MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-190P17
Chromosome	5 (Build37)
Map Location	149,355,146 - 149,513,869
singlet/doublet	doublet
Overlap gene	Ubl3
Upstream gene	Pan3, Flt1, LOC100039825, Pomp, Slc46a3, C130038G02Rik, LOC100041819, Slc7a1, LOC100041842
Downstream gene	2210417A02Rik, LOC100041869, Katnal1, 8430423G03Rik, 1810059H22Rik, LOC667386, LOC100039964, Hmgb1, EG667410, LOC100040006, Uspl1, 2310047D07Rik, Alox5ap, 6330406I15Rik, 4930588N13Rik, LOC100040037, LOC100040062, 4930434E21Rik, Hsp110, EG433968, B3galtl
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pan3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72587 MGI:1919837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14254 MGI:95558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pomp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66537 MGI:1913787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc46a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71706 MGI:1918956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C130038G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77521 MGI:1915388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 10 Proteins pseudo : _no_value

name	Slc7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11987 MGI:88117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ubl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24109 MGI:1344373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210417A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70138 MGI:1917388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100041869 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Katnal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231912 MGI:2387638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430423G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71473 MGI:1918723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1810059H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69820 MGI:1917070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	LOC667386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100039964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Hmgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15289 MGI:96113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667410 MGI:3647532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 296 ESTs, 9 Proteins

name	LOC100040006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Uspl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231915 MGI:2442342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69657 MGI:1916907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Alox5ap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11690 MGI:107505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330406I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70717 MGI:1917967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930588N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75860 MGI:1923110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins

name	LOC100040037 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	4930434E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381693 MGI:1923042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsp110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15505 MGI:105053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433968 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433968 MGI:3648428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 521 ESTs, 19 Proteins

name	B3galtl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381694 MGI:2685903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pan3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61744462 GeneID:72587 MGI:1919837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PAN3 polyA specific ribonuclease subunit homolog (S. cerevisiae) transcript_id : NM_028291.3

name	Flt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129969 GeneID:14254 MGI:95558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 1 transcript_id : NM_010228.3

name	Pomp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377568 GeneID:66537 MGI:1913787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome maturation protein transcript_id : NM_025624.2

name	Slc46a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802503 GeneID:71706 MGI:1918956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 46, member 3 transcript_id : NM_027872.3

name	C130038G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362771 GeneID:77521 MGI:1915388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130038G02 gene transcript_id : NM_029920.5

name	Slc7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801995 GeneID:11987 MGI:88117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 transcript_id : NM_007513.3

name	LOC100041842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254777 GeneID:100041842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100041842 transcript_id : XM_001477382.1

name	Ubl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053909 GeneID:24109 MGI:1344373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 3 transcript_id : NM_011908.2

name	2210417A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254779 GeneID:70138 MGI:1917388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 2210417A02 gene transcript_id : XM_001477439.1

name	LOC100041869 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254781 GeneID:100041869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041869 transcript_id : XM_001477450.1

name	Katnal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956363 GeneID:231912 MGI:2387638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : katanin p60 subunit A-like 1 transcript_id : NM_153572.1

name	8430423G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375855 GeneID:71473 MGI:1918723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 8430423G03 gene transcript_id : XM_990235.1

name	LOC667386 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375857 GeneID:667386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC667386 transcript_id : XM_990264.1

name	LOC100039964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254749 GeneID:100039964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039964 transcript_id : XM_001473858.1

name	Hmgb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326547 GeneID:15289 MGI:96113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group box 1 transcript_id : NM_010439.3

name	EG667410 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375861 GeneID:667410 MGI:3647532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 296 ESTs, 9 Proteins product : predicted gene, EG667410 transcript_id : XM_990406.1

name	LOC100040006 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254751 GeneID:100040006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040006 transcript_id : XM_001473934.1

name	Uspl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701435 GeneID:231915 MGI:2442342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase like 1 transcript_id : NM_001013378.1

