MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-184A23
Chromosome	5 (Build37)
Map Location	121,420,578 - 121,564,942
singlet/doublet	doublet
Overlap gene	Rph3a, LOC665299
Upstream gene	Rbm19, LOC100039609, Lhx5, Sdsl, Sds, 1300012G16Rik, Slc24a6, Tpcn1, Iqcd, 1110008J03Rik, Ddx54, LOC546886, Rasal1, Dtx1, Oas2, Oas3, Oas1e, Oas1c, Oas1b, Oas1f, Oas1h, Oas1g, Oas1a, Oas1d, Oas1i
Downstream gene	Ptpn11, Rpl6, LOC100039686, EG545802, AU042671, Trafd1, C330023M02Rik, Erp29, Tmem116, Adam1b, Adam1a, Mapkapk5, Aldh2, 9330129D05Rik, Acad10, Brap, Atxn2, Sh2b3, A230106M15Rik, Cutl2, LOC100042693, Myl2, Ccdc63
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rbm19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74111 MGI:1921361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Lhx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16873 MGI:107792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdsl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257635 MGI:2182607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231691 MGI:98270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300012G16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71772 MGI:1919022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc24a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170756 MGI:2180781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252972 MGI:2182472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75732 MGI:1922982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110008J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100764 MGI:1922021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71990 MGI:1919240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546886 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Rasal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19415 MGI:1330842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dtx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14357 MGI:1352744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246728 MGI:2180852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246727 MGI:2180850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231699 MGI:2180856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114643 MGI:2149633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23961 MGI:97430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243262 MGI:2180855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246729 MGI:2180853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23960 MGI:97429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246730 MGI:2180860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100535 MGI:2140770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oas1i (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Rph3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19894 MGI:102788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Ptpn11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19247 MGI:99511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19988 MGI:108057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039686 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	EG545802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545802 MGI:3647820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs

name	AU042671 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269700 MGI:2141089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 183 ESTs, 7 Proteins

name	Trafd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231712 MGI:1923551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330023M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231713 MGI:2442563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erp29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67397 MGI:1914647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77462 MGI:1924712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280667 MGI:2429506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280668 MGI:2429504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkapk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17165 MGI:1333110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11669 MGI:99600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9330129D05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338350 MGI:2443320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 5 Proteins

name	Acad10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71985 MGI:1919235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72399 MGI:1919649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atxn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20239 MGI:1277223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16923 MGI:893598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230106M15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231717 MGI:2442708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cutl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13048 MGI:107321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042693 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Myl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17906 MGI:97272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330188 MGI:3607777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794153 GeneID:74111 MGI:1921361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 19 transcript_id : NM_028762.1

name	LOC100039609 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254549 GeneID:100039609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001473185.1

name	Lhx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388418 GeneID:16873 MGI:107792
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM homeobox protein 5 transcript_id : NM_008499.3

name	Sdsl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20589948 GeneID:257635 MGI:2182607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine dehydratase-like transcript_id : NM_133902.2

name	Sds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704135 GeneID:231691 MGI:98270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine dehydratase transcript_id : NM_145565.1

name	1300012G16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343676 GeneID:71772 MGI:1919022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300012G16 gene transcript_id : NM_023625.3

name	Slc24a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875375 GeneID:170756 MGI:2180781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 6 transcript_id : NM_133221.1

name	Tpcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254191 GeneID:252972 MGI:2182472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : two pore channel 1 transcript_id : NM_145853.2

name	Iqcd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893038 GeneID:75732 MGI:1922982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing D transcript_id : NM_029408.2

name	1110008J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383593 GeneID:100764 MGI:1922021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110008J03 gene transcript_id : NM_029096.2

name	Ddx54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742726 GeneID:71990 MGI:1919240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 transcript_id : NM_028041.2

name	LOC546886 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254551 GeneID:546886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to hCG1652305 transcript_id : XM_001473234.1

name	Rasal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802160 GeneID:19415 MGI:1330842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS protein activator like 1 (GAP1 like) transcript_id : NM_013832.3

name	Dtx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802233 GeneID:14357 MGI:1352744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 1 homolog (Drosophila) transcript_id : NM_008052.3

name	Oas2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644596 GeneID:246728 MGI:2180852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 2 transcript_id : NM_145227.1

name	Oas3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130089 GeneID:246727 MGI:2180850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 3 transcript_id : NM_145226.2

name	Oas1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21630286 GeneID:231699 MGI:2180856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1E transcript_id : NM_145210.1

name	Oas1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375235 GeneID:114643 MGI:2149633
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1C transcript_id : NM_033541.3

name	Oas1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254530 GeneID:23961 MGI:97430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1B transcript_id : XM_001471673.1

name	Oas1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475826 GeneID:243262 MGI:2180855
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1F transcript_id : NM_145153.2

name	Oas1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21699071 GeneID:246729 MGI:2180853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1H transcript_id : NM_145228.1

name	Oas1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560523 GeneID:23960 MGI:97429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1G transcript_id : NM_011852.2

name	Oas1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21630282 GeneID:246730 MGI:2180860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1A transcript_id : NM_145211.1

name	Oas1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801731 GeneID:100535 MGI:2140770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase 1D transcript_id : NM_133893.2

name	Rph3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543602 GeneID:19894 MGI:102788
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabphilin 3A transcript_id : NM_011286.2

name	Ptpn11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37360980 GeneID:19247 MGI:99511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 11 transcript_id : NM_011202.2

name	Rpl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366289 GeneID:19988 MGI:108057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L6 transcript_id : NM_011290.4

name	LOC100039686 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254553 GeneID:100039686
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100039686 transcript_id : XM_001473338.1

name	EG545802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375589 GeneID:545802 MGI:3647820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : predicted gene, EG545802 transcript_id : XM_622379.3

name	AU042671 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254555 GeneID:269700 MGI:2141089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 183 ESTs, 7 Proteins product : expressed sequence AU042671, transcript variant 1 transcript_id : XM_132325.9

name	Trafd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986576 GeneID:231712 MGI:1923551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRAF type zinc finger domain containing 1 transcript_id : NM_172275.1

name	C330023M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374503 GeneID:231713 MGI:2442563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330023M02 gene transcript_id : NM_172722.3

name	Erp29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982657 GeneID:67397 MGI:1914647
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum protein 29 transcript_id : NM_026129.2

name	Tmem116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296590 GeneID:77462 MGI:1924712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 116 transcript_id : NM_029912.1

name	Adam1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842411 GeneID:280667 MGI:2429506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 1b transcript_id : NM_172125.2

name	Adam1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559888 GeneID:280668 MGI:2429504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 1a transcript_id : NM_172126.2

name	Mapkapk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754635 GeneID:17165 MGI:1333110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP kinase-activated protein kinase 5 transcript_id : NM_010765.1

name	Aldh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371450 GeneID:11669 MGI:99600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 2, mitochondrial transcript_id : NM_009656.3

name	9330129D05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375630 GeneID:338350 MGI:2443320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 5 Proteins product : RIKEN cDNA 9330129D05 gene, transcript variant 1 transcript_id : XM_488540.4

name	Acad10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351050 GeneID:71985 MGI:1919235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase family, member 10 transcript_id : NM_028037.2

name	Brap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608138 GeneID:72399 MGI:1919649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRCA1 associated protein transcript_id : NM_028227.2

name	Atxn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244103 GeneID:20239 MGI:1277223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 2 transcript_id : NM_009125.2

name	Sh2b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802577 GeneID:16923 MGI:893598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 3 transcript_id : NM_008507.3

name	A230106M15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385230 GeneID:231717 MGI:2442708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230106M15 gene transcript_id : NM_175474.3

name	Cutl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789276 GeneID:13048 MGI:107321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cut-like 2 (Drosophila) transcript_id : NM_007804.2

name	LOC100042693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254575 GeneID:100042693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042693 transcript_id : XM_001479641.1

name	Myl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657924 GeneID:17906 MGI:97272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 2, regulatory, cardiac, slow transcript_id : NM_010861.2

name	Ccdc63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803026 GeneID:330188 MGI:3607777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 63 transcript_id : NM_183307.2

name	Rbm19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794154 CCDS:CCDS19616.1 GeneID:74111 MGI:1921361
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 19 protein_id : NP_083038.1

name	LOC100039609 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254550 GeneID:100039609
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473235.1

name	Lhx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678690 CCDS:CCDS19617.1 GeneID:16873 MGI:107792
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LIM homeo box protein 5 product : LIM homeobox protein 5 protein_id : NP_032525.1

name	Sdsl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20589949 CCDS:CCDS19618.1 GeneID:257635 MGI:2182607
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003941 - L-serine ammonia-lyase activity [Evidence IEA] GO_process : GO:0006094 - gluconeogenesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : serine dehydratase related sequence 1 protein_id : NP_598663.2

name	Sds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704136 CCDS:CCDS19619.1 GeneID:231691 MGI:98270
definition	codon_start : 1 product : serine dehydratase protein_id : NP_663540.1

name	1300012G16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560090 CCDS:CCDS19620.1 GeneID:71772 MGI:1919022
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : 66.3 kDa product : hypothetical protein LOC71772 protein_id : NP_076114.2

name	Slc24a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875376 GeneID:170756 MGI:2180781
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0031403 - lithium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sodium/calcium exchanger protein protein_id : NP_573484.1

name	Tpcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003914 GeneID:252972 MGI:2182472
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : two pore channel 1 protein_id : NP_665852.1

name	Iqcd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313054 CCDS:CCDS19621.1 GeneID:75732 MGI:1922982
definition	GO_function : GO:0004618 - phosphoglycerate kinase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : IQ motif containing D protein_id : NP_083684.1

name	1110008J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270206 GeneID:100764 MGI:1922021
definition	codon_start : 1 product : hypothetical protein LOC100764 protein_id : NP_083372.1

name	Ddx54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076989 GeneID:71990 MGI:1919240
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0030331 - estrogen receptor binding [Evidence ISS]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence ISS] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence ISS]; GO:0006396 - RNA processing [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 protein_id : NP_082317.1

name	LOC546886 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254552 GeneID:546886
definition	codon_start : 1 product : similar to hCG1652305 protein_id : XP_001473284.1

name	Rasal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980729 CCDS:CCDS19623.1 GeneID:19415 MGI:1330842
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS protein activator like 1 (GAP1 like) protein_id : NP_038860.2

name	Dtx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816920 CCDS:CCDS19624.1 GeneID:14357 MGI:1352744
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0010001 - glial cell differentiation [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IMP] [Evidence IDA] codon_start : 1 note : fractionated x-irradiation induced transcript 1 product : deltex 1 homolog protein_id : NP_032078.2

name	Oas2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644597 CCDS:CCDS19625.1 GeneID:246728 MGI:2180852
definition	GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006401 - RNA catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : 2'-5' oligoadenylate synthetase-like 11 product : 2'-5' oligoadenylate synthetase 2 protein_id : NP_660262.1

name	Oas3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644585 GeneID:246727 MGI:2180850
definition	GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : 2'-5' oligoadenylate synthetase-like 10 product : 2'-5' oligoadenylate synthetase 3 protein_id : NP_660261.1

name	Oas1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630287 GeneID:231699 MGI:2180856
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 2'-5'olygoadenylate synthetase 1E; 2'-5' oligoadenylate synthetase-like 7; 2,5-oligoadenylate synthetase-like 7 product : 2'-5' oligoadenylate synthetase 1E protein_id : NP_660211.1

name	Oas1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809044 CCDS:CCDS19626.1 GeneID:114643 MGI:2149633
definition	GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : 2'-5' oligoadenylate synthetase-like 2 product : 2'-5' oligoadenylate synthetase 1C protein_id : NP_291019.1

name	Oas1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254531 GeneID:23961 MGI:97430
definition	codon_start : 1 product : 2'-5' oligoadenylate synthetase 1B protein_id : XP_001471723.1

name	Oas1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553117 CCDS:CCDS19628.1 GeneID:243262 MGI:2180855
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : 2'-5'oligoadenylate synthetase 1F protein_id : NP_660135.1

name	Oas1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699072 CCDS:CCDS19629.1 GeneID:246729 MGI:2180853
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : 2'-5' oligoadenylate synthetase 1H protein_id : NP_660263.1

name	Oas1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560524 GeneID:23960 MGI:97429
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : 2'-5' oligoadenylate synthetase 1A product : 2'-5' oligoadenylate synthetase 1G protein_id : NP_035982.2

name	Oas1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630283 CCDS:CCDS19630.1 GeneID:246730 MGI:2180860
definition	GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0048525 - negative regulation of viral life cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation product : 2'-5' oligoadenylate synthetase 1A protein_id : NP_660212.1

name	Oas1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527108 CCDS:CCDS19631.1 GeneID:100535 MGI:2140770
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009790 - embryonic development [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0051348 - negative regulation of transferase activity [Evidence IDA]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0001542 - ovulation (sensu Mammalia) [Evidence IMP] codon_start : 1 note : 2',5'-oligoadenylate synthetase-like 8; 2'-5'olygoadenylate synthetase 1D product : 2'-5' oligoadenylate synthetase 1D protein_id : NP_598654.1

name	Rph3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16945962 GeneID:19894 MGI:102788
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : rabphilin 3A protein_id : NP_035416.1

name	Ptpn11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755228 GeneID:19247 MGI:99511
definition	GO_component : GO:0030054 - cell junction [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0001725 - stress fiber [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0000077 - DNA damage checkpoint [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0048011 - nerve growth factor receptor signaling pathway [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0046825 - regulation of protein export from nucleus [Evidence IMP] codon_start : 1 note : SH2 domain-containing protein tyrosine phosphatase-2 product : protein tyrosine phosphatase, non-receptor type 11 protein_id : NP_035332.1

name	LOC100039686 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254554 GeneID:100039686
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473388.1

name	Rpl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662736 CCDS:CCDS19632.1 GeneID:19988 MGI:108057
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L6 protein_id : NP_035420.2

name	EG545802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899449 GeneID:545802 MGI:3647820
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622379.2

name	AU042671 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254556 GeneID:269700 MGI:2141089
definition	codon_start : 1 product : hypothetical protein LOC269700 isoform 1 protein_id : XP_132325.9

name	Trafd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986577 GeneID:231712 MGI:1923551
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : FLN29 gene product product : TRAF type zinc finger domain containing 1 protein_id : NP_758479.1

name	C330023M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742803 CCDS:CCDS19633.1 GeneID:231713 MGI:2442563
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC231713 protein_id : NP_766310.2

name	Erp29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526463 CCDS:CCDS19634.1 GeneID:67397 MGI:1914647
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence IEA] GO_process : GO:0009306 - protein secretion [Evidence IEA] codon_start : 1 note : endoplasmic retuclum protein 29 product : endoplasmic reticulum protein ERp29 precursor protein_id : NP_080405.1

name	Tmem116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296591 CCDS:CCDS19635.1 GeneID:77462 MGI:1924712
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77462 protein_id : NP_084188.1

name	Adam1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842412 CCDS:CCDS19636.1 GeneID:280667 MGI:2429506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030881 - beta-2-microglobulin binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence NAS] [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence NAS] codon_start : 1 note : PH-30 alpha; fertilin alpha product : a disintegrin and metalloproteinase domain 1b protein_id : NP_742123.2

name	Adam1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559889 CCDS:CCDS19637.1 GeneID:280668 MGI:2429504
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS] [Evidence IEA]; GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IMP]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence NAS]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence NAS] [Evidence IEA] codon_start : 1 note : PH-30 alpha; a disintegrin and metalloproteinase domain 1a (fertilin alpha) product : a disintegrin and metalloproteinase domain 1a protein_id : NP_742124.2

name	Mapkapk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754636 GeneID:17165 MGI:1333110
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : MAP kinase-activated protein kinase 5 protein_id : NP_034895.1

name	Aldh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753036 CCDS:CCDS19638.1 GeneID:11669 MGI:99600
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004029 - aldehyde dehydrogenase (NAD) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : aldehyde dehydrogenase 2, mitochondrial protein_id : NP_033786.1

name	9330129D05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899437 GeneID:338350 MGI:2443320
definition	codon_start : 1 product : hypothetical protein LOC338350 isoform 1 protein_id : XP_488540.2

name	Acad10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794396 GeneID:71985 MGI:1919235
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase family, member 10 protein_id : NP_082313.1

name	Brap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608139 CCDS:CCDS19640.1 GeneID:72399 MGI:1919649
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008139 - nuclear localization sequence binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000165 - MAPKKK cascade [Evidence ISS]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : BRCA1 associated protein protein_id : NP_082503.2

name	Atxn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244104 GeneID:20239 MGI:1277223
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0050692 - DBD domain binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2); spinocerebellar ataxia 2 homolog product : ataxin 2 protein_id : NP_033151.2

name	Sh2b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678706 CCDS:CCDS19641.1 GeneID:16923 MGI:893598
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IDA] [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IDA] codon_start : 1 product : linker of T-cell receptor pathways protein_id : NP_032533.1

name	A230106M15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425218 CCDS:CCDS19642.1 GeneID:231717 MGI:2442708
definition	codon_start : 1 product : hypothetical protein LOC231717 protein_id : NP_780683.1

name	Cutl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789277 GeneID:13048 MGI:107321
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cut-like 2 protein_id : NP_031830.2

name	LOC100042693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254576 GeneID:100042693
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479691.1

name	Myl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657925 GeneID:17906 MGI:97272
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin light chain, phosphorylatable, cardiac ventricles; ventricular myosin regulatory light chain; myosin light chain 2v product : myosin, light polypeptide 2, regulatory, cardiac, slow protein_id : NP_034991.2

name	Ccdc63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34303985 GeneID:330188 MGI:3607777
definition	codon_start : 1 product : coiled-coil domain containing 63 protein_id : NP_899130.1

name	Oas1i (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665294
definition	number : 5 pseudo : _no_value

name	Oas1i (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665294
definition	number : 4 pseudo : _no_value

name	Oas1i (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665294
definition	number : 3 pseudo : _no_value

name	Oas1i (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665294
definition	number : 2 pseudo : _no_value

name	Oas1i (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665294
definition	number : 1 pseudo : _no_value

name	LOC665299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665299
definition	number : 2 pseudo : _no_value

name	LOC665299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665299
definition	number : 1 pseudo : _no_value

clone name	MSMg01-546L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-454B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-465F16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496A20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320H02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-057A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-500K23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-156E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339A14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-184A23.b	B6Ng01-184A23.g
ACC	GA009531	GA009532
length	1,176	1,091
definition	B6Ng01-184A23.b	B6Ng01-184A23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(121,563,763 - 121,564,942)	(121,420,578 - 121,421,665)
sequence	gaattccattaaatccccaagtccagggcttgtgacatacatagctcagt tggtacagcccagcaggcacatagcctcccatttgttcccctgtaccacc taaaaccaggtgaggtggcacatgcctaccatgccagcactcacaaggta aaggcaggaggaccaagagttcagtgtcatctctggctacttagtgagtg tgaggcccgtctgggctatggtaggccctgccacgtgcaattgagcagct tcatgagaggccagggaggatggcttcagttttgctcctgataccaaagt ttctcacctggttatatgtgtcctgaacacacacatacaggaccctgtgt agttcagagccagtccgagcctggactgccattggctgaggaagcagtcg tcagtacagtctgcccaggtggcagtgaggccggaatcctcctgcctcca cctcccaatcgctgagattgcaggcacgaagcggtccttccgccttgatt tgttgactccctccgtgactgatttagtttttctggcgtgaatcccaagc gcttgccattcagttggtatttttaggctctgtttaagaagagaaaccag aacaattttaaaaggccgaatgcaaagtgcttctctagcaggaagtgact acgcccctccggaagccagctcacctgccaaggtggccagctggggcaat tcaccgtggtcctctaagacagaaggcagtttctggtaatttcactgttg gagtggattgtgcacacagccccgtgtggaatgttatccctagaggggcc atctttcagcctgtcctttgtcctgagtcccctccaaaccacccgaggca gggcataggcctcaggttgggaaaaaactgctacacatcacattaccttg agctgagttccaaatgacatggtgccctcaggaatgtcacctgtaattac cattcccagcagaggactctggctcagcgctctctctctctctctctctc tctctctctctctctcttctcatctacccaatcatctcttctcccccaca caaccactgcatggctggaccactgaccacaggctgtgaaggcccccttg aacctccaatggtggcaaggcctgagagcctgctcctccctatcacctgt actttaattttcaacttcagtggagg	gaattcttaaccctttaaatcatgaacaatggaaaactatatctttgtgg ctttaagtcactatttttcccccttggcgttttgttgcatagcagtgaat agccggagaacctggttaaaagtagatgtttcccatctcatccaaatctg ctttgcctaatggtggaggagggcaaaccaggagcctccacattgtgccg tgagagggaatgtgtacaaatgaggcagttggataaagttcgttccaggc cattaactgtctatcctcacatcctgagcagagcagagctgggcagatgg gtagagggtacatgagcatttagacacttgtgatggagctgcgggaagac agcttgagactctgcacagccccagggctctcctgggctcttggttccaa caaaactgtcccaatgaggaagcaaaaggccctcccggggagacttgatg ctcttctccctgtgaactcagagtcagacacagatggtggcagcagcaca tggggcagattaacaaggcaggaaggagtctgctggagaggccacctgct aagcttgaactcttaaatggaagtttggggttgggggcttgcaagtgggc tcagcaggaagaggggcttgctgccaagactgatgactggagttcaatcc ccaaagccgcacagtgaaaggggaaaattggtcccccaagaattgtcctc tgatatctgtacatataccatggcatgtaaagaactttatttacaatcct gtctctctgagccttagtttctcctctgtacaatagcatccactccatag ggcagagatgaacaggactgtgttgaatcaaatgaagttctatactacag ggctcagggctggagctcaatgggtagatagcttgtacaatgcctgaagt cttgggtttcattcccagtactacaaaaactgggtgtggtgggcacatgc cttgttacccagaactcaggaagtaggggtcaagggtcagaagttcaagg tcatcctaggctacaatagcgactcaggctaactgggctacattgagaat gctgtctataggtagaataaggtaggtagctagatatgata
quality values	Open. Hide. 58 33 29 29 54 52 31 19 54 45 52 46 46 36 58 49 62 41 42 62 62 62 62 41 39 62 62 54 54 62 62 62 62 56 39 51 38 34 32 27 24 38 44 56 46 49 47 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 59 59 59 59 62 62 62 62 54 62 59 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 38 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 47 54 62 62 46 62 62 62 62 62 62 54 47 47 62 62 54 42 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 48 58 58 58 58 58 58 58 58 58 54 54 58 58 58 54 58 58 58 58 58 54 54 58 58 58 58 54 58 54 58 58 58 54 58 58 58 58 53 52 58 54 58 58 52 58 39 58 58 48 47 54 49 54 58 54 52 54 49 58 58 58 51 58 58 58 58 51 51 25 58 50 58 58 54 58 52 50 58 58 49 54 58 51 58 54 53 53 58 49 58 49 54 50 24 58 58 58 52 50 50 44 39 50 50 44 36 50 43 41 38 32 44 43 29 50 58 48 34 51 50 50 50 51 58 53 52 39 58 54 58 49 37 33 35 41 58 30 39 30 37 47 39 52 51 47 47 58 58 50 41 51 49 31 58 42 41 28 58 50 42 58 58 42 53 52 53 42 42 46 50 41 58 29 37 40 54 49 17 54 19 49 37 30 54 42 49 40 44 54 37 41 35 31 54 49 33 38 47 26 49 26 37 38 44 44 21 32 53 32 42 22 53 51 40 52 40 33 42 31 53 34 52 45 49 44 38 19 26 51 27 46 27 36 42 32 53 24 41 37 42 28 51 44 30 33 40 41 25 51 47 51 21 40 32 35 31 40 49 33 31 28 19 31 31 34 42 32 24 42 31 53 32 31 29 32 33 32 31 32 16 26 20 40 40 40 40 19 31 20 51 51 28 31 25 21 41 40 23 33 8 31 28 22 8 40 18 26 31 36 33 8 38 30 30 31 24 22 5 25 22 32 28 46 14 14 46 46 46 46 29 30 34 42 27 26 29 31 31 30 24 31 32 34 27 34 34 41 31 32 30 25 27 32 36 19 31 31 30 41 15 25 25 32 34 29 46 23 30 37 28 18 15 31 28 27 13 28 30 48 27 16 21 6 10 15 24 21 24 37 31 30 27 17 15 10 25 29 30 22 24 24 29 19 28 31 31 18 25 48 38 23 11 11 26 19 44 31 21 34 15 29 23 24 18 26 15 33 32 32 14 21 37 9 28 15 15 13 31 22 31 22 31 20 28 18 19 19 31 24 24 17 15 16 14 10 21 19 33 16 14 14 31 12 16 9 15 8 21 13 3 7 8 12 6 3 8 10 9 11 13 17 8 10 8 26 15 27 12 4 3 5 6 18 6 6 7 34 34 33 24 9 6 6 10 5 8 24 4 7 5 6 15 14 25 21 16 21 11 7 8 5 22 9 9 10 18 5 3 1 2 3 5 10 5 4 14 5 8 9 8 8 8 7 20 9 12 18 8 13 23 16 4 3 6 18 4 7 7 6 19 5 7 10 11 3 2 2 5 7 6 6 11 11 5 5 23 5 18 4 12 13 4 8 11 2 2 2 4 5 3 3 19 17 6 7 23 9 5 4 24 6 14 8 17 4 1 9 8 7 4 12 20 5 6 13 6 7 9 8 8 3 2 1 4 19 4 3 6 4	Open. Hide. 62 49 39 47 62 62 62 49 62 62 62 56 38 38 32 22 27 28 34 43 24 28 37 49 46 56 59 59 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 51 59 54 54 49 49 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 47 54 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 46 58 58 58 58 41 54 54 58 58 58 58 58 58 58 58 58 58 58 58 45 58 58 52 58 58 58 58 58 58 58 58 58 39 58 54 58 38 58 52 54 58 58 54 58 49 39 51 48 58 58 58 58 58 58 58 54 53 58 51 53 58 54 58 58 58 54 58 50 58 58 58 58 58 58 51 41 58 50 58 58 58 58 50 58 50 58 49 50 58 50 49 58 58 58 51 58 53 52 50 51 50 30 58 44 44 32 44 26 58 58 58 53 54 50 51 54 58 48 43 18 19 50 49 39 35 50 54 47 50 49 51 53 50 58 54 49 49 54 54 50 39 58 53 53 58 58 58 37 58 50 50 58 58 53 53 42 51 40 49 45 53 49 54 44 37 54 54 54 50 54 54 41 50 39 49 28 28 52 28 35 37 35 28 44 31 49 37 35 39 53 37 51 39 37 40 49 38 31 39 42 45 40 52 54 37 40 44 32 52 39 53 33 51 34 37 34 37 54 44 42 37 39 30 32 54 45 47 45 47 37 47 36 35 45 53 33 35 29 38 13 47 29 34 33 32 53 34 32 32 35 32 34 35 32 52 19 53 47 33 34 37 22 48 49 52 45 30 34 52 39 37 31 53 32 29 34 28 45 42 37 26 45 30 32 25 46 31 42 43 30 35 31 45 31 12 47 40 29 42 18 46 10 23 30 31 42 32 32 15 10 41 22 21 30 31 30 41 27 28 28 30 42 34 34 26 48 31 31 31 33 36 25 35 31 43 36 34 32 26 38 43 32 32 20 8 46 46 22 31 31 6 10 33 21 31 27 22 38 20 12 30 38 30 25 16 31 31 47 37 33 33 30 32 34 32 31 32 36 22 31 19 30 31 17 31 31 26 11 31 27 31 22 27 23 14 15 17 19 32 48 34 19 44 37 32 27 31 23 17 44 25 24 14 8 16 33 26 27 31 18 44 48 44 30 29 27 31 48 26 7 22 31 30 32 10 6 44 26 24 17 20 9 12 32 14 15 37 13 21 24 20 19 31 43 31 13 18 28 30 28 32 33 10 25 19 17 24 19 19 22 30 39 48 27 17 15 24 13 4 40 26 12 24 10 11 13 26 8 15 13 28 28 8 17 15 26 12 11 24 17 15 27 17 18 19 20 9 9 28 10 6 7 11 6 11 9 16 4 11 10 12 17 10 19 8 6 12 6 3 5 40 21 9 16 13 27 7 15 10 6 4 7 28 10 12 7 30 8 19 8 9 7 18 23 14 16 17 7 7 10 12 4 5 7 11 7 17 11 9 8 16 9 4 3 4 5 9 10 12 12 21 8 4 3 4 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_121563763_121564942
seq2: B6Ng01-184A23.b_49_1224 (reverse)

seq1  CCTCCACTGAAGTGGAAAA-TAAAGTACAGGTGATAGGGGAGAGGGGAGG  49
      ||||||||||||| ||||| |||||||||||||||||||  |||      
seq2  CCTCCACTGAAGTTGAAAATTAAAGTACAGGTGATAGGGAGGAG------  44

seq1  CCAGCCTCTAAG--CCTGCAACCA-TGGAGTGTC-AGGAGGCC-TCACAG  94
       ||| |||| ||  | ||| |||| |||||  || ||| |||| ||||||
seq2  -CAGGCTCTCAGGCCTTGCCACCATTGGAGGTTCAAGGGGGCCTTCACAG  93

seq1  CCTGGTGGCCAGTGGT-CAGCCATGCAGTGGTGGTGTGGGGGAGAAGAGG  143
      ||| |||| ||||||| ||||||||||||||| ||||||||||||||| |
seq2  CCT-GTGGTCAGTGGTCCAGCCATGCAGTGGTTGTGTGGGGGAGAAGA-G  141

seq1  ATGA-TGGGTAGATGGAGAAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAG  192
      |||| ||||||||| ||||| |||||||||||||||||||||||||||||
seq2  ATGATTGGGTAGAT-GAGAA-GAGAGAGAGAGAGAGAGAGAGAGAGAGAG  189

seq1  AGAGAGAGCGCTGAGCCAGAGTCCTCTGCTGGGAATGGTAATTACAGGTG  242
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGCGCTGAGCCAGAGTCCTCTGCTGGGAATGGTAATTACAGGTG  239

seq1  ACATTCCCTGAGGGCACCATGTCATTTGGAACTCAGCTCAAGGTAATGTG  292
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATT-CCTGAGGGCACCATGTCATTTGGAACTCAGCTCAAGGTAATGTG  288

seq1  ATGTGTAGCAGTTTTTTCCCAACCTGAGGCCTATGCCCTGCCTCGGGTGG  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGTAGCAGTTTTTTCCCAACCTGAGGCCTATGCCCTGCCTCGGGTGG  338

seq1  TTTGGAGGGGACTCAGGACAAAGGACAGGCTGAAAGATGGCCCCTCTAGG  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAGGGGACTCAGGACAAAGGACAGGCTGAAAGATGGCCCCTCTAGG  388

seq1  GATAACATTCCACACGGGGCTGTGTGCACAATCCACTCCAACAGTGAAAT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAACATTCCACACGGGGCTGTGTGCACAATCCACTCCAACAGTGAAAT  438

seq1  TACCAGAAACTGCCTTCTGTCTTAGAGGACCACGGTGAATTGCCCCAGCT  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAGAAACTGCCTTCTGTCTTAGAGGACCACGGTGAATTGCCCCAGCT  488

seq1  GGCCACCTTGGCAGGTGAGCTGGCTTCCGGAGGGGCGTAGTCACTTCCTG  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCACCTTGGCAGGTGAGCTGGCTTCCGGAGGGGCGTAGTCACTTCCTG  538

seq1  CTAGAGAAGCACTTTGCATTCGGCCTTTTAAAATTGTTCTGGTTTCTCTT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGAGAAGCACTTTGCATTCGGCCTTTTAAAATTGTTCTGGTTTCTCTT  588

seq1  CTTAAACAGAGCCTAAAAATACCAACTGAATGGCAAGCGCTTGGGATTCA  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAACAGAGCCTAAAAATACCAACTGAATGGCAAGCGCTTGGGATTCA  638

seq1  CGCCAGAAAAACTAAATCAGTCACGGAGGGAGTCAACAAATCAAGGCGGA  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCAGAAAAACTAAATCAGTCACGGAGGGAGTCAACAAATCAAGGCGGA  688

seq1  AGGACCGCTTCGTGCCTGCAATCTCAGCGATTGGGAGGTGGAGGCAGGAG  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACCGCTTCGTGCCTGCAATCTCAGCGATTGGGAGGTGGAGGCAGGAG  738

seq1  GATTCCGGCCTCACTGCCACCTGGGCAGACTGTACTGACGACTGCTTCCT  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCCGGCCTCACTGCCACCTGGGCAGACTGTACTGACGACTGCTTCCT  788

seq1  CAGCCAATGGCAGTCCAGGCTCGGACTGGCTCTGAACTACACAGGGTCCT  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAATGGCAGTCCAGGCTCGGACTGGCTCTGAACTACACAGGGTCCT  838

seq1  GTATGTGTGTGTTCAGGACACATATAACCAGGTGAGAAACTTTGGTATCA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTGTGTGTTCAGGACACATATAACCAGGTGAGAAACTTTGGTATCA  888

seq1  GGAGCAAAACTGAAGCCATCCTCCCTGGCCTCTCATGAAGCTGCTCAATT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCAAAACTGAAGCCATCCTCCCTGGCCTCTCATGAAGCTGCTCAATT  938

seq1  GCACGTGGCAGGGCCTACCATAGCCCAGACGGGCCTCACACTCACTAAGT  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACGTGGCAGGGCCTACCATAGCCCAGACGGGCCTCACACTCACTAAGT  988

seq1  AGCCAGAGATGACACTGAACTCTTGGTCCTCCTGCCTTTACCTTGTGAGT  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGAGATGACACTGAACTCTTGGTCCTCCTGCCTTTACCTTGTGAGT  1038

seq1  GCTGGCATGGTAGGCATGTGCCACCTCACCTGGTTTTAGGTGGTACAGGG  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCATGGTAGGCATGTGCCACCTCACCTGGTTTTAGGTGGTACAGGG  1088

seq1  GAACAAATGGGAGGCTATGTGCCTGCTGGGCTGTACCAACTGAGCTATGT  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAAATGGGAGGCTATGTGCCTGCTGGGCTGTACCAACTGAGCTATGT  1138

seq1  ATGTCACAAGCCCTGGACTTGGGGATTTAATGGAATTC  1180
      ||||||||||||||||||||||||||||||||||||||
seq2  ATGTCACAAGCCCTGGACTTGGGGATTTAATGGAATTC  1176

seq1: chr5_121420578_121421665
seq2: B6Ng01-184A23.g_64_1154

seq1  GAATTCTTAACCCTTTAAATCATGAACAATGGAAAACTATATCTTTGTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAACCCTTTAAATCATGAACAATGGAAAACTATATCTTTGTGG  50

seq1  CTTTAAGTCACTATTTTTCCCCCTTGGCGTTTTGTTGCATAGCAGTGAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAAGTCACTATTTTTCCCCCTTGGCGTTTTGTTGCATAGCAGTGAAT  100

seq1  AGCCGGAGAACCTGGTTAAAAGTAGATGTTTCCCATCTCATCCAAATCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGGAGAACCTGGTTAAAAGTAGATGTTTCCCATCTCATCCAAATCTG  150

seq1  CTTTGCCTAATGGTGGAGGAGGGCAAACCAGGAGCCTCCACATTGTGCCG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGCCTAATGGTGGAGGAGGGCAAACCAGGAGCCTCCACATTGTGCCG  200

seq1  TGAGAGGGAATGTGTACAAATGAGGCAGTTGGATAAAGTTCGTTCCAGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGGGAATGTGTACAAATGAGGCAGTTGGATAAAGTTCGTTCCAGGC  250

seq1  CATTAACTGTCTATCCTCACATCCTGAGCAGAGCAGAGCTGGGCAGATGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAACTGTCTATCCTCACATCCTGAGCAGAGCAGAGCTGGGCAGATGG  300

seq1  GTAGAGGGTACATGAGCATTTAGACACTTGTGATGGAGCTGCGGGAAGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAGGGTACATGAGCATTTAGACACTTGTGATGGAGCTGCGGGAAGAC  350

seq1  AGCTTGAGACTCTGCACAGCCCCAGGGCTCTCCTGGGCTCTTGGTTCCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTGAGACTCTGCACAGCCCCAGGGCTCTCCTGGGCTCTTGGTTCCAA  400

seq1  CAAAACTGTCCCAATGAGGAAGCAAAAGGCCCTCCCGGGGAGACTTGATG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACTGTCCCAATGAGGAAGCAAAAGGCCCTCCCGGGGAGACTTGATG  450

seq1  CTCTTCTCCCTGTGAACTCAGAGTCAGACACAGATGGTGGCAGCAGCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCTCCCTGTGAACTCAGAGTCAGACACAGATGGTGGCAGCAGCACA  500

seq1  TGGGGCAGATTAACAAGGCAGGAAGGAGTCTGCTGGAGAGGCCACCTGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGCAGATTAACAAGGCAGGAAGGAGTCTGCTGGAGAGGCCACCTGCT  550

seq1  AAGCTTGAACTCTTAAATGGAAGTTTGGGGTTGGGGGCTTGCAAGTGGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTTGAACTCTTAAATGGAAGTTTGGGGTTGGGGGCTTGCAAGTGGGC  600

seq1  TCAGCAGGAAGAGGGGCTTGCTGCCAAGACTGATGACTGGAGTTCAATCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGGAAGAGGGGCTTGCTGCCAAGACTGATGACTGGAGTTCAATCC  650

seq1  CCAAAGCCGCACAGTGAAAGGGGAAAATTGGTCCCCCAAGAATTGTCCTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGCCGCACAGTGAAAGGGGAAAATTGGTCCCCCAAGAATTGTCCTC  700

seq1  TGATATCTGTACATATACCATGGCATGTAAAGAACTTTATTTACAATCCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATCTGTACATATACCATGGCATGTAAAGAACTTTATTTACAATCCT  750

seq1  GTCTCTCTGAGCCTTAGTTTCTCCTCTGTACAATAGCATCCACTCCATAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCTCTGAGCCTTAGTTTCTCCTCTGTACAATAGCATCCACTCCATAG  800

seq1  GGCAGAGATGAACAGGACTGTGTTGAATCAAATGAAGTTCTATACTACAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGAGATGAACAGGACTGTGTTGAATCAAATGAAGTTCTATACTACAG  850

seq1  GGCTCAGGGCTGGAGCTCAATGGGTAGATAGCTTGTACAATGCCTGAAGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCAGGGCTGGAGCTCAATGGGTAGATAGCTTGTACAATGCCTGAAGT  900

seq1  CTTGGGTTTCATTCCCAGTACTACAAAAACTGGGTGTGGT-GGCACATG-  948
      |||||||||||||||||||||||||||||||||||||||| |||||||| 
seq2  CTTGGGTTTCATTCCCAGTACTACAAAAACTGGGTGTGGTGGGCACATGC  950

seq1  CTTGTTACCCCAGAACTCAGGAAGTAGGGGTCAAAGGGTCAGAAGTTCAA  998
      ||||||| |||||||||||||||||||||||| |||||||||||||||||
seq2  CTTGTTA-CCCAGAACTCAGGAAGTAGGGGTC-AAGGGTCAGAAGTTCAA  998

seq1  GGTCATCCTAGGCTAC-ATAGCGAACTTCAGGCTAACCTGGGCTACA-TG  1046
      |||||||||||||||| |||||||   ||||||||| |||||||||| ||
seq2  GGTCATCCTAGGCTACAATAGCGA--CTCAGGCTAA-CTGGGCTACATTG  1045

seq1  AG-ATGCTGTCTATAGGTAGA--TAGGTAGGTAGGTAGATA-GATA  1088
      || ||||||||||||||||||   |||||||||| |||||| ||||
seq2  AGAATGCTGTCTATAGGTAGAATAAGGTAGGTAGCTAGATATGATA  1091

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information