MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-188D11
Chromosome	5 (Build37)
Map Location	31,298,333 - 31,496,616
singlet/doublet	doublet
Overlap gene	Slc5a6, 0610007C21Rik, Cad, Slc30a3, Dnajc5g, Trim54, Ucn, Mpv17, Gtf3c2, Eif2b4, Snx17
Upstream gene	LOC100039369, Il6, Tyms, EG242914, Gm444, Hadha, Hadhb, Gpr113, EG384325, D5Wsu178e, Gm1060, Otof, 1700001C02Rik, 1700041E20Rik, Kcnk3, 4930471M23Rik, Cenpa, Dpysl5, Mapre3, 1110039B18Rik, 9430057O19Rik, 2310016E02Rik, Emilin1, Khk, Cgref1, Abhd1, Preb, Tcf23
Downstream gene	Zfp513, Ppm1g, ENSMUSG00000055424, Nrbp1, Krtcap3, Ift172, Fndc4, Gckr, Zfp512, 4930548H24Rik, Xab1, Supt7l, Slc4a1ap, Mrpl33, Rbks, LOC100040000, Bre, Fosl2, LOC672217
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039369 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Il6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16193 MGI:96559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyms (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22171 MGI:98878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG242914 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242914 MGI:3645260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 8 Proteins

name	Gm444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242915 MGI:2685290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 7 Proteins

name	Hadha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97212 MGI:2135593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hadhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231086 MGI:2136381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381628 MGI:2685887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384325 MGI:3645309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 4 Proteins

name	D5Wsu178e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28042 MGI:107898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1060 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381738 MGI:2685906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otof (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83762 MGI:1891247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700001C02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75434 MGI:1922684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73259 MGI:1920509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 5 Proteins

name	Kcnk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16527 MGI:1100509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930471M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74919 MGI:1922169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12615 MGI:88375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpysl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65254 MGI:1929772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapre3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100732 MGI:2140967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110039B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68796 MGI:1916046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430057O19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231093 MGI:2441745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2310016E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67695 MGI:1914945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emilin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100952 MGI:1926189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Khk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16548 MGI:1096353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cgref1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68567 MGI:1915817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 64 ESTs, 4 Proteins

name	Abhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57742 MGI:1931013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Preb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50907 MGI:1355326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69852 MGI:1934960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330064 MGI:2660847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610007C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381629 MGI:1918918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69719 MGI:1916969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc30a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22784 MGI:1345280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc5g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231098 MGI:3045263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58522 MGI:1889623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22226 MGI:1276123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpv17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17527 MGI:97138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf3c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71752 MGI:1919002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13667 MGI:95300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266781 MGI:2387801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101023 MGI:2141255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppm1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14208 MGI:106065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000055424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621407 MGI:3642876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Nrbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192292 MGI:2183436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtcap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69815 MGI:1917065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ift172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67661 MGI:2682064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fndc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64339 MGI:1917195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gckr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231103 MGI:1096345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269639 MGI:1917345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930548H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67656 MGI:1914906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74254 MGI:1921504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72195 MGI:1919445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a1ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20534 MGI:1196608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66845 MGI:2137225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbks (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71336 MGI:1918586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Bre (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Fosl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14284 MGI:102858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039369 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253827 GeneID:100039369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039369 transcript_id : XM_001472770.1

name	Il6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13624310 GeneID:16193 MGI:96559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 6 transcript_id : NM_031168.1

name	Tyms (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347432 GeneID:22171 MGI:98878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymidylate synthase transcript_id : NM_021288.3

name	Gm444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374640 GeneID:242915 MGI:2685290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 7 Proteins product : gene model 444, (NCBI) transcript_id : XM_144253.6

name	Hadha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357440 GeneID:97212 MGI:2135593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit transcript_id : NM_178878.2

name	Hadhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704099 GeneID:231086 MGI:2136381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit transcript_id : NM_145558.1

name	Gpr113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117553628 GeneID:381628 MGI:2685887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 113 transcript_id : NM_001014394.2

name	EG384325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253831 GeneID:384325 MGI:3645309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 4 Proteins product : predicted gene, EG384325 transcript_id : XM_357571.5

name	D5Wsu178e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111119004 GeneID:28042 MGI:107898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, Wayne State University 178, expressed transcript_id : NM_027652.2

name	Gm1060 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352196 GeneID:381738 MGI:2685906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1060, (NCBI) transcript_id : NM_001033460.2

name	Otof (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994206 GeneID:83762 MGI:1891247
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otoferlin transcript_id : NM_031875.1

name	1700001C02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729772 GeneID:75434 MGI:1922684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001C02 gene transcript_id : NM_029285.1

name	1700041E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374643 GeneID:73259 MGI:1920509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 5 Proteins product : RIKEN cDNA 1700041E20 gene transcript_id : XM_131990.3

name	Kcnk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014691 GeneID:16527 MGI:1100509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 3 transcript_id : NM_010608.2

name	4930471M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801901 GeneID:74919 MGI:1922169
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930471M23 gene transcript_id : NM_175675.2

name	Cenpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131195 GeneID:12615 MGI:88375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein A transcript_id : NM_007681.2

name	Dpysl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789287 GeneID:65254 MGI:1929772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydropyrimidinase-like 5 transcript_id : NM_023047.2

name	Mapre3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930508 GeneID:100732 MGI:2140967
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein, RP/EB family, member 3 transcript_id : NM_133350.1

name	1110039B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353473 GeneID:68796 MGI:1916046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110039B18 gene transcript_id : NM_144525.3

name	9430057O19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124028513 GeneID:231093 MGI:2441745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430057O19 gene transcript_id : NM_174849.3

name	9430057O19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119943146 GeneID:231093 MGI:2441745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430057O19 gene transcript_id : NM_001048192.2

name	2310016E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378004 GeneID:67695 MGI:1914945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310016E02 gene transcript_id : NM_024460.3

name	Emilin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129794 GeneID:100952 MGI:1926189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastin microfibril interfacer 1 transcript_id : NM_133918.2

name	Khk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130797 GeneID:16548 MGI:1096353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ketohexokinase transcript_id : NM_008439.3

name	Cgref1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253837 GeneID:68567 MGI:1915817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 63 ESTs, 4 Proteins product : cell growth regulator with EF hand domain 1 transcript_id : XM_181420.6

name	Abhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253834 GeneID:57742 MGI:1931013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 1 transcript_id : XR_035744.1

name	Preb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710083 GeneID:50907 MGI:1355326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin regulatory element binding transcript_id : NM_016703.1

name	Tcf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131202 GeneID:69852 MGI:1934960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 23 transcript_id : NM_053085.2

name	Slc5a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802749 GeneID:330064 MGI:2660847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium-dependent vitamin transporter), member 6 transcript_id : NM_177870.4

name	0610007C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57526830 GeneID:381629 MGI:1918918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610007C21 gene transcript_id : NM_212470.2

name	0610007C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087145 GeneID:381629 MGI:1918918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610007C21 gene transcript_id : NM_027855.2

name	Cad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51093866 GeneID:69719 MGI:1916969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase transcript_id : NM_023525.1

name	Slc30a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130059 GeneID:22784 MGI:1345280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 3 transcript_id : NM_011773.2

name	Dnajc5g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364807 GeneID:231098 MGI:3045263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 5 gamma transcript_id : NM_177677.3

name	Trim54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946823 GeneID:58522 MGI:1889623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 54 transcript_id : NM_021447.1

name	Ucn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12025527 GeneID:22226 MGI:1276123
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocortin transcript_id : NM_021290.1

name	Mpv17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802117 GeneID:17527 MGI:97138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mpv17 transgene, kidney disease mutant transcript_id : NM_008622.2

name	Gtf3c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861228 GeneID:71752 MGI:1919002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIIC, polypeptide 2, beta transcript_id : NM_027901.2

name	Eif2b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753735 GeneID:13667 MGI:95300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2B, subunit 4 delta transcript_id : NM_010122.1

name	Snx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130070 GeneID:266781 MGI:2387801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 17 transcript_id : NM_153680.2

name	Zfp513 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254295 GeneID:101023 MGI:2141255
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 513 transcript_id : NM_175311.3

name	Ppm1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131027 GeneID:14208 MGI:106065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform transcript_id : NM_008014.3

name	ENSMUSG00000055424 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253835 GeneID:621407 MGI:3642876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, ENSMUSG00000055424 transcript_id : XM_001473162.1

name	Nrbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892152 GeneID:192292 MGI:2183436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor binding protein 1 transcript_id : NM_147201.2

name	Krtcap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359753 GeneID:69815 MGI:1917065
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratinocyte associated protein 3 transcript_id : NM_027221.2

name	Ift172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358418 GeneID:67661 MGI:2682064
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 172 homolog (Chlamydomonas) transcript_id : NM_026298.4

name	Fndc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373155 GeneID:64339 MGI:1917195
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 4 transcript_id : NM_022424.4

name	Gckr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450292 GeneID:231103 MGI:1096345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucokinase regulatory protein transcript_id : NM_144909.1

name	Zfp512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141800992 GeneID:269639 MGI:1917345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 512 transcript_id : NM_172993.2

name	4930548H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346424 GeneID:67656 MGI:1914906
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930548H24 gene transcript_id : NM_026296.2

name	Xab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377911 GeneID:74254 MGI:1921504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : XPA binding protein 1 transcript_id : NM_133756.3

name	Supt7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037284 GeneID:72195 MGI:1919445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 7 (S. cerevisiae)-like transcript_id : NM_028150.1

name	Slc4a1ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469098 GeneID:20534 MGI:1196608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 1, adaptor protein transcript_id : NM_009206.1

name	Mrpl33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375920 GeneID:66845 MGI:2137225
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L33 transcript_id : NM_025796.2

name	Rbks (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23397418 GeneID:71336 MGI:1918586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribokinase transcript_id : NM_153196.1

name	LOC100040000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253838 GeneID:100040000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040000 transcript_id : XM_001474287.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21617850 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_144541.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281923 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181279.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281939 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181280.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281944 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181282.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281929 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181281.1

name	Fosl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789304 GeneID:14284 MGI:102858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fos-like antigen 2 transcript_id : NM_008037.3

name	LOC100039369 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253828 GeneID:100039369
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472820.1

name	Il6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624311 CCDS:CCDS19153.1 GeneID:16193 MGI:96559
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005138 - interleukin-6 receptor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045079 - negative regulation of chemokine biosynthesis [Evidence IMP] [Evidence IDA]; GO:0001781 - neutrophil apoptosis [Evidence IDA] [Evidence IMP] codon_start : 1 product : interleukin 6 protein_id : NP_112445.1

name	Tyms (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358062 CCDS:CCDS19154.1 GeneID:22171 MGI:98878
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0004799 - thymidylate synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006231 - dTMP biosynthesis [Evidence IEA]; GO:0009165 - nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : thymidylate synthase protein_id : NP_067263.1

name	Gm444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897249 GeneID:242915 MGI:2685290
definition	codon_start : 1 product : similar to Gm444 protein protein_id : XP_144253.5

name	Hadha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859811 CCDS:CCDS19155.1 GeneID:97212 MGI:2135593
definition	GO_component : GO:0016507 - fatty acid beta-oxidation multienzyme complex [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence IEA]; GO:0004300 - enoyl-CoA hydratase activity [Evidence TAS]; GO:0016509 - long-chain-3-hydroxyacyl-CoA dehydrogenase activity [Evidence TAS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006635 - fatty acid beta-oxidation [Evidence IMP]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : mitochondrial trifunctional protein, alpha subunit protein_id : NP_849209.1

name	Hadhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704100 GeneID:231086 MGI:2136381
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0003985 - acetyl-CoA C-acetyltransferase activity [Evidence TAS] GO_process : GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta aubunit; hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit product : mitochondrial trifunctional protein, beta subunit protein_id : NP_663533.1

name	Gpr113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117553629 GeneID:381628 MGI:2685887
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 113 protein_id : NP_001014416.2

name	EG384325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253832 GeneID:384325 MGI:3645309
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 protein_id : XP_357571.4

name	D5Wsu178e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111119005 GeneID:28042 MGI:107898
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008430 - selenium binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : selenoprotein I protein_id : NP_081928.2 transl_except : (pos:30593510..30593512,aa:Sec)

name	Gm1060 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701985 GeneID:381738 MGI:2685906
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC381738 protein_id : NP_001028632.1

name	Otof (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994207 CCDS:CCDS19157.1 GeneID:83762 MGI:1891247
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : otoferlin protein_id : NP_114081.1

name	1700001C02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729773 CCDS:CCDS19158.1 GeneID:75434 MGI:1922684
definition	codon_start : 1 product : hypothetical protein LOC75434 protein_id : NP_083561.1

name	1700041E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20825123 GeneID:73259 MGI:1920509
definition	codon_start : 1 product : hypothetical protein LOC73259 protein_id : XP_131990.1

name	Kcnk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859576 CCDS:CCDS19160.1 GeneID:16527 MGI:1100509
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium channel, subfamily K, member 3 protein_id : NP_034738.1

name	4930471M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563309 CCDS:CCDS19161.1 GeneID:74919 MGI:1922169
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74919 protein_id : NP_783606.1

name	Cenpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680920 CCDS:CCDS19162.1 GeneID:12615 MGI:88375
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence ISS] [Evidence IEA]; GO:0000939 - inner kinetochore of condensed chromosome [Evidence IDA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : centrosomin A product : centromere autoantigen A protein_id : NP_031707.1

name	Dpysl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746424 GeneID:65254 MGI:1929772
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IPI]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007411 - axon guidance [Evidence TAS] codon_start : 1 note : collapsin response mediator protein 5 product : dihydropyrimidinase-like 5 protein_id : NP_075534.1

name	Mapre3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930509 CCDS:CCDS19163.1 GeneID:100732 MGI:2140967
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : APC-binding protein EB2 protein_id : NP_579928.1

name	1110039B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559970 CCDS:CCDS19164.1 GeneID:68796 MGI:1916046
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68796 protein_id : NP_653108.2

name	9430057O19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796664 GeneID:231093 MGI:2441745
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; carboxypeptidase 5, cytosolic product : carboxypeptidase 5, cytosolic isoform 3 protein_id : NP_001041657.1

name	9430057O19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424675 CCDS:CCDS19165.1 GeneID:231093 MGI:2441745
definition	GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; carboxypeptidase 5, cytosolic product : carboxypeptidase 5, cytosolic isoform 5 protein_id : NP_777274.1

name	2310016E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378005 GeneID:67695 MGI:1914945
definition	codon_start : 1 product : hypothetical protein LOC67695 protein_id : NP_077780.3

name	Emilin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527130 CCDS:CCDS19167.1 GeneID:100952 MGI:1926189
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0030023 - extracellular matrix constituent conferring elasticity [Evidence IMP]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : elastin microfibril interface located protein 1 product : elastin microfibril interfacer 1 protein_id : NP_598679.1

name	Khk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982229 GeneID:16548 MGI:1096353
definition	GO_function : GO:0004454 - ketohexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : ketohexokinase protein_id : NP_032465.2

name	Cgref1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23625083 GeneID:68567 MGI:1915817
definition	codon_start : 1 product : cell growth regulator with EF hand domain 1 protein_id : XP_181420.1

name	Preb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710084 GeneID:50907 MGI:1355326
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : prolactin regulatory element binding protein protein_id : NP_057912.1

name	Tcf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716369 CCDS:CCDS19168.1 GeneID:69852 MGI:1934960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : basic helix-loop-helix transcription factor OUT product : transcription factor 23 protein_id : NP_444315.1

name	Slc5a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244474 CCDS:CCDS19169.1 GeneID:330064 MGI:2660847
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 5 (sodium-dependent vitamin transporter), member 6 protein_id : NP_808538.1

name	0610007C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47087146 CCDS:CCDS19170.1 GeneID:381629 MGI:1918918
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; apoptosis related protein APR-3 product : apoptosis related protein APR-3 isoform 1 protein_id : NP_082131.2

name	0610007C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058968 GeneID:381629 MGI:1918918
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; apoptosis related protein APR-3 product : apoptosis related protein APR-3 isoform 2 protein_id : NP_997635.1

name	Cad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51093867 CCDS:CCDS19171.1 GeneID:69719 MGI:1916969
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0004070 - aspartate carbamoyltransferase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004086 - carbamoyl-phosphate synthase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016812 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence IEA]; GO:0006807 - nitrogen compound metabolism [Evidence IEA]; GO:0006221 - pyrimidine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase protein_id : NP_076014.1

name	Slc30a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755552 GeneID:22784 MGI:1345280
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : zinc transporter 3 product : solute carrier family 30 (zinc transporter), member 3 protein_id : NP_035903.1

name	Dnajc5g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244106 CCDS:CCDS19172.1 GeneID:231098 MGI:3045263
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily C, member 5 gamma protein_id : NP_808345.1

name	Trim54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946824 CCDS:CCDS19173.1 GeneID:58522 MGI:1889623
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA] codon_start : 1 note : muscle-specific RING-finger protein; ring finger protein 30 product : tripartite motif-containing 54 protein_id : NP_067422.1

name	Ucn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025528 CCDS:CCDS19174.1 GeneID:22226 MGI:1276123
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : urocortin protein_id : NP_067265.1

name	Mpv17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678926 CCDS:CCDS19175.1 GeneID:17527 MGI:97138
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IMP] [Evidence ISS]; GO:0005777 - peroxisome [Evidence IDA] GO_process : GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence IDA]; GO:0007605 - sensory perception of sound [Evidence IMP] [Evidence IEA] codon_start : 1 product : Mpv17 transgene, kidney disease mutant protein_id : NP_032648.1

name	Gtf3c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861229 GeneID:71752 MGI:1919002
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TFIIIC-BETA product : general transcription factor IIIC, polypeptide 2, beta protein_id : NP_082177.2

name	Eif2b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753736 CCDS:CCDS19176.1 GeneID:13667 MGI:95300
definition	GO_component : GO:0005851 - eukaryotic translation initiation factor 2B complex [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0044249 - cellular biosynthesis [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : eukaryotic translation initiation factor 2B, subunit 4 delta protein_id : NP_034252.1

name	Snx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24211031 CCDS:CCDS19177.1 GeneID:266781 MGI:2387801
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005768 - endosome [Evidence IPI] GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 17 protein_id : NP_710147.1

name	Zfp513 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254296 CCDS:CCDS19178.1 GeneID:101023 MGI:2141255
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 513 protein_id : NP_780520.2

name	Ppm1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679793 CCDS:CCDS19179.1 GeneID:14208 MGI:106065
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 note : fibroblast growth factor inducible 13 product : protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform protein_id : NP_032040.1

name	ENSMUSG00000055424 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253836 GeneID:621407 MGI:3642876
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473212.1

name	Nrbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22219434 CCDS:CCDS19180.1 GeneID:192292 MGI:2183436
definition	GO_component : GO:0012505 - endomembrane system [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004672 - protein kinase activity [Evidence IDA] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS]; GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : HLS7-interacting protein kinase product : nuclear receptor binding protein protein_id : NP_671734.1

name	Krtcap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312434 GeneID:69815 MGI:1917065
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratinocytes associated protein 3 protein_id : NP_081497.1

name	Ift172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358419 GeneID:67661 MGI:2682064
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IGI] [Evidence IMP]; GO:0001841 - neural tube formation [Evidence IMP]; GO:0015671 - oxygen transport [Evidence IEA]; GO:0016485 - protein processing [Evidence IMP]; GO:0007224 - smoothened signaling pathway [Evidence IGI] codon_start : 1 exception : mismatches in translation note : selective LIM-binding factor Wimple product : intraflagellar transport 172 protein protein_id : NP_080574.4

name	Fndc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921579 CCDS:CCDS19181.1 GeneID:64339 MGI:1917195
definition	codon_start : 1 note : fibronectin type III repeat containing protein 1 product : fibronectin type III domain containing 4 protein_id : NP_071869.2

name	Gckr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450293 CCDS:CCDS19182.1 GeneID:231103 MGI:1096345
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0000060 - protein import into nucleus, translocation [Evidence IMP] codon_start : 1 product : glucokinase regulatory protein protein_id : NP_659158.1

name	Zfp512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370500 CCDS:CCDS19183.1 GeneID:269639 MGI:1917345
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 512 protein_id : NP_766581.1

name	4930548H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312838 CCDS:CCDS19184.1 GeneID:67656 MGI:1914906
definition	codon_start : 1 product : hypothetical protein LOC67656 protein_id : NP_080572.1

name	Xab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526970 CCDS:CCDS19185.1 GeneID:74254 MGI:1921504
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : methyl-CpG binding domain protein 2 interacting protein product : XPA binding protein 1 protein_id : NP_598517.1

name	Supt7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037285 CCDS:CCDS19186.1 GeneID:72195 MGI:1919445
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SPTF-associated factor 65 gamma protein_id : NP_082426.1

name	Slc4a1ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469099 GeneID:20534 MGI:1196608
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : solute carrier family 4 (anion exchanger), member 1, adapter protein product : solute carrier family 4 (anion exchanger), member 1, adaptor protein protein_id : NP_033232.1

name	Mrpl33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385266 GeneID:66845 MGI:2137225
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein L33 protein_id : NP_080072.1

name	Rbks (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23397419 CCDS:CCDS19187.1 GeneID:71336 MGI:1918586
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ribokinase protein_id : NP_694876.1

name	LOC100040000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253839 GeneID:100040000
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474337.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21617851 CCDS:CCDS19188.1 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform V is encoded by transcript variant 5 product : brain and reproductive organ-expressed protein isoform V protein_id : NP_653124.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281924 CCDS:CCDS19189.1 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform I is encoded by transcript variant 1 product : brain and reproductive organ-expressed protein isoform I protein_id : NP_851796.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281940 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform IV is encoded by transcript variant 4 product : brain and reproductive organ-expressed protein isoform IV protein_id : NP_851797.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281930 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform III is encoded by transcript variant 3 product : brain and reproductive organ-expressed protein isoform III protein_id : NP_851798.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281945 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform II is encoded by transcript variant 2 product : brain and reproductive organ-expressed protein isoform II protein_id : NP_851799.1

name	Fosl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328117 CCDS:CCDS19190.1 GeneID:14284 MGI:102858
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : fos-like antigen 2 protein_id : NP_032063.2

name	LOC672217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672217
definition	number : 1 pseudo : _no_value

name	EG242914 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253830 GeneID:242914 MGI:3645260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 8 Proteins product : predicted gene, EG242914 transcript_id : XR_001540.2

clone name	MSMg01-496J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-322C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122F05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-103F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-188D11.b	B6Ng01-188D11.g
ACC	GA012578	GA012579
length	1,005	1,082
definition	B6Ng01-188D11.b	B6Ng01-188D11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(31,495,606 - 31,496,616)	(31,298,333 - 31,299,415)
sequence	gaattcccaagttatagtttaggtgccagaaggaatgtgctttgactaac agggttcagtttttccatgcaggggcaaaggatgaaaaaggagacagctc agagaaggaaggatgtgtgagtatagggaagtacaggaactgtgagagac aagccgctcagagagtttccggaaatgtcacgctaacaaagtccaccttc cactgtagcagtgattatagggtgatgtaatgaaaggggattaatgtccg tgggtatggaagggcttgaagctgcatctagacagggttgttagtcccac ctgctcgtgcagccccagaagctggctgtagcgcacccgacagtgcagga ctccattcacgtgaatgttataggcctgaggacacaaaagcaggcaaaca tctcaggatcgacgtgcaaaccacctcttgccccagaaacctgtccggaa gttgcctgacatatccgtctgcgcaacgctccgagacttcccgggattta gcctgtttttcccccagggccgggtttcaagcagaaggcccagtcccgag gacactcgggcgcttgtgcggcagtatccctcccggagatgacaatagtg cccaccgccagagcagtcgcggcctggccggggaaagaagaacctattgg agcttggggtggcttaagtacgaaactgagacatgagatggcttccagtg aggttcgaaggctggaggcgctccgagagctcggcccgttatcccggcct gggcccagctttctagcacctcctcaccacgtaggcgggagccgccgctg tccccactggcgggactccgtttcaggaatggaaaagtgcatgttcttaa ggcagagctccgtaactacaaggtccgagcgcctctgtcgcttgccttgg ccatctagccggtctcccagccagctgcaatttgtggcctgaactccaaa ggtgggaaggcgttgaagtatacggctctgcagcagcaacctcgcatgtc tggga	gaattccattttctgagggggtgagtgagcagagatgggtatatgaatat gatgcacagtattccttttagaaaacatttatgtatctatatagtgtgtt tgcatatgtttgtgggtacacatgccagagatcagaggacaacttgtgga agttggttctcttcttccataagcagattccaggaactgaacacaggttc tctggcttcgtggcaattgttctttccagctgaaaagtctcctgtgtccc tggcctgggatacacagtgttctactgaatggatgtaccacagcttatac gccagggctggagactaagagctttcactcttccaggggacttggatttg gctccctacacccaccttgggtgacttccaaccttctggaaccaggagaa ctgaagccctcttctggcctccatgggctcctgcatacatttgatataca taactgacacgtatgacctttattgacagcacttggaaagcacatctctg tgagttcaaaactagcctggtctacagagtgagtactaggacagctagga gtacacagagaagccctatctcaaacaaaacacaacacaacaaaacaaaa acaaaaacaaaaagaacacataaaacccagaaacaaataaataaaaataa tttttaaaaaagcttattagccaattcttattggcagtctagaggatatt gatagaacctagtagggaaacccccactcaattcccaattctgtgggcac ccaaaaaaaatcacgaaggaccatcttgatgtaattacatgaggacgttt aatgacgtagctccggaccgacatgcatcccacacaggagataacggatg tcggccatgaggctcggaagctaggggtttttatggggtgaggggcttag gggtgtggaattcagccataccgacacactattggcttattcaaccatca agcagaaaaattacatgtacgtgcatgggtgtcagagttctgtgagtggt gactcagttcaggatagccctgctattgtctcacagtcccctttatctat ggtcaagatgctccaggatgttcaacaacagg
quality values	Open. Hide. 58 41 30 42 62 62 62 38 26 47 62 62 62 56 47 47 47 62 62 51 47 62 49 54 49 62 47 44 62 62 62 62 59 51 35 15 29 24 29 32 46 34 49 62 59 59 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 54 62 56 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 49 43 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 46 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 62 62 62 62 62 62 62 48 62 47 45 58 58 58 40 58 58 54 49 58 58 58 58 58 54 41 58 54 58 54 54 58 54 58 44 58 58 58 42 23 58 54 46 52 54 54 58 58 58 54 58 54 45 58 58 54 58 58 54 54 58 58 58 54 54 35 58 58 54 58 58 46 48 49 58 51 58 50 49 41 58 58 53 51 58 58 58 58 58 54 58 58 58 51 42 46 58 58 39 43 43 58 53 49 30 37 27 43 43 44 35 54 49 53 40 49 40 51 51 27 35 51 49 41 51 58 50 53 52 53 54 50 40 50 26 24 41 37 52 51 40 49 29 47 39 35 33 51 58 30 44 58 50 58 51 38 30 54 47 42 34 50 49 37 54 32 54 54 54 36 31 44 39 42 34 32 25 49 54 25 44 40 54 47 42 54 33 37 33 31 42 42 40 18 51 53 26 33 8 54 33 31 33 31 37 40 25 25 53 21 51 30 21 31 30 52 37 27 46 34 45 32 32 24 45 47 25 32 26 33 29 10 32 32 31 30 32 31 53 35 53 34 53 32 31 35 39 18 33 18 31 31 17 31 23 31 31 31 31 33 19 32 22 23 14 32 31 17 31 30 32 51 18 31 36 27 31 32 32 31 33 17 12 18 34 17 14 7 22 21 46 46 26 30 46 31 22 32 33 12 33 21 22 22 31 32 22 37 18 25 19 13 25 14 38 37 48 46 31 18 30 33 21 31 33 14 36 32 32 21 31 19 44 48 31 30 33 31 31 12 26 28 21 31 31 32 14 16 14 42 21 25 33 15 21 25 35 33 24 30 22 14 34 32 23 32 21 33 27 20 29 18 34 21 25 32 16 11 29 7 17 31 12 28 22 37 13 31 15 26 25 12 5 12 11 44 21 21 27 27 13 11 31 41 35 7 8 22 31 18 22 44 18 21 44 21 32 14 28 25 37 10 14 20 33 19 13 17 18 26 31 20 15 15 7 9 21 9 17 12 17 28 20 20 6 6 14 31 11 22 13 32 20 11 20 18 11 17 27 8 4 7 31 39 15 18 14 21 22 9 6 16 39 12 8 6 21 19 21 5 19 22 21 16 6 8 9 18 28 17 13 13 22 21 28 18 6 6 19 14 5 6 17 9 8 4 3 7 25 6 9 8 7 6 5 8 5 10 20 13 27 19 10 7 6 6 26 18 26 9 7 6 6 28 4 7 5 13 5 6 7 21 13 6 5 12 8 3 4 5 4 5 9 12 13 6 20 20 16 11 28 10 6 4 11 8 18 5 4 5 7 7 9 4 10 4 16 6 5 4 12 14 7 7 7 6 4 7 5 7 20 28 4 15 9 22 19 4 8 16 8 15 23 10 9 10 20 5 8 5 4 7 4 7 7 7 7 13 4 18 6 6 20 21 7 5 5 7 6 7 5 9 6 7 9 5 13 6 8 5 2 2 5 7 12 7 5 12 12 5 19 9 10 13 4 7 4 6 7 5 8 9 25 20 7	Open. Hide. 62 47 51 47 62 62 44 37 62 62 62 45 41 23 24 32 23 34 38 38 37 33 49 38 56 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 59 49 50 40 48 56 56 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 52 52 43 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 54 52 62 62 62 62 62 62 52 62 41 54 49 62 62 54 49 49 58 58 44 54 58 58 58 58 58 54 58 52 54 54 58 58 33 52 52 52 52 52 52 52 52 54 48 54 52 52 54 52 52 52 41 54 35 52 52 41 41 47 34 42 47 52 52 54 46 52 58 52 52 52 54 52 52 52 52 52 54 50 54 52 52 52 52 31 48 42 58 58 49 51 50 58 58 50 46 58 37 41 50 58 58 58 37 37 47 48 50 58 58 58 49 41 58 58 58 58 58 52 52 58 51 47 37 33 50 46 53 47 27 51 32 58 48 50 37 50 41 50 51 37 35 49 39 41 50 52 50 40 54 46 58 32 19 50 33 58 58 48 37 53 32 54 52 50 50 50 51 39 53 53 39 58 40 41 58 24 24 38 23 41 41 23 24 49 37 31 46 43 50 40 14 26 19 50 51 54 40 35 54 39 46 54 54 45 32 50 44 40 25 54 54 54 54 54 54 40 39 40 40 41 31 53 53 12 54 41 28 38 26 52 37 46 34 45 35 29 42 31 13 32 37 53 29 52 24 34 52 47 16 47 45 32 25 41 54 30 28 42 37 47 30 27 21 32 32 20 52 41 29 46 31 40 36 19 34 21 35 29 18 31 31 31 25 32 40 53 31 33 32 31 31 33 22 33 33 20 31 21 51 31 34 24 29 30 24 38 34 36 22 32 33 39 28 24 30 46 18 28 26 38 30 26 9 30 33 30 31 36 31 18 47 47 42 32 48 46 46 31 29 31 29 46 46 41 21 32 33 26 46 46 33 29 30 34 29 7 47 48 38 24 31 24 26 19 23 24 24 32 22 16 14 12 21 14 27 30 8 9 10 25 31 10 30 17 26 14 11 5 9 8 14 21 24 31 33 33 24 24 6 29 7 14 10 34 18 6 16 11 32 20 16 38 38 38 44 6 10 17 12 23 11 11 16 12 11 33 21 21 25 16 18 12 29 41 19 6 9 18 21 7 5 20 6 22 28 22 7 21 25 20 22 5 24 8 16 31 19 9 5 12 8 8 13 14 21 7 5 5 5 19 7 7 8 25 31 28 21 15 10 13 10 17 7 11 12 6 11 11 5 7 18 6 6 8 8 28 13 18 30 18 17 6 11 30 11 12 13 22 7 21 14 8 10 26 5 4 7 19 11 4 7 18 10 7 6 17 6 7 3 8 4 7 26 13 9 4 3 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_31495606_31496616
seq2: B6Ng01-188D11.b_49_1053 (reverse)

seq1  TCCCAG-CATGCCGAGGTTGCTGCTCGCAGAGCCGTCATCCTACA--GCC  47
      |||||| |||| ||||||||||||| |||||||||| || || ||  |||
seq2  TCCCAGACATG-CGAGGTTGCTGCT-GCAGAGCCGT-ATACTTCAACGCC  47

seq1  TTCCCACC-TCGGAGTTCAGGCCCACCAAAATGGCGAGCTGGGCTGCGGA  96
      |||||||| | |||||||||| ||||  |||| || |||| ||||| |||
seq2  TTCCCACCTTTGGAGTTCAGG-CCAC--AAATTGC-AGCT-GGCTG-GGA  91

seq1  GACGCGCTGAGTGGCAGAGGCAAGCGAGCAGAGGCGCTGCGAACCTGGTA  146
      |||  |||   ||||  |||||||||| |||||||||| || |||| |||
seq2  GACCGGCTAGATGGCCAAGGCAAGCGA-CAGAGGCGCT-CGGACCTTGTA  139

seq1  G-TACGGAGCTCTGCCTTAGGGAACATGCACTTTTCCATTCCTGAAACGG  195
      | |||||||||||||||||  |||||||||||||||||||||||||||||
seq2  GTTACGGAGCTCTGCCTTA-AGAACATGCACTTTTCCATTCCTGAAACGG  188

seq1  AGTCCCG-CAGTGGGGACAGCGGCGGCT-CCGCCTACGTGGTGAGGAGGT  243
      ||||||| |||||||||||||||||||| |||||||||||||||||||||
seq2  AGTCCCGCCAGTGGGGACAGCGGCGGCTCCCGCCTACGTGGTGAGGAGGT  238

seq1  GCTAG-AAGCTGGGCCAGGGCGGGGATAACGGGCCGGAGCTCTCGGAGCG  292
      ||||| ||||||||||  ||| ||||||||||||| ||||||||||||| 
seq2  GCTAGAAAGCTGGGCCCAGGCCGGGATAACGGGCC-GAGCTCTCGGAGC-  286

seq1  GCCTCCAGCCTTCGAACCTCACTGGAAGCCATCTCATGTCTCAGTTTCGT  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCAGCCTTCGAACCTCACTGGAAGCCATCTCATGTCTCAGTTTCGT  336

seq1  ACTTAAGCCACCCCAAGCTCCAATAGGTTCTTCTTTCCCCGGCCAGGCCG  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAGCCACCCCAAGCTCCAATAGGTTCTTCTTTCCCCGGCCAGGCCG  386

seq1  CGACTGCTCTGGCGGTGGGCACTATTGTCATCTCCGGGAGGGATACTGCC  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGACTGCTCTGGCGGTGGGCACTATTGTCATCTCCGGGAGGGATACTGCC  436

seq1  GCACAAGCGCCCGAGTGTCCTCGGGACTGGGCCTTCTGCTTGAAACCCGG  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAAGCGCCCGAGTGTCCTCGGGACTGGGCCTTCTGCTTGAAACCCGG  486

seq1  CCCTGGGGGAAAAACAGGCTAAATCCCGGGAAGTCTCGGAGCGTTGCGCA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGGGGGAAAAACAGGCTAAATCCCGGGAAGTCTCGGAGCGTTGCGCA  536

seq1  GACGGATATGTCAGGCAACTTCCGGACAGGTTTCTGGGGCAAGAGGTGGT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGGATATGTCAGGCAACTTCCGGACAGGTTTCTGGGGCAAGAGGTGGT  586

seq1  TTGCACGTCGATCCTGAGATGTTTGCCTGCTTTTGTGTCCTCAGGCCTAT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCACGTCGATCCTGAGATGTTTGCCTGCTTTTGTGTCCTCAGGCCTAT  636

seq1  AACATTCACGTGAATGGAGTCCTGCACTGTCGGGTGCGCTACAGCCAGCT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTCACGTGAATGGAGTCCTGCACTGTCGGGTGCGCTACAGCCAGCT  686

seq1  TCTGGGGCTGCACGAGCAGGTGGGACTAACAACCCTGTCTAGATGCAGCT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGGCTGCACGAGCAGGTGGGACTAACAACCCTGTCTAGATGCAGCT  736

seq1  TCAAGCCCTTCCATACCCACGGACATTAATCCCCTTTCATTACATCACCC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCCCTTCCATACCCACGGACATTAATCCCCTTTCATTACATCACCC  786

seq1  TATAATCACTGCTACAGTGGAAGGTGGACTTTGTTAGCGTGACATTTCCG  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATCACTGCTACAGTGGAAGGTGGACTTTGTTAGCGTGACATTTCCG  836

seq1  GAAACTCTCTGAGCGGCTTGTCTCTCACAGTTCCTGTACTTCCCTATACT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACTCTCTGAGCGGCTTGTCTCTCACAGTTCCTGTACTTCCCTATACT  886

seq1  CACACATCCTTCCTTCTCTGAGCTGTCTCCTTTTTCATCCTTTGCCCCTG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACATCCTTCCTTCTCTGAGCTGTCTCCTTTTTCATCCTTTGCCCCTG  936

seq1  CATGGAAAAACTGAACCCTGTTAGTCAAAGCACATTCCTTCTGGCACCTA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGAAAAACTGAACCCTGTTAGTCAAAGCACATTCCTTCTGGCACCTA  986

seq1  AACTATAACTTGGGAATTC  1011
      |||||||||||||||||||
seq2  AACTATAACTTGGGAATTC  1005

seq1: chr5_31298333_31299415
seq2: B6Ng01-188D11.g_67_1148

seq1  GAATTCCATTTTCTGAGGGGGTGAGTGAGCAGAGATGGGTATATGAATAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATTTTCTGAGGGGGTGAGTGAGCAGAGATGGGTATATGAATAT  50

seq1  GATGCACAGTATTCCTTTTAGAAAACATTTATGTATCTATATAGTGTGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCACAGTATTCCTTTTAGAAAACATTTATGTATCTATATAGTGTGTT  100

seq1  TGCATATGTTTGTGGGTACACATGCCAGAGATCAGAGGACAACTTGTGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATATGTTTGTGGGTACACATGCCAGAGATCAGAGGACAACTTGTGGA  150

seq1  AGTTGGTTCTCTTCTTCCATAAGCAGATTCCAGGAACTGAACACAGGTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGGTTCTCTTCTTCCATAAGCAGATTCCAGGAACTGAACACAGGTTC  200

seq1  TCTGGCTTCGTGGCAATTGTTCTTTCCAGCTGAAAAGTCTCCTGTGTCCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCTTCGTGGCAATTGTTCTTTCCAGCTGAAAAGTCTCCTGTGTCCC  250

seq1  TGGCCTGGGATACACAGTGTTCTACTGAATGGATGTACCACAGCTTATAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTGGGATACACAGTGTTCTACTGAATGGATGTACCACAGCTTATAC  300

seq1  GCCAGGGCTGGAGACTAAGAGCTTTCACTCTTCCAGGGGACTTGGATTTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGGCTGGAGACTAAGAGCTTTCACTCTTCCAGGGGACTTGGATTTG  350

seq1  GCTCCCTACACCCACCTTGGGTGACTTCCAACCTTCTGGAACCAGGAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCCTACACCCACCTTGGGTGACTTCCAACCTTCTGGAACCAGGAGAA  400

seq1  CTGAAGCCCTCTTCTGGCCTCCATGGGCTCCTGCATACATTTGATATACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAGCCCTCTTCTGGCCTCCATGGGCTCCTGCATACATTTGATATACA  450

seq1  TAACTGACACGTATGACCTTTATTGACAGCACTTGGAAAGCACATCTCTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGACACGTATGACCTTTATTGACAGCACTTGGAAAGCACATCTCTG  500

seq1  TGAGTTCAAAACTAGCCTGGTCTACAGAGTGAGTACTAGGACAGCTAGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTTCAAAACTAGCCTGGTCTACAGAGTGAGTACTAGGACAGCTAGGA  550

seq1  GTACACAGAGAAGCCCTATCTCAAACAAAACACAACACAACAAAACAAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACACAGAGAAGCCCTATCTCAAACAAAACACAACACAACAAAACAAAA  600

seq1  ACAAAAACAAAAAGAACACATAAAACCCAGAAACAAATAAATAAAAATAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAAACAAAAAGAACACATAAAACCCAGAAACAAATAAATAAAAATAA  650

seq1  TTTTTAAAAAAGCTTATTAGCCAATTCTTATTGGCAGTCTAGAGGATATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAAAAAAGCTTATTAGCCAATTCTTATTGGCAGTCTAGAGGATATT  700

seq1  GATAGAACCTAGTAGGGAAACCCCCACTCAATTCCCAATTCTGTGGGCAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGAACCTAGTAGGGAAACCCCCACTCAATTCCCAATTCTGTGGGCAC  750

seq1  CCAAAAAAAATCACGAAGGACCATCTTGATGTAATTACATGAGGACGTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAAAAAATCACGAAGGACCATCTTGATGTAATTACATGAGGACGTTT  800

seq1  AATGACGTAGCTCCGGACCGACATGCATCCCACACAGGAGATAACGGATG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGACGTAGCTCCGGACCGACATGCATCCCACACAGGAGATAACGGATG  850

seq1  TCGGCCATGAGGCTCGGAAGCTAGGGGTTTTTATGGGGTGAGGGGCTTAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGCCATGAGGCTCGGAAGCTAGGGGTTTTTATGGGGTGAGGGGCTTAG  900

seq1  GGGTGTGGAATTCAG-CATAGCGACACACTATTGGCTTATTCAAACATC-  948
      ||||||||||||||| |||| ||||||||||||||||||||||| |||| 
seq2  GGGTGTGGAATTCAGCCATACCGACACACTATTGGCTTATTCAACCATCA  950

seq1  AGCAGAAAAATTACATGTACGTGCA-GGGTGTCAGAGTTCTGTGAGTTGT  997
      ||||||||||||||||||||||||| |||||||||||||||||||| || 
seq2  AGCAGAAAAATTACATGTACGTGCATGGGTGTCAGAGTTCTGTGAG-TGG  999

seq1  TGACTCAGTTCA-GATAGCCCTGCTA-TGTCTTCACAGTCCCCTTTATCT  1045
      |||||||||||| ||||||||||||| |||| ||||||||||||||||| 
seq2  TGACTCAGTTCAGGATAGCCCTGCTATTGTC-TCACAGTCCCCTTTATC-  1047

seq1  TATGGTCAAGATGTTCCCAGGAATGTTTTAACAACAGG  1083
      ||||||||||||| | ||||| ||| || |||||||||
seq2  TATGGTCAAGATGCT-CCAGG-ATG-TTCAACAACAGG  1082

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information