name	2310047D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375863 GeneID:69657 MGI:1916907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2310047D07 gene transcript_id : XM_990491.1

name	Alox5ap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563241 GeneID:11690 MGI:107505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arachidonate 5-lipoxygenase activating protein transcript_id : NM_009663.1

name	6330406I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363148 GeneID:70717 MGI:1917967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330406I15 gene transcript_id : NM_027519.2

name	4930588N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375866 GeneID:75860 MGI:1923110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 2 Proteins product : RIKEN cDNA 4930588N13 gene, transcript variant 1 transcript_id : XM_132524.6

name	4930434E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508423 GeneID:381693 MGI:1923042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930434E21 gene transcript_id : NM_029440.3

name	Hsp110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145504 GeneID:15505 MGI:105053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 110 transcript_id : NM_013559.2

name	EG433968 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254784 GeneID:433968 MGI:3648428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 521 ESTs, 19 Proteins product : predicted gene, EG433968 transcript_id : XM_485703.4

name	B3galtl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487080 GeneID:381694 MGI:2685903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta 1,3-galactosyltransferase-like transcript_id : NM_001081204.1

name	Pan3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61744463 GeneID:72587 MGI:1919837
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Pabp1-dependent poly A-specific ribonuclease subunit Pan3 product : PABP-dependent poly(A) nuclease 3 protein_id : NP_082567.2

name	Flt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328180 CCDS:CCDS19879.1 GeneID:14254 MGI:95558
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : vascular permeability factor receptor; vascular endothelial growth factor receptor product : FMS-like tyrosine kinase 1 protein_id : NP_034358.2

name	Pomp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385086 GeneID:66537 MGI:1913787
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : proteasome maturation protein protein_id : NP_079900.1

name	Slc46a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311835 CCDS:CCDS19880.1 GeneID:71706 MGI:1918956
definition	codon_start : 1 product : solute carrier family 46, member 3 protein_id : NP_082148.1

name	C130038G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832043 CCDS:CCDS19881.1 GeneID:77521 MGI:1915388
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hypothetical protein LOC77521 isoform b protein_id : NP_084196.4

name	Slc7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677433 CCDS:CCDS19882.1 GeneID:11987 MGI:88117
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cationic amino acid transporter 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 protein_id : NP_031539.2

name	LOC100041842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254778 GeneID:100041842
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477432.1

name	Ubl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755925 GeneID:24109 MGI:1344373
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin-like 3 protein_id : NP_036038.1

name	2210417A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254780 GeneID:70138 MGI:1917388
definition	codon_start : 1 product : hypothetical protein LOC70138 protein_id : XP_001477489.1

name	LOC100041869 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254782 GeneID:100041869
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477500.1

name	Katnal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956364 GeneID:231912 MGI:2387638
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008568 - microtubule-severing ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : katanin p60 subunit A-like 1 protein_id : NP_705800.1

name	8430423G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375856 GeneID:71473 MGI:1918723
definition	codon_start : 1 product : hypothetical protein LOC71473 protein_id : XP_995329.1

name	LOC667386 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375858 GeneID:667386
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995358.1

name	LOC100039964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254750 GeneID:100039964
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473908.1

name	Hmgb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754208 CCDS:CCDS19883.1 GeneID:15289 MGI:96113
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005694 - chromosome [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0030235 - nitric-oxide synthase regulator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006323 - DNA packaging [Evidence IEA]; GO:0006809 - nitric oxide biosynthesis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006810 - transport [Evidence IDA] codon_start : 1 note : high mobility group protein 1 product : high mobility group box 1 protein_id : NP_034569.1

name	EG667410 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375862 GeneID:667410 MGI:3647532
definition	codon_start : 1 product : similar to mKIAA0060 protein protein_id : XP_995500.1

name	LOC100040006 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254752 GeneID:100040006
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473984.1

name	Uspl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701436 GeneID:231915 MGI:2442342
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific peptidase like 1 protein_id : NP_001013396.1

name	2310047D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375864 GeneID:69657 MGI:1916907
definition	codon_start : 1 product : hypothetical protein LOC69657 protein_id : XP_995585.1

name	Alox5ap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563242 GeneID:11690 MGI:107505
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0019370 - leukotriene biosynthesis [Evidence IEA] codon_start : 1 note : arachidonate 5 lipoxygenase activating protein product : arachidonate 5-lipoxygenase activating protein protein_id : NP_033793.1

name	6330406I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734078 CCDS:CCDS19884.1 GeneID:70717 MGI:1917967
definition	codon_start : 1 product : hypothetical protein LOC70717 protein_id : NP_081795.1

name	4930588N13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51711287 GeneID:75860 MGI:1923110
definition	codon_start : 1 product : hypothetical protein LOC75860 isoform 1 protein_id : XP_132524.3

name	4930434E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508424 GeneID:381693 MGI:1923042
definition	codon_start : 1 product : hypothetical protein LOC381693 protein_id : NP_083716.2

name	Hsp110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145505 CCDS:CCDS19885.1 GeneID:15505 MGI:105053
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : heat shock protein, 105 kDa; HSP105 42 C-HSP product : heat shock protein 105 protein_id : NP_038587.2

name	EG433968 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82900057 GeneID:433968 MGI:3648428
definition	codon_start : 1 product : similar to nucleoside diphosphate kinase B protein_id : XP_485703.2

name	B3galtl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487081 GeneID:381694 MGI:2685903
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : beta 1,3-galactosyltransferase-like protein_id : NP_001074673.1

name	LOC100039825 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039825
definition	number : 1 pseudo : _no_value

name	LOC100039825 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039825
definition	number : 2 pseudo : _no_value

name	LOC100040037 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040037
definition	number : 3 pseudo : _no_value

name	LOC100040037 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040037
definition	number : 2 pseudo : _no_value

name	LOC100040037 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040037
definition	number : 1 pseudo : _no_value

name	LOC100040062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040062
definition	number : 1 pseudo : _no_value

name	LOC100041819 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254776 GeneID:100041819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 10 Proteins product : similar to fus-like protein pseudo : _no_value transcript_id : XR_033181.1

name	1810059H22Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254748 GeneID:69820 MGI:1917070
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : RIKEN cDNA 1810059H22 gene transcript_id : XR_035221.1

clone name	MSMg01-365G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-526M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501I20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516A14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-190P17.b	B6Ng01-190P17.g
ACC	GA014599	GA014600
length	1,068	1,156
definition	B6Ng01-190P17.b	B6Ng01-190P17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(149,512,794 - 149,513,869)	(149,355,146 - 149,356,288)
sequence	gaattcccaacggccattgtccttgctcctgaacagagtgtttgagaccg aatagtgagaagctaggacaaagctagagccaagcgagggggcgtgtccc aggtgggcgtgtcccagggggtagcttcacttccttctcaactctttgcc ttcctgtgtgatccaggaaccaggacacacacagaacccaacagtgtctg gcctctcttctgagcagcagatggctaggttcaaccttagggatgggtca agagttcaaccacagcttcctggcagggagctattcaaacgcaggaatgt gagaatggtacagccaaccagtgcagttgtgcatagttcacacagtccct gaaggaacaaaggagaggaccacggactcacaggcgcaaagaaacaagta aaacagccgtttaaatcaacagcctgccctttgacccagtgaccctgtcc caagaagccagtactccggaagcaggcagaacctggcaaagctcagaatg gtaacattcacacttgtatggtatctaccacacagaacgtcagggaaaac ccacatatctgaattagaaaagggtgaaatgaattatacctcaacaacga cgtgggcactggattgtgtttaaaaatacattccattgtttgggaaatac aatgttaagtaaaatggctgtatagagaagggactcacctatttcaagcc ctaaatttatactctcaaacaataaattcgaaggaaggtttaggagagaa tcatacgttgctatatctggctagcataaatgaatattttcatctcggta ttttattttaatgaacccattgtaagtcaccagcaccaaaaatgtttctt catgtcttatatttgccgtattgaaatatacagagctcaactttgccatt tccgggccattttaagtgcaaaaaatggtcattgtagtcacactgttgct acagccacggcatccctaccatccttacccttgaacgcgttcatccatct tctaaacagaactccacccccaccaactccccacagccaccttacagcac actcagcttttatctctg	gaattccttggaacatttatggatgaaatgaaatcaattcttaacaaaaa attctgcaatgttttccagatcattttatgaggtcaatgtactcttgaca cctagatctgccaaagatttttacaagaaattaaaattgttaatcagcct tttccatgaacaaaatcacaagcatctgatgtgagggataagctagcata ctaaaaaatgtgggcctggagagatggctcagagcactttgctgctcttg cagagacccgggttcaattcccaccacctacattaccattcataactatc agtaaatcagttccaggtgatccaacgtcttcttgtgacctcctcagata tcaagcaggcacatggttggtgcacacacacatacagacaaaacacacat ataagaagtaaatctgtaaataaagtatttttttaaaaaaagaaaatgca gctatttgtggtagcacatgcttctaatcccagcactaaggaggctgagc caggaggatggagatccaggatagcctgggctatccagatacaagggaga cctggacccgatctcaaaacaaaagccaaagggaagggaaaagacaggag agagggcgtagtaaaatagccacattcaactggtaagtcaagggttttgc tttgttttttaattatgaaattggtaccttcccatctatgacttcaataa ctgacctattttttggcacaacaactacattcctaagaactttattttaa ggagtactcacaaggcatgtttgagaatagccatgaaactactgtttccc acagcttttaaatacctgctgtggtctgagtgtatcctgaagagtcaggt gttgggaactcaatccccaatgtggcactggtgaggtggggacttaaagg aagctaaggcttagcctctccccacacctcccagtctcctgttgctttct agacttacagcagcaaggaatgaaacagaaatgatgtctgcaaatgtgca aattagttaagtaacttgacatccactaagaatcaggtttaatgatttct atacaatgtgtttttatccctatttgtatagatgatgtgactgcattaaa gaaaatcaagtatttctaaggcaaacaattttacctctttcgattttaaa gaaaat
quality values	Open. Hide. 52 28 22 37 54 62 62 35 26 47 62 62 62 62 39 37 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 44 43 43 36 27 34 34 50 59 51 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 54 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 58 54 45 58 54 58 58 49 58 54 58 58 54 58 49 45 58 58 58 58 58 49 58 58 58 58 58 54 54 58 58 58 58 58 44 54 58 58 51 58 58 58 58 58 58 58 58 54 58 52 58 58 54 58 58 58 58 52 58 54 54 58 58 58 58 54 58 58 58 41 54 42 58 54 54 58 58 54 48 58 51 51 58 58 58 49 41 58 51 58 58 58 52 53 51 49 45 58 49 24 43 58 52 58 51 49 48 40 47 51 51 54 53 49 50 52 45 32 46 35 39 54 28 48 50 54 48 54 58 58 51 58 51 35 49 51 49 51 51 58 54 40 58 54 37 47 38 38 15 39 42 58 49 50 51 58 46 51 51 51 50 54 40 58 54 16 58 42 24 26 58 53 50 51 58 47 50 41 58 51 53 39 50 50 46 49 58 52 46 58 50 53 58 53 42 49 41 51 54 54 52 53 31 54 54 50 49 52 53 33 54 30 47 54 39 14 54 52 25 54 51 13 9 49 25 54 46 45 12 35 44 30 46 23 54 40 37 43 43 53 51 52 34 41 33 47 42 40 42 45 42 53 45 42 54 54 35 53 40 39 31 37 40 39 54 32 33 42 33 32 45 53 45 53 47 19 32 32 52 42 53 32 23 47 27 29 29 49 49 18 26 31 47 46 32 20 52 34 43 32 38 32 40 28 29 43 30 42 24 33 25 30 29 28 31 29 31 30 31 32 28 24 31 27 51 51 51 51 33 46 12 46 37 32 34 9 29 19 31 42 31 31 31 21 43 26 42 30 48 33 32 25 46 30 23 43 33 31 18 25 46 29 22 27 30 30 31 24 21 31 23 31 32 31 24 33 26 31 46 17 16 14 18 23 44 46 35 31 32 19 46 31 17 31 30 33 41 41 28 30 26 32 38 42 18 11 48 48 48 48 32 33 27 29 17 33 15 11 22 21 9 25 16 24 31 24 20 14 31 21 22 31 13 33 28 34 32 34 32 17 17 10 11 31 24 16 4 4 17 33 43 23 21 10 13 12 30 31 20 16 28 26 19 23 36 34 7 11 10 18 20 22 21 14 16 15 26 24 28 18 17 15 27 28 16 16 21 18 5 15 34 6 3 6 18 20 15 9 23 16 21 8 6 27 9 21 18 14 10 12 8 6 5 11 14 30 27 14 7 5 20 4 3 3 11 17 24 17 9 24 9 6 10 8 11 7 8 17 7 10 15 22 12 18 19 14 7 3 2 4 4 4 6 18	Open. Hide. 46 35 56 42 62 62 62 62 62 47 39 20 20 34 12 23 27 28 27 28 32 38 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 49 49 62 62 62 62 54 49 43 43 62 49 43 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 59 62 59 56 54 54 54 28 42 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 59 59 62 62 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 43 62 62 49 38 62 47 38 62 62 62 62 62 62 62 47 54 62 62 49 53 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 53 54 58 52 54 52 58 58 58 49 54 34 58 58 58 52 45 42 58 58 58 58 49 58 58 54 52 58 58 58 52 49 58 58 58 58 54 58 49 58 58 46 58 58 58 58 54 58 52 54 54 52 52 42 45 32 37 41 58 42 30 45 49 54 39 58 45 52 52 58 42 41 54 47 58 49 58 52 58 47 42 46 52 58 52 58 54 47 29 58 52 53 58 58 40 47 58 51 50 41 35 50 48 58 51 41 49 58 54 54 53 58 58 41 58 50 58 58 58 58 41 50 53 50 58 42 42 50 58 58 48 50 58 58 58 50 26 39 58 50 41 50 58 52 40 53 53 47 49 53 53 51 32 58 51 39 14 58 39 33 38 33 50 51 41 31 46 47 50 37 58 58 58 58 52 58 33 29 40 52 39 23 51 31 30 46 52 39 53 32 58 50 49 51 49 39 51 29 36 37 39 42 54 49 42 31 54 54 34 21 49 41 54 47 32 42 28 35 47 45 34 40 26 51 34 54 37 32 38 52 39 54 29 33 54 10 44 42 39 40 18 40 44 27 42 41 51 54 45 37 32 35 53 37 46 13 54 52 38 54 33 23 33 32 32 42 42 54 54 33 30 54 46 28 23 42 37 38 53 35 35 36 32 53 31 24 34 35 32 47 12 23 32 21 22 34 29 41 32 33 35 45 18 41 21 36 32 29 32 36 21 32 21 31 32 46 32 21 28 32 42 20 7 29 23 25 45 41 19 25 43 33 51 13 29 24 25 19 28 29 31 42 27 31 43 20 29 12 26 46 32 22 9 13 21 29 9 37 7 22 21 33 31 21 19 9 19 31 19 19 7 36 46 14 7 6 18 13 20 26 33 46 46 32 26 18 25 29 8 6 10 31 14 18 18 31 11 11 13 20 24 29 10 9 19 27 41 46 30 24 30 32 21 24 15 31 31 31 14 26 18 31 31 14 26 23 23 16 23 25 8 8 29 31 43 33 24 12 5 5 28 19 14 15 26 12 8 8 14 27 24 8 16 28 22 11 8 10 23 32 21 27 26 8 8 14 7 19 24 16 30 22 34 22 19 21 11 7 7 14 17 10 16 20 34 18 31 7 6 17 6 25 25 17 7 5 6 8 21 25 19 15 12 18 29 22 12 28 9 12 5 6 5 3 3 20 6 3 3 6 13 4 34 38 40 16 12 7 9 25 9 27 7 6 34 17 22 13 11 27 10 11 17 9 9 23 9 11 6 9 22 28 7 7 8 16 17 8 27 34 25 9 25 28 26 24 8 23 21 8 11 10 11 24 25 16 13 8 7 10 4 3 4 12 12 22 7 12 9 13 28 23 22 7 11 6 7 4 19 20 21 14 5 5 4 20 12 7 23 22 16 21 16 22 23 6 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_149512794_149513869
seq2: B6Ng01-190P17.b_44_1111 (reverse)

seq1  CAGAGATTAAAAAGCTGAGTGTGCTTGTTAAGGGTGGGCTGTGGGGAGTT  50
      |||||||  ||||||||||||||||   |||||   |||||||||||| |
seq2  CAGAGAT--AAAAGCTGAGTGTGCT--GTAAGG--TGGCTGTGGGGAG-T  43

seq1  TGGTGGGGGTGGAGTTTCTGTTTAGGAAGATGGATGAACGCGTTC-AGGG  99
      |||||||||||||| ||||||||| |||||||||||||||||||| ||||
seq2  TGGTGGGGGTGGAG-TTCTGTTTA-GAAGATGGATGAACGCGTTCAAGGG  91

seq1  TAAGGATGGTAGGGATGGCCGTGGCTGTAGCAACAGTGTGACTACAATGA  149
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TAAGGATGGTAGGGAT-GCCGTGGCTGTAGCAACAGTGTGACTACAATGA  140

seq1  CCA-TTTTTGCACTTAAAATGGCCCGGAAATGGCAAAGTTGAGCTCTGTA  198
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTTTGCACTTAAAATGGCCCGGAAATGGCAAAGTTGAGCTCTGTA  190

seq1  TATTTCAATACGGCAAATATAAGACATGAAGAAACATTTTTGGTGCTGGT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTCAATACGGCAAATATAAGACATGAAGAAACATTTTTGGTGCTGGT  240

seq1  GACTTACAATGGGTTCATTAAAATAAAATACCGAGATGAAAATATTCATT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTACAATGGGTTCATTAAAATAAAATACCGAGATGAAAATATTCATT  290

seq1  TATGCTAGCCAGATATAGCAACGTATGATTCTCTCCTAAACCTTCCTTCG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGCTAGCCAGATATAGCAACGTATGATTCTCTCCTAAACCTTCCTTCG  340

seq1  AATTTATTGTTTGAGAGTATAAATTTAGGGCTTGAAATAGGTGAGTCCCT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTATTGTTTGAGAGTATAAATTTAGGGCTTGAAATAGGTGAGTCCCT  390

seq1  TCTCTATACAGCCATTTTACTTAACATTGTATTTCCCAAACAATGGAATG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTATACAGCCATTTTACTTAACATTGTATTTCCCAAACAATGGAATG  440

seq1  TATTTTTAAACACAATCCAGTGCCCACGTCGTTGTTGAGGTATAATTCAT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTTAAACACAATCCAGTGCCCACGTCGTTGTTGAGGTATAATTCAT  490

seq1  TTCACCCTTTTCTAATTCAGATATGTGGGTTTTCCCTGACGTTCTGTGTG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACCCTTTTCTAATTCAGATATGTGGGTTTTCCCTGