MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-189J21
Chromosome	5 (Build37)
Map Location	32,600,229 - 32,758,680
singlet/doublet	doublet
Overlap gene	Plb1, EG665350, LOC545743
Upstream gene	Gckr, Zfp512, 4930548H24Rik, Xab1, Supt7l, Slc4a1ap, Mrpl33, Rbks, LOC100040000, Bre, Fosl2, LOC672217
Downstream gene	Ppp1cb, LOC634553, LOC675983, Yes1, LOC100039775, Pisd, C330019G07Rik, LOC100040141, Depdc5, Ywhah, LOC100040169, Slc5a1, Spon2, Ctbp1, Maea, 4933407H18Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gckr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231103 MGI:1096345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp512 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269639 MGI:1917345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930548H24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67656 MGI:1914906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74254 MGI:1921504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72195 MGI:1919445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a1ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20534 MGI:1196608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66845 MGI:2137225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbks (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71336 MGI:1918586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Bre (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Fosl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14284 MGI:102858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Plb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665270 MGI:1922406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665350 MGI:3644314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC545743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 73 ESTs, 14 Proteins pseudo : _no_value

name	Ppp1cb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19046 MGI:104871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC675983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Yes1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22612 MGI:99147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Pisd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320951 MGI:2445114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330019G07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215476 MGI:2443658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040141 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Depdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277854 MGI:2141101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ywhah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22629 MGI:109194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040169 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 677 ESTs, 5 Proteins

name	Slc5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20537 MGI:107678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spon2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100689 MGI:1923724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maea (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933407H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gckr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450292 GeneID:231103 MGI:1096345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucokinase regulatory protein transcript_id : NM_144909.1

name	Zfp512 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141800992 GeneID:269639 MGI:1917345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 512 transcript_id : NM_172993.2

name	4930548H24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346424 GeneID:67656 MGI:1914906
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930548H24 gene transcript_id : NM_026296.2

name	Xab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377911 GeneID:74254 MGI:1921504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : XPA binding protein 1 transcript_id : NM_133756.3

name	Supt7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037284 GeneID:72195 MGI:1919445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 7 (S. cerevisiae)-like transcript_id : NM_028150.1

name	Slc4a1ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469098 GeneID:20534 MGI:1196608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 1, adaptor protein transcript_id : NM_009206.1

name	Mrpl33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375920 GeneID:66845 MGI:2137225
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L33 transcript_id : NM_025796.2

name	Rbks (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23397418 GeneID:71336 MGI:1918586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribokinase transcript_id : NM_153196.1

name	LOC100040000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253838 GeneID:100040000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040000 transcript_id : XM_001474287.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21617850 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_144541.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281923 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181279.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281939 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181280.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281944 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181282.1

name	Bre (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281929 GeneID:107976 MGI:1333875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain and reproductive organ-expressed protein transcript_id : NM_181281.1

name	Fosl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789304 GeneID:14284 MGI:102858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fos-like antigen 2 transcript_id : NM_008037.3

name	Plb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487226 GeneID:665270 MGI:1922406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase B1 transcript_id : NM_001081407.1

name	EG665350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374663 GeneID:665350 MGI:3644314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG665350 transcript_id : XM_976298.1

name	Ppp1cb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385377 GeneID:19046 MGI:104871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, catalytic subunit, beta isoform transcript_id : NM_172707.2

name	Yes1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130336 GeneID:22612 MGI:99147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 transcript_id : NM_009535.2

name	Pisd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722756 GeneID:320951 MGI:2445114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylserine decarboxylase transcript_id : NM_177298.3

name	C330019G07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996496 GeneID:215476 MGI:2443658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330019G07 gene transcript_id : NM_194340.1

name	Depdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909319 GeneID:277854 MGI:2141101
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEP domain containing 5 transcript_id : NM_001025426.1

name	Depdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803514 GeneID:277854 MGI:2141101
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEP domain containing 5 transcript_id : NM_177786.3

name	Ywhah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756036 GeneID:22629 MGI:109194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide transcript_id : NM_011738.1

name	LOC100040169 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253848 GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 319 ESTs, 5 Proteins product : similar to ribosomal protein L35a, transcript variant 2 transcript_id : XM_001474659.1

name	LOC100040169 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253846 GeneID:100040169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 675 ESTs, 5 Proteins product : similar to ribosomal protein L35a, transcript variant 1 transcript_id : XM_001474643.1

name	Slc5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802859 GeneID:20537 MGI:107678
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 1 transcript_id : NM_019810.3

name	Spon2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981610 GeneID:100689 MGI:1923724
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spondin 2, extracellular matrix protein transcript_id : NM_133903.2

name	Ctbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129918 GeneID:13016 MGI:1201685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-terminal binding protein 1 transcript_id : NM_013502.2

name	Maea (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407042 GeneID:59003 MGI:1891748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage erythroblast attacher transcript_id : NM_021500.2

name	4933407H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487375 GeneID:71101 MGI:1918351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933407H18 gene transcript_id : NM_001081101.1

name	Gckr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450293 CCDS:CCDS19182.1 GeneID:231103 MGI:1096345
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0000060 - protein import into nucleus, translocation [Evidence IMP] codon_start : 1 product : glucokinase regulatory protein protein_id : NP_659158.1

name	Zfp512 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370500 CCDS:CCDS19183.1 GeneID:269639 MGI:1917345
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 512 protein_id : NP_766581.1

name	4930548H24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312838 CCDS:CCDS19184.1 GeneID:67656 MGI:1914906
definition	codon_start : 1 product : hypothetical protein LOC67656 protein_id : NP_080572.1

name	Xab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526970 CCDS:CCDS19185.1 GeneID:74254 MGI:1921504
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : methyl-CpG binding domain protein 2 interacting protein product : XPA binding protein 1 protein_id : NP_598517.1

name	Supt7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037285 CCDS:CCDS19186.1 GeneID:72195 MGI:1919445
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SPTF-associated factor 65 gamma protein_id : NP_082426.1

name	Slc4a1ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469099 GeneID:20534 MGI:1196608
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : solute carrier family 4 (anion exchanger), member 1, adapter protein product : solute carrier family 4 (anion exchanger), member 1, adaptor protein protein_id : NP_033232.1

name	Mrpl33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385266 GeneID:66845 MGI:2137225
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein L33 protein_id : NP_080072.1

name	Rbks (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23397419 CCDS:CCDS19187.1 GeneID:71336 MGI:1918586
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ribokinase protein_id : NP_694876.1

name	LOC100040000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253839 GeneID:100040000
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474337.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21617851 CCDS:CCDS19188.1 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform V is encoded by transcript variant 5 product : brain and reproductive organ-expressed protein isoform V protein_id : NP_653124.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281924 CCDS:CCDS19189.1 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform I is encoded by transcript variant 1 product : brain and reproductive organ-expressed protein isoform I protein_id : NP_851796.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281940 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform IV is encoded by transcript variant 4 product : brain and reproductive organ-expressed protein isoform IV protein_id : NP_851797.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281930 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform III is encoded by transcript variant 3 product : brain and reproductive organ-expressed protein isoform III protein_id : NP_851798.1

name	Bre (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281945 GeneID:107976 MGI:1333875
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000152 - nuclear ubiquitin ligase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000268 - peroxisome targeting sequence binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045768 - positive regulation of anti-apoptosis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform II is encoded by transcript variant 2 product : brain and reproductive organ-expressed protein isoform II protein_id : NP_851799.1

name	Fosl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328117 CCDS:CCDS19190.1 GeneID:14284 MGI:102858
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : fos-like antigen 2 protein_id : NP_032063.2

name	Plb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487227 GeneID:665270 MGI:1922406
definition	codon_start : 1 product : phospholipase B1 protein_id : NP_001074876.1

name	EG665350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374664 GeneID:665350 MGI:3644314
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981392.1

name	Ppp1cb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28173568 CCDS:CCDS19193.1 GeneID:19046 MGI:104871
definition	EC_number : 3.1.3.16 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0000163 - protein phosphatase type 1 activity [Evidence IDA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : protein phosphatase 1, catalytic subunit, beta isoform protein_id : NP_766295.1

name	Yes1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678617 GeneID:22612 MGI:99147
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0015758 - glucose transport [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : viral oncogene yes homolog protein_id : NP_033561.1

name	Pisd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722757 CCDS:CCDS19194.1 GeneID:320951 MGI:2445114
definition	codon_start : 1 product : phosphatidylserine decarboxylase protein_id : NP_796272.2

name	C330019G07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996497 CCDS:CCDS19195.1 GeneID:215476 MGI:2443658
definition	codon_start : 1 product : hypothetical protein LOC215476 protein_id : NP_919321.1

name	Depdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909320 CCDS:CCDS19196.1 GeneID:277854 MGI:2141101
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DEP domain containing 5 isoform 1 protein_id : NP_001020597.1

name	Depdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244316 CCDS:CCDS19197.1 GeneID:277854 MGI:2141101
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DEP domain containing 5 isoform 2 protein_id : NP_808454.1

name	Ywhah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756037 CCDS:CCDS19198.1 GeneID:22629 MGI:109194
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0035259 - glucocorticoid receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0019904 - protein domain specific binding [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0006713 - glucocorticoid catabolism [Evidence ISS]; GO:0042921 - glucocorticoid receptor signaling pathway [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0050774 - negative regulation of dendrite morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence ISS] codon_start : 1 note : 14-3-3 eta product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide protein_id : NP_035868.1

name	LOC100040169 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253847 GeneID:100040169
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474693.1

name	LOC100040169 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253849 GeneID:100040169
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474709.1

name	Slc5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543739 CCDS:CCDS19199.1 GeneID:20537 MGI:107678
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005903 - brush border [Evidence IDA] GO_function : GO:0005355 - glucose transporter activity [Evidence IMP]; GO:0005412 - glucose:sodium symporter activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence ISS] [Evidence IMP]; GO:0050892 - intestinal absorption [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0001656 - metanephros development [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sodium-glucose cotransporter 1; sodium glucose cotransporter 1; solute carrier family 5, member alpha 1; solute carrier family 5, member 1 product : solute carrier family 5 (sodium/glucose cotransporter), member 1 protein_id : NP_062784.2

name	Spon2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981611 CCDS:CCDS19200.1 GeneID:100689 MGI:1923724
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : spondin 2, extracellular matrix protein protein_id : NP_598664.2

name	Ctbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304989 CCDS:CCDS19201.1 GeneID:13016 MGI:1201685
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006564 - L-serine biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : C-terminal binding protein 1 protein_id : NP_038530.1

name	Maea (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407043 GeneID:59003 MGI:1891748
definition	codon_start : 1 product : erythroblast macrophage protein protein_id : NP_067475.2

name	4933407H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487376 GeneID:71101 MGI:1918351
definition	codon_start : 1 product : hypothetical protein LOC71101 protein_id : NP_001074570.1

name	LOC672217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672217
definition	number : 1 pseudo : _no_value

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 3 pseudo : _no_value

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 2 pseudo : _no_value

name	LOC634553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634553
definition	number : 1 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 1 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 2 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 3 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 4 pseudo : _no_value

name	LOC675983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675983
definition	number : 5 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 1 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 2 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 3 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 4 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 5 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 6 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 7 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 8 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 9 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 10 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 11 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 12 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 13 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 14 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 15 pseudo : _no_value

name	LOC100039775 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039775
definition	number : 16 pseudo : _no_value

name	LOC100040141 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040141
definition	number : 1 pseudo : _no_value

name	LOC545743 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253840 GeneID:545743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 73 ESTs, 14 Proteins product : similar to CLP36 pseudo : _no_value transcript_id : XR_031762.1

clone name	MSMg01-312G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-428A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122F05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-103F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440I05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-312C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-495L12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-189J21.b	B6Ng01-189J21.g
ACC	GA013592	GA013593
length	1,112	1,018
definition	B6Ng01-189J21.b	B6Ng01-189J21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(32,757,567 - 32,758,680)	(32,600,229 - 32,601,242)
sequence	gaattcattaaccgttgtcagctaggagaactgttaagtagaggtaatta aagatagatgaacagtcaccatcaatggtgattaatggctgaaatgttga gtctgtggcccttccctttctcttacaaggagattacaggagcagtatgt atttaggtcagccttagtttgttacaacaaaacctgtcatctacataggt aaaagtgtttctcttttagtgtgaaaggatgcctccttcaaacagcatac caggagtttgcaccaacagcatcttattggtgaggaaaagaatacaaaat gaaactttgtttcaaatgacatacttgaaatggtttgtcattaatacaag ttggtctcttgcaacaaaagtctttccattcactttctgcattggaggtt taactacttggtttcttaagtttctctttcaattgactctgataaataga ataatttgctgagctctttctttcttccttcctttcttttccccactcac tcactccctgccactctctccttttggttctggggaatcgaacatagatc caaacacatactaagaaagtgttctgcctttgaactataactctagccca agatgagttttctaaaatgttataaaatcaatagatctcctaaaactaaa accatgtatttttatatttaatataaaagcccatttagaatttataatat agaatttatgaattattatttgcaacttaaagtgcatccagttcattaca catgttctttttaaaaagttgtatggccgggcggtggtggcgcacgcctt taatcctagcacttgggaggcagagacaggtggatttctgagttcgaggc cagcctggttctacaaagtgagttccaggacagccaagactacagagaaa ccctgtctcgaaaaatcaaaaaaaaaaagttgtatgattgttgtatgtga gagtctgtttgtgcatgtacacatgcaaggacaacttggtagtgttggta ttctcttttcaacctttgcatgggtccagatggacagcaagccacttgct agtgagcatttccaccccccaacatcataggtaataaattgaaataaccc tgggttccttgt	gaattccagacatgatgatgggggaaggaagaataaagaaagatacttgg tgactctagaatctaagaaacaagacttcgaagctgccatcaggctttgc aatggcagccaaagttatgtgagtcaatttgaacctaaacctggaaagaa acagttatgagttttggtctctcctacaaatgcagaaataaccactgtcc atggcttcctaatgaaaacatacttctgggtagttctcaaaatgtggtac ccagacaggacttggggcagccacagtacctgagcatcagacatgcaaac atcttagacccaccatagacctgctgaatctgaagctcttggtagttcag gggtcataggtgattctgttgcccaacccagtttgaggaccagtaatctc catattctgtcaggtacacattcatctgtcagtctacatcctattctagg acacatcagggacttttccttaccagtgcaagtcctcagtgggtgtggca gctgccattctgcaagcagtgtgaaagtggtagagaagcctgagttggca gccagtgggagcaaggcatgccactgggaaagctagttttctcagacata taggggactaggtcagggcttcctgaaaccctcattttccattcacccag atttgctttccagttcacagcttgcggccagctgatatcaagatcatagg agcattgggtgactcgctcacggtaggtgatctcaactgtagaaaattaa gaagagagatgtttatgattttgaggcagggttttgtgtagctcaggctg gtgtcaaattcactatgtaactggggttggccttgaactcctgatcttcc tgtgtctacctcccaagttgctgggattacagctgtgggctaccacatcc aactaggagggagagattttaatgaatacaaaaacatgaaactggaaagt tgaggttttactctagcctgtttctggttccaatccttcaaaggctccct attccctttgccttggca
quality values	Open. Hide. 58 26 37 26 58 39 22 42 54 54 54 58 62 62 62 62 62 62 38 37 54 62 47 47 62 62 49 42 62 62 47 56 62 24 24 21 21 20 28 37 22 38 38 37 32 50 62 59 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 54 54 48 54 54 62 62 42 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 41 58 58 58 58 58 58 58 58 54 58 54 54 58 58 54 54 58 58 58 54 58 54 49 42 58 58 58 52 58 47 58 58 58 58 58 58 58 58 58 58 58 49 58 54 58 58 58 54 42 47 58 58 58 58 58 58 51 58 50 51 51 58 58 58 58 58 51 51 50 41 43 40 51 51 46 40 54 58 37 54 58 58 54 58 48 50 58 58 49 49 58 35 42 47 53 54 58 58 58 50 54 46 58 58 53 58 35 39 50 54 49 34 43 37 58 58 39 41 41 39 58 58 39 49 49 41 54 58 54 53 53 58 58 58 50 52 52 50 37 58 41 33 58 53 53 53 40 58 58 49 41 39 41 41 40 49 58 50 52 41 58 50 33 58 40 50 53 32 53 53 42 49 54 50 58 41 32 58 54 39 51 51 52 37 49 42 42 53 49 49 37 54 49 38 42 28 49 40 53 49 21 54 51 39 42 50 38 38 52 40 49 30 49 46 41 32 35 51 50 34 49 34 50 40 40 53 54 18 37 38 54 54 54 34 21 54 54 54 51 31 28 51 42 37 40 45 41 32 15 54 16 54 49 25 25 54 30 54 54 39 52 51 52 42 32 32 32 30 25 35 45 52 52 22 31 32 32 34 32 40 39 31 32 31 33 24 32 53 46 25 7 52 30 31 18 32 16 29 23 14 9 13 13 51 45 30 16 46 51 35 43 31 45 19 51 43 35 32 33 16 37 21 25 23 34 25 31 29 30 46 7 8 26 33 27 26 21 45 21 22 22 31 31 26 42 43 21 32 31 31 43 35 18 25 23 27 36 25 28 13 30 17 19 20 37 17 25 42 21 27 32 33 28 37 23 11 28 27 31 31 22 20 18 41 39 47 23 26 14 26 43 46 39 46 44 48 46 46 46 17 15 18 27 19 14 24 21 23 27 16 31 24 7 27 29 20 27 31 20 29 17 38 11 33 13 33 26 25 26 33 41 7 15 12 12 33 11 8 13 9 20 33 24 31 23 34 31 16 7 16 6 14 14 11 24 33 34 19 15 16 4 7 21 32 27 32 10 25 18 6 15 5 5 17 31 16 7 5 24 43 21 19 21 21 19 6 26 27 25 12 16 19 19 12 24 13 4 5 22 7 5 5 5 3 10 13 8 16 15 20 18 9 16 19 7 6 7 3 6 8 19 27 27 9 13 28 28 8 20 6 22 28 11 9 9 7 16 28 21 30 32 21 13 8 14 6 4 9 6 16 10 6 3 13 5 5 19 4 26 14 9 14 9 10 18 16 6 7 11 23 30 17 1 2 2 6 5 24 8 9 6 12 7 3	Open. Hide. 62 47 34 47 62 62 41 26 62 54 62 62 39 38 29 21 21 22 29 56 38 32 38 38 44 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 59 59 62 54 59 62 49 59 59 59 59 59 59 56 50 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 58 58 58 47 58 58 58 49 46 52 52 48 54 54 52 46 52 54 58 54 58 58 54 58 54 54 58 54 54 58 58 58 58 58 58 58 54 58 58 58 54 58 52 58 52 58 54 48 45 54 54 58 58 52 58 58 58 54 54 54 52 54 46 54 54 52 58 58 58 58 52 58 52 58 54 58 54 54 58 58 44 36 34 54 51 45 58 47 41 41 58 50 50 49 50 58 58 58 58 54 53 53 53 40 37 58 50 50 53 52 53 58 58 58 58 58 44 25 49 50 48 54 50 50 47 48 49 32 49 58 51 46 51 50 51 58 42 35 27 33 40 51 50 50 53 58 54 49 34 42 29 49 51 40 32 44 43 44 28 46 46 30 58 58 50 46 49 58 58 39 51 50 52 34 58 42 39 43 40 40 52 58 47 51 50 40 50 40 39 27 41 40 58 50 39 37 41 52 50 51 35 43 47 39 49 38 50 43 50 58 54 35 53 40 49 35 26 49 38 42 44 46 37 51 37 51 52 53 42 37 37 30 54 24 37 14 32 27 41 47 25 52 52 49 47 26 28 21 39 34 45 39 54 54 54 49 26 30 13 33 29 51 54 21 49 27 44 31 33 33 42 30 54 39 31 39 31 31 24 54 54 51 25 53 18 51 24 26 27 54 31 32 54 54 53 51 32 34 32 35 29 32 34 30 11 12 14 12 32 52 40 13 31 26 31 32 47 34 53 6 9 18 34 34 39 31 34 34 32 32 26 22 41 46 46 36 33 16 21 18 20 40 23 16 17 25 34 32 18 14 23 29 35 37 26 32 33 18 42 33 12 38 23 31 23 43 36 31 19 22 43 36 42 29 31 26 15 6 6 20 30 32 31 40 18 28 33 33 31 32 28 31 31 33 38 31 46 41 32 21 32 9 27 30 24 27 15 29 33 25 21 22 30 26 25 22 21 11 7 28 21 31 18 39 18 32 31 39 39 31 20 41 25 41 33 19 20 12 9 12 18 9 38 29 32 12 31 10 15 36 20 9 29 21 17 38 35 21 15 8 11 31 26 8 18 31 44 48 38 33 37 18 17 20 14 9 16 12 7 7 12 33 11 28 17 26 27 11 14 32 25 13 25 17 18 33 9 10 25 18 48 16 25 30 6 16 11 28 26 14 20 10 13 11 24 18 29 31 6 6 8 22 19 11 31 25 13 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_32757567_32758680
seq2: B6Ng01-189J21.b_46_1157 (reverse)

seq1  ACAAAGAACACAGGG-TATTTCAATTAATAACTAATG-TGTT-GGGGGTG  47
      |||| |||| ||||| |||||||||| || ||  ||| |||| |||||||
seq2  ACAAGGAACCCAGGGTTATTTCAATTTATTACCTATGATGTTGGGGGGTG  50

seq1  AAATGGCTCACTTAGCAAAGGTGCTTGCTGTTCCAATTCCTGGAACCCAT  97
       ||  |||||| |||| |||  |||||||| ||||    |||| ||||||
seq2  GAAATGCTCAC-TAGC-AAGTGGCTTGCTG-TCCA---TCTGG-ACCCAT  93

seq1  GCAAAGGTTG-AAAGAGATAACCAACACTACCAAGTTGTCCTTTGCATGT  146
      |||||||||| |||||||  ||||||||||||||||||||| ||||||||
seq2  GCAAAGGTTGAAAAGAGAATACCAACACTACCAAGTTGTCC-TTGCATGT  142

seq1  GTACATGCACAAACAGACTCTCACATACAACAATCATACAAC-TTTTTTT  195
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  GTACATGCACAAACAGACTCTCACATACAACAATCATACAACTTTTTTTT  192

seq1  TTTGATTTTTCGAGACAGGGTTTCTCTGTAGTCTTGGCTGTCCTGGAACT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATTTTTCGAGACAGGGTTTCTCTGTAGTCTTGGCTGTCCTGGAACT  242

seq1  CACTTTGTAG-ACCAGGCTGGCCTCGAACTCAGAAATCCACCTGTCTCTG  294
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CACTTTGTAGAACCAGGCTGGCCTCGAACTCAGAAATCCACCTGTCTCTG  292

seq1  CCTCCCAAGTGCTAGGATTAAAGGCGTGCGCCACCACCGCCCGGCCATAC  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCAAGTGCTAGGATTAAAGGCGTGCGCCACCACCGCCCGGCCATAC  342

seq1  AACTTTTTAAAAAGAACATGTGTAATGAACTGGATGCACTTTAAGTTGCA  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTTTAAAAAGAACATGTGTAATGAACTGGATGCACTTTAAGTTGCA  392

seq1  AATAATAATTCATAAATTCTATATTATAAATTCTAAATGGGCTTTTATAT  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATAATTCATAAATTCTATATTATAAATTCTAAATGGGCTTTTATAT  442

seq1  TAAATATAAAAATACATGGTTTTAGTTTTAGGAGATCTATTGATTTTATA  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATATAAAAATACATGGTTTTAGTTTTAGGAGATCTATTGATTTTATA  492

seq1  ACATTTTAGAAAACTCATCTTGGGCTAGAGTTATAGTTCAAAGGCAGAAC  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTTAGAAAACTCATCTTGGGCTAGAGTTATAGTTCAAAGGCAGAAC  542

seq1  ACTTTCTTAGTATGTGTTTGGATCTATGTTCGATTCCCCAGAACCAAAAG  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTCTTAGTATGTGTTTGGATCTATGTTCGATTCCCCAGAACCAAAAG  592

seq1  GAGAGAGTGGCAGGGAGTGAGTGAGTGGGGAAAAGAAAGGAAGGAAGAAA  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGTGGCAGGGAGTGAGTGAGTGGGGAAAAGAAAGGAAGGAAGAAA  642

seq1  GAAAGAGCTCAGCAAATTATTCTATTTATCAGAGTCAATTGAAAGAGAAA  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAGCTCAGCAAATTATTCTATTTATCAGAGTCAATTGAAAGAGAAA  692

seq1  CTTAAGAAACCAAGTAGTTAAACCTCCAATGCAGAAAGTGAATGGAAAGA  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAGAAACCAAGTAGTTAAACCTCCAATGCAGAAAGTGAATGGAAAGA  742

seq1  CTTTTGTTGCAAGAGACCAACTTGTATTAATGACAAACCATTTCAAGTAT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGTTGCAAGAGACCAACTTGTATTAATGACAAACCATTTCAAGTAT  792

seq1  GTCATTTGAAACAAAGTTTCATTTTGTATTCTTTTCCTCACCAATAAGAT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTTGAAACAAAGTTTCATTTTGTATTCTTTTCCTCACCAATAAGAT  842

seq1  GCTGTTGGTGCAAACTCCTGGTATGCTGTTTGAAGGAGGCATCCTTTCAC  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTTGGTGCAAACTCCTGGTATGCTGTTTGAAGGAGGCATCCTTTCAC  892

seq1  ACTAAAAGAGAAACACTTTTACCTATGTAGATGACAGGTTTTGTTGTAAC  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAAAAGAGAAACACTTTTACCTATGTAGATGACAGGTTTTGTTGTAAC  942

seq1  AAACTAAGGCTGACCTAAATACATACTGCTCCTGTAATCTCCTTGTAAGA  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTAAGGCTGACCTAAATACATACTGCTCCTGTAATCTCCTTGTAAGA  992

seq1  GAAAGGGAAGGGCCACAGACTCAACATTTCAGCCATTAATCACCATTGAT  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGGAAGGGCCACAGACTCAACATTTCAGCCATTAATCACCATTGAT  1042

seq1  GGTGACTGTTCATCTATCTTTAATTACCTCTACTTAACAGTTCTCCTAGC  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGACTGTTCATCTATCTTTAATTACCTCTACTTAACAGTTCTCCTAGC  1092

seq1  TGACAACGGTTAATGAATTC  1114
      ||||||||||||||||||||
seq2  TGACAACGGTTAATGAATTC  1112

seq1: chr5_32600229_32601242
seq2: B6Ng01-189J21.g_65_1082

seq1  GAATTCCAGACATGATGATGGGGGAAGGAAGAATAAAGAAAGATACTTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGACATGATGATGGGGGAAGGAAGAATAAAGAAAGATACTTGG  50

seq1  TGACTCTAGAATCTAAGAAACAAGACTTCGAAGCTGCCATCAGGCTTTGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTCTAGAATCTAAGAAACAAGACTTCGAAGCTGCCATCAGGCTTTGC  100

seq1  AATGGCAGCCAAAGTTATGTGAGTCAATTTGAACCTAAACCTGGAAAGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGCAGCCAAAGTTATGTGAGTCAATTTGAACCTAAACCTGGAAAGAA  150

seq1  ACAGTTATGAGTTTTGGTCTCTCCTACAAATGCAGAAATAACCACTGTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTTATGAGTTTTGGTCTCTCCTACAAATGCAGAAATAACCACTGTCC  200

seq1  ATGGCTTCCTAATGAAAACATACTTCTGGGTAGTTCTCAAAATGTGGTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTTCCTAATGAAAACATACTTCTGGGTAGTTCTCAAAATGTGGTAC  250

seq1  CCAGACAGGACTTGGGGCAGCCACAGTACCTGAGCATCAGACATGCAAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGACAGGACTTGGGGCAGCCACAGTACCTGAGCATCAGACATGCAAAC  300

seq1  ATCTTAGACCCACCATAGACCTGCTGAATCTGAAGCTCTTGGTAGTTCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAGACCCACCATAGACCTGCTGAATCTGAAGCTCTTGGTAGTTCAG  350

seq1  GGGTCATAGGTGATTCTGTTGCCCAACCCAGTTTGAGGACCAGTAATCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCATAGGTGATTCTGTTGCCCAACCCAGTTTGAGGACCAGTAATCTC  400

seq1  CATATTCTGTCAGGTACACATTCATCTGTCAGTCTACATCCTATTCTAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATTCTGTCAGGTACACATTCATCTGTCAGTCTACATCCTATTCTAGG  450

seq1  ACACATCAGGGACTTTTCCTTACCAGTGCAAGTCCTCAGTGGGTGTGGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACATCAGGGACTTTTCCTTACCAGTGCAAGTCCTCAGTGGGTGTGGCA  500

seq1  GCTGCCATTCTGCAAGCAGTGTGAAAGTGGTAGAGAAGCCTGAGTTGGCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCCATTCTGCAAGCAGTGTGAAAGTGGTAGAGAAGCCTGAGTTGGCA  550

seq1  GCCAGTGGGAGCAAGGCATGCCACTGGGAAAGCTAGTTTTCTCAGACATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGTGGGAGCAAGGCATGCCACTGGGAAAGCTAGTTTTCTCAGACATA  600

seq1  TAGGGGACTAGGTCAGGGCTTCCTGAAACCCTCATTTTCCATTCACCCAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGGGACTAGGTCAGGGCTTCCTGAAACCCTCATTTTCCATTCACCCAG  650

seq1  ATTTGCTTTCCAGTTCACAGCTTGCGGCCAGCTGATATCAAGATCATAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGCTTTCCAGTTCACAGCTTGCGGCCAGCTGATATCAAGATCATAGG  700

seq1  AGCATTGGGTGACTCGCTCACGGTAGGTGATCTCAACTGTAGAAAATTAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATTGGGTGACTCGCTCACGGTAGGTGATCTCAACTGTAGAAAATTAA  750

seq1  GAAGAGAGATGTTTATGATTTTGAGGCAGGGTTTTGTGTAGCTCAGGCTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGAGATGTTTATGATTTTGAGGCAGGGTTTTGTGTAGCTCAGGCTG  800

seq1  GTGTCAAATTCACTATGTAACTGGGGTTGGCCTTGAACTCCTGATCTTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCAAATTCACTATGTAACTGGGGTTGGCCTTGAACTCCTGATCTTCC  850

seq1  TGTGTCTACCTCCCAAG-TGCTGGGATTACAGCTGTGGGCTACCACATCC  899
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TGTGTCTACCTCCCAAGTTGCTGGGATTACAGCTGTGGGCTACCACATCC  900

seq1  AACTAGGA-GGAGAGATTTTAATGAATACAAAAACATGAAACT-GAAAGT  947
      |||||||| |||||||||||||||||||||||||||||||||| ||||||
seq2  AACTAGGAGGGAGAGATTTTAATGAATACAAAAACATGAAACTGGAAAGT  950

seq1  TGAGGTTTTACTCTTAGCCTGTTTCTGGTCCCAATCC-TCAAAGGCTCCC  996
      ||||||||||||| ||||||||||||||| ||||||| ||||||||||||
seq2  TGAGGTTTTACTC-TAGCCTGTTTCTGGTTCCAATCCTTCAAAGGCTCCC  999

seq1  TATTCCCTTTGCC-TGGCA  1014
      ||||||||||||| |||||
seq2  TATTCCCTTTGCCTTGGCA  1018

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information