : GO:0042326 - negative regulation of phosphorylation [Evidence IDA]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA] codon_start : 1 product : Prkr interacting protein 1 (IL11 inducible) protein_id : NP_080050.1

name	Sh2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254556 GeneID:23921 MGI:1345171
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0001726 - ruffle [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005070 - SH3/SH2 adaptor activity [Evidence IDA]; GO:0005068 - transmembrane receptor protein tyrosine kinase adaptor protein activity [Evidence IDA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IMP] [Evidence IPI]; GO:0050851 - antigen receptor-mediated signaling pathway [Evidence IDA]; GO:0001922 - B-1 B cell homeostasis [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0042593 - glucose homeostasis [Evidence ISS]; GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IDA]; GO:0046325 - negative regulation of glucose import [Evidence ISS]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0019222 - regulation of metabolism [Evidence IMP] codon_start : 1 note : adaptor protein with pleckstrin homology and src homology 2 domains; insulin receptor substrate 5 product : adaptor protein with pleckstrin homology and src protein_id : NP_061295.2

name	Cutl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815859 GeneID:13047 MGI:88568
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CCAAT displacement protein; Cux/CDP homeoprotein product : CCAAT displacement protein isoform b protein_id : NP_941004.2

name	Cutl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835729 GeneID:13047 MGI:88568
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0042491 - auditory receptor cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030324 - lung development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CCAAT displacement protein; Cux/CDP homeoprotein product : CCAAT displacement protein isoform a protein_id : NP_034116.3

name	Mylc2pl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11072103 GeneID:59310 MGI:1891705
definition	codon_start : 1 exception : unclassified translation discrepancy note : precursor lymphocyte-specific regulatory light chain product : myosin light chain 2, precursor lymphocyte-specific protein_id : NP_067624.1

name	Emid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263338 CCDS:CCDS19755.1 GeneID:140709 MGI:2155345
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : Collagen XXVI; collagen, type XXVI, alpha 1; procollagen, type XXVI, alpha 1 product : Emu2 protein_id : NP_077794.2

name	Rabl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313026 CCDS:CCDS19756.1 GeneID:67286 MGI:1914536
definition	codon_start : 1 product : RAB, member of RAS oncogene family-like 5 protein_id : NP_080349.1

name	Fis1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384998 CCDS:CCDS19757.1 GeneID:66437 MGI:1913687
definition	GO_component : GO:0031307 - integral to mitochondrial outer membrane [Evidence ISS]; GO:0005779 - integral to peroxisomal membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0000266 - mitochondrial fission [Evidence ISS]; GO:0016559 - peroxisome fission [Evidence ISS] codon_start : 1 product : tetratricopeptide repeat domain 11 protein_id : NP_079838.1

name	Cldn15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149748 CCDS:CCDS19758.1 GeneID:60363 MGI:1913103
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 15 protein_id : NP_068365.1

name	Znhit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037197 GeneID:70103 MGI:1917353
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger protein, subfamily 4A (HIT domain containing), member 1 product : zinc finger, HIT domain containing 1 protein_id : NP_081594.1

name	Plod3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755110 CCDS:CCDS19759.1 GeneID:26433 MGI:1347008
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : lysyl hydroxylase 2; lysyl hydroxylase 3 product : procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 protein_id : NP_036092.1

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 1 pseudo : _no_value

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 2 pseudo : _no_value

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 3 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 1 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 2 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 3 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 4 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 5 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 6 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 7 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 8 pseudo : _no_value

name	LOC269718 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254615 GeneID:269718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 498 ESTs, 8 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_032332.1

clone name	MSMg01-458K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-170M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225E21
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-177C13.b	B6Ng01-177C13.g
ACC	GA004508	GA004509
length	1,038	981
definition	B6Ng01-177C13.b	B6Ng01-177C13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(136,493,363 - 136,494,400)	(136,300,599 - 136,301,564)
sequence	gaattccaggaggagagccacacccaccatgcatgtgtgggtttcatggg ctctgagcttccatctttacactgaataaccaagagctataaccacagag cctcctccccatcttgcctttcaatgttctacacagacagaacctgacag tcccaggcagaccgaggctcaggtcaaaggaaatccaaggtcccacatcc tggacatcaaggctgaatgtgctacactcagctccaatttgcacaaacaa tgacatgccaggttccactacagagcttctatgcttatatagagtggtag gtacaatgaatataaagcccaatataaaaatcttaagacctctcatgact tacaggtgcagaaaaaagacaaagcaggcgccggagctttcactgaaaga tccacagtagtactagagaaaaagaaaaattcaggggccagccagatgcc ttagcaagggaaagagccttgccgccaggcctgatgaccagagctggatc cctgggaaccataggaggagagaactgatctccacgagttgccctctgaa ctccacacttgtgccatggcacaatgtatgtttgtgcatgtgtgtatgtg gagacacacataaatgtaatgaaaaatattttaaaacagctgagcacggt ggtgcatgccttccaccccagccctcaggaggcaggggcaggtgaaactg taaatctgaggccagcctagactacacagtgaactctgagacagccagag ctacacagtgagatcctgtctcacaaaataagttaattaacgaactaaaa tttggtaaaaagaaccctggacctgcaatatataacacgctaatctcaca caggtcagtggctgacaaggacccatggcaagaatgggaacaaggcagag catcagttccactcacacggcgatggcagtggggaaaggggggccctcag agcagcattgagagcacagcagatgctgctgggtgtggtggctcatgtct gtaatcccagcagtccggagactgagaggatggagttc	gaattcaagttggaaaccctaggatggggttggtgcttggctagaagaca agacattcccatctcattcagaaactaggctgacatcaggccttgggaag agatggccatggagtttacacaaatgtcaaagggaaacagactggatgtt gggagcaaggacaacttccactgaagtccctgaagatgacagtagtgaga tagaagaagtgagccccaccactacaaacacgggctagctgtatattaca aacacaggcaagctgcgcgtattacagttggttgtttgtttattgagtgt gtaccatggcacaaacatgtggcagtgagaagacagtgtgggggtcagtt ctctcccccaactatgtaaatcttaggtcttgaggcttggaggcaagcag ctttacccactgagccattcccctgcccgagattggatttttgcccctct tgtttattttgacacaaggtctcatgcaacacaggcaggtcttgaactca ctgtgtagccaaaggtgacattgaactatagatcctcctacctccacatc ccagtgctgagctggtcacagatggctgcccggtgtgacagcccacccca gacagacactaaggacaggaagatagatgaactcaactactctcagagag accactggcaggccggggattggagcgtgtctgtaatcctagcacacgag aggctaagacagaagaatcacaagtctagtccagtatgggaagttaggtg tggtggcacacacatctagtcctcctcctatttgagaggcagaggctggt ggagttctgtgaaggtctgaggccagcctgggtccacggagtggagttct agggaatccagggctacctggtaagacactatcttcaaaaaatattggct ggggataagggcttagctggttcggagccgcaccaaggccctgggccttg gaccttggagcactgaagaacctgggccatg
quality values	Open. Hide. 47 31 27 28 62 62 32 16 62 62 47 45 62 49 47 62 62 54 47 42 62 62 62 62 47 44 62 44 44 62 62 59 62 62 59 51 46 32 38 38 33 50 50 62 59 49 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 48 54 56 56 59 59 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 49 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 46 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 48 62 62 47 47 62 62 62 54 54 62 58 58 58 58 58 58 43 58 58 58 54 54 58 58 58 58 58 58 58 49 54 49 58 58 58 58 58 58 58 49 54 54 58 58 58 54 54 52 58 58 58 58 54 58 58 54 58 58 58 54 58 54 52 58 58 58 58 58 58 52 52 54 58 52 58 58 58 54 54 58 42 52 45 58 54 58 52 58 54 58 58 53 58 46 46 49 48 58 58 58 54 50 52 51 58 58 49 49 58 58 58 42 35 52 58 58 51 42 12 46 52 49 52 58 40 51 51 50 58 50 50 53 58 41 49 49 51 53 53 39 50 58 58 50 46 50 58 58 58 58 50 49 9 58 39 16 58 26 39 22 58 58 47 50 39 18 58 35 51 52 58 37 23 43 58 37 30 58 39 40 50 51 30 54 12 47 25 52 25 31 52 58 50 37 20 47 32 33 34 53 31 50 32 52 52 52 51 50 37 53 52 42 41 51 23 41 40 31 37 52 52 37 52 53 31 52 39 33 49 19 40 39 49 41 53 53 42 41 37 23 54 42 54 37 39 42 34 29 34 42 54 54 24 41 40 52 37 52 30 19 45 33 33 28 46 42 34 36 25 32 40 34 54 54 52 33 54 35 41 53 32 37 54 54 54 49 19 49 35 24 54 30 34 29 24 12 9 31 35 43 23 7 40 33 31 28 29 39 32 35 30 31 31 33 40 34 33 27 31 32 29 31 26 40 30 31 24 5 26 20 29 29 26 39 37 33 18 31 36 29 15 28 33 39 42 31 28 45 32 28 34 36 51 26 31 31 30 33 31 29 36 51 29 33 13 16 19 18 23 27 18 31 10 35 8 30 24 36 34 18 33 42 26 32 32 24 31 31 31 18 29 21 33 19 22 16 29 31 26 31 42 21 31 32 32 42 46 39 48 11 46 12 31 46 41 46 32 19 33 41 27 32 15 12 9 33 9 31 25 18 31 22 31 39 33 31 8 32 18 20 19 23 23 17 25 25 12 34 17 31 21 27 32 31 32 31 44 19 9 29 16 36 32 15 32 36 25 31 31 21 22 27 17 34 22 42 31 26 19 23 32 37 34 20 20 22 23 27 28 23 18 21 10 29 6 22 21 17 10 4 5 18 16 24 21 30 11 10 14 21 23 32 11	Open. Hide. 62 49 51 44 62 47 35 59 62 62 62 62 43 62 59 56 62 62 56 56 50 28 43 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 59 56 35 35 40 59 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 47 47 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 35 36 24 47 58 48 54 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 41 54 54 58 49 58 58 58 54 52 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 54 58 58 45 49 52 54 58 58 58 58 58 58 58 58 51 54 58 58 50 49 51 58 53 58 42 49 43 41 46 40 58 50 51 58 50 58 54 52 46 58 58 58 49 58 54 47 54 53 53 51 50 54 51 58 42 51 58 41 53 51 58 49 51 41 40 51 36 53 50 58 43 50 53 38 51 52 51 49 36 19 58 53 53 58 36 50 42 52 33 51 53 42 58 51 50 58 53 51 58 58 38 58 41 51 51 38 35 45 32 40 54 54 51 39 39 54 54 49 39 39 32 25 37 47 32 27 39 53 52 39 40 32 51 49 38 39 49 54 40 50 24 47 37 53 40 34 37 33 28 33 42 54 53 29 34 49 41 34 53 53 53 54 41 40 26 51 20 53 31 32 29 22 32 41 32 52 40 32 40 40 37 21 45 37 53 53 36 31 31 25 42 29 53 25 52 33 23 47 32 32 40 40 34 33 29 31 30 53 40 35 29 32 31 29 26 31 29 51 28 35 17 51 23 21 15 31 18 25 24 31 22 42 45 18 51 18 21 39 31 36 25 31 26 31 42 33 35 25 36 34 36 31 24 31 32 31 31 47 17 33 32 31 36 32 19 20 35 31 42 26 31 42 29 42 31 26 17 25 9 14 29 31 31 42 36 34 30 21 31 29 30 33 28 16 22 25 33 28 31 27 46 34 30 41 20 32 22 18 24 21 16 30 16 16 11 14 25 30 8 26 39 34 20 30 23 14 21 16 11 8 8 27 37 19 6 29 20 17 26 10 38 37 14 16 24 25 31 17 11 41 15 24 30 11 23 10 15 10 30 11 31 19 18 32 14 21 10 24 13 21 5 33 25 15 31 18 20 26 22 19 43 30 15 21 13 33 14 24 34 37 21 29 19 12 28 6 9 13 32 27 13 10 18 9 8 17 48 48 39 37 9 8 7 9 8 30 25 13 20 28 43 34 21 27 10 8 15 28 47 28 13 24 15 25 13 20 21 17 28 12 6 5 9 7 13 7 6 5 8 11 4 5 6 28 27 6 5 17 28 16 20 24 32 28 6 6 20 10 7 9 7 8 14 11 26 10 6 7 7 24 20 18 13 18 26 6 9 16 20 7 18 15 13 28 14 18 13 19 19 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_136493363_136494400
seq2: B6Ng01-177C13.b_48_1085 (reverse)

seq1  GAACTCAATCCTCTCAGTCTCCGGACTGCTGGGATTACAGACATGAGCCA  50
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCCATCCTCTCAGTCTCCGGACTGCTGGGATTACAGACATGAGCCA  50

seq1  CCACACCCAGCAGCATCTGCTGTGCTCTCAATGCTGCTCTGAGGGGCCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  CCACACCCAGCAGCATCTGCTGTGCTCTCAATGCTGCTCTGAGGGCCCCC  100

seq1  CCTTCCCCACTGCCATCGCCGTGTGAGTGGAACTGATGCTCTGCCTTGTT  150
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCCCACTGCCATCGCCGTGTGAGTGGAACTGATGCTCTGCCTTGTT  150

seq1  CCCATTCTTGCCATGGGTCCTTGTCAGCCACTGACCTGTGTGAGATTAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATTCTTGCCATGGGTCCTTGTCAGCCACTGACCTGTGTGAGATTAGC  200

seq1  GTGTTATATATTGCAGGTCCAGGGTTCTTTTTACCAAATTTTAGTTCGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTATATATTGCAGGTCCAGGGTTCTTTTTACCAAATTTTAGTTCGTT  250

seq1  AATTAACTTATTTTGTGAGACAGGATCTCACTGTGTAGCTCTGGCTGTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAACTTATTTTGTGAGACAGGATCTCACTGTGTAGCTCTGGCTGTCT  300

seq1  CAGAGTTCACTGTGTAGTCTAGGCTGGCCTCAGATTTACAGTTTCACCTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGTTCACTGTGTAGTCTAGGCTGGCCTCAGATTTACAGTTTCACCTG  350

seq1  CCCCTGCCTCCTGAGGGCTGGGGTGGAAGGCATGCACCACCGTGCTCAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTGCCTCCTGAGGGCTGGGGTGGAAGGCATGCACCACCGTGCTCAGC  400

seq1  TGTTTTAAAATATTTTTCATTACATTTATGTGTGTCTCCACATACACACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTAAAATATTTTTCATTACATTTATGTGTGTCTCCACATACACACA  450

seq1  TGCACAAACATACATTGTGCCATGGCACAAGTGTGGAGTTCAGAGGGCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACAAACATACATTGTGCCATGGCACAAGTGTGGAGTTCAGAGGGCAA  500

seq1  CTCGTGGAGATCAGTTCTCTCCTCCTATGGTTCCCAGGGATCCAGCTCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGTGGAGATCAGTTCTCTCCTCCTATGGTTCCCAGGGATCCAGCTCTG  550

seq1  GTCATCAGGCCTGGCGGCAAGGCTCTTTCCCTTGCTAAGGCATCTGGCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATCAGGCCTGGCGGCAAGGCTCTTTCCCTTGCTAAGGCATCTGGCTG  600

seq1  GCCCCTGAATTTTTCTTTTTCTCTAGTACTACTGTGGATCTTTCAGTGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCTGAATTTTTCTTTTTCTCTAGTACTACTGTGGATCTTTCAGTGAA  650

seq1  AGCTCCGGCGCCTGCTTTGTCTTTTTTCTGCACCTGTAAGTCATGAGAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCCGGCGCCTGCTTTGTCTTTTTTCTGCACCTGTAAGTCATGAGAGG  700

seq1  TCTTAAGATTTTTATATTGGGCTTTATATTCATTGTACCTACCACTCTAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAGATTTTTATATTGGGCTTTATATTCATTGTACCTACCACTCTAT  750

seq1  ATAAGCATAGAAGCTCTGTAGTGGAACCTGGCATGTCATTGTTTGTGCAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGCATAGAAGCTCTGTAGTGGAACCTGGCATGTCATTGTTTGTGCAA  800

seq1  ATTGGAGCTGAGTGTAGCACATTCAGCCTTGATGTCCAGGATGTGGGACC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGAGCTGAGTGTAGCACATTCAGCCTTGATGTCCAGGATGTGGGACC  850

seq1  TTGGATTTCCTTTGACCTGAGCCTCGGTCTGCCTGGGACTGTCAGGTTCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGATTTCCTTTGACCTGAGCCTCGGTCTGCCTGGGACTGTCAGGTTCT  900

seq1  GTCTGTGTAGAACATTGAAAGGCAAGATGGGGAGGAGGCTCTGTGGTTAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGTGTAGAACATTGAAAGGCAAGATGGGGAGGAGGCTCTGTGGTTAT  950

seq1  AGCTCTTGGTTATTCAGTGTAAAGATGGAAGCTCAGAGCCCATGAAACCC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCTTGGTTATTCAGTGTAAAGATGGAAGCTCAGAGCCCATGAAACCC  1000

seq1  ACACATGCATGGTGGGTGTGGCTCTCCTCCTGGAATTC  1038
      ||||||||||||||||||||||||||||||||||||||
seq2  ACACATGCATGGTGGGTGTGGCTCTCCTCCTGGAATTC  1038

seq1: chr5_136300599_136301564
seq2: B6Ng01-177C13.g_64_1044

seq1  GAATTCAAGTTGGAAACCCTAGGATGGGGTTGGTGCTTGGCTAGAAGACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGTTGGAAACCCTAGGATGGGGTTGGTGCTTGGCTAGAAGACA  50

seq1  AGACATTCCCATCTCATTCAGAAACTAGGCTGACATCAGGCCTTGGGAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATTCCCATCTCATTCAGAAACTAGGCTGACATCAGGCCTTGGGAAG  100

seq1  AGATGGCCATGGAGTTTACACAAATGTCAAAGGGAAACAGACTGGATGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGCCATGGAGTTTACACAAATGTCAAAGGGAAACAGACTGGATGTT  150

seq1  GGGAGCAAGGACAACTTCCACTGAAGTCCCTGAAGATGACAGTAGTGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGCAAGGACAACTTCCACTGAAGTCCCTGAAGATGACAGTAGTGAGA  200

seq1  TAGAAGAAGTGAGCCCCACCACTACAAACACGGGCTAGCTGTATATTACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAGAAGTGAGCCCCACCACTACAAACACGGGCTAGCTGTATATTACA  250

seq1  AACACAGGCAAGCTGCGCGTATTACAGTTGGTTGTTTGTTTATTGAGTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAGGCAAGCTGCGCGTATTACAGTTGGTTGTTTGTTTATTGAGTGT  300

seq1  GTACCATGGCACAAACATGTGGCAGTGAGAAGACAGTGTGGGGGTCAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACCATGGCACAAACATGTGGCAGTGAGAAGACAGTGTGGGGGTCAGTT  350

seq1  CTCTCCCCCAACTATGTAAATCTTAGGTCTTGAGGCTTGGAGGCAAGCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCCCCCAACTATGTAAATCTTAGGTCTTGAGGCTTGGAGGCAAGCAG  400

seq1  CTTTACCCACTGAGCCATTCCCCTGCCCGAGATTGGATTTTTGCCCCTCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTACCCACTGAGCCATTCCCCTGCCCGAGATTGGATTTTTGCCCCTCT  450

seq1  TGTTTATTTTGACACAAGGTCTCATGCAACACAGGCAGGTCTTGAACTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTATTTTGACACAAGGTCTCATGCAACACAGGCAGGTCTTGAACTCA  500

seq1  CTGTGTAGCCAAAGGTGACATTGAACTATAGATCCTCCTACCTCCACATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGTAGCCAAAGGTGACATTGAACTATAGATCCTCCTACCTCCACATC  550

seq1  CCAGTGCTGAGCTGGTCACAGATGGCTGCCCGGTGTGACAGCCCACCCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGCTGAGCTGGTCACAGATGGCTGCCCGGTGTGACAGCCCACCCCA  600

seq1  GACAGACACTAAGGACAGGAAGATAGATGAACTCAACTACTCTCAGAGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGACACTAAGGACAGGAAGATAGATGAACTCAACTACTCTCAGAGAG  650

seq1  ACCACTGGCAGGCCGGGGATTGGAGCGTGTCTGTAATCCTAGCACACGAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTGGCAGGCCGGGGATTGGAGCGTGTCTGTAATCCTAGCACACGAG  700

seq1  AGGCTAAGACAGAAGAATCACAAGTCTAGTCCAGTATGGGAAGTTAGGTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTAAGACAGAAGAATCACAAGTCTAGTCCAGTATGGGAAGTTAGGTG  750

seq1  TGGTGGCACACACATCTAGTCCTCCTCCTATTTGAGAGGCAGAGGCTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGGCACACACATCTAGTCCTCCTCCTATTTGAGAGGCAGAGGCTGGT  800

seq1  GGAGTTCTGTG-AGGTCTGAGGCCAGCCT-GGTCCACGGAGT-GAGTTCT  847
      ||||||||||| ||||||||||||||||| |||||||||||| |||||||
seq2  GGAGTTCTGTGAAGGTCTGAGGCCAGCCTGGGTCCACGGAGTGGAGTTCT  850

seq1  AGGGAATCCAGGGCTACCTGGTAAGACACTATCT--CAAAAATA-TGGCT  894
      ||||||||||||||||||||||||||||||||||   ||||||| |||||
seq2  AGGGAATCCAGGGCTACCTGGTAAGACACTATCTTCAAAAAATATTGGCT  900

seq1  GGGGAT-AGGGCTTAGCTGGT--CGAG-CGCA-CAAAGCCCTGGGC--TT  937
      |||||| ||||||||||||||   ||| |||| ||| |||||||||  | 
seq2  GGGGATAAGGGCTTAGCTGGTTCGGAGCCGCACCAAGGCCCTGGGCCTTG  950

seq1  GACCTT-GAGCACTGAAGACACT-GGCCATG  966
      |||||| ||||||||||||  || |||||||
seq2  GACCTTGGAGCACTGAAGAACCTGGGCCATG  981

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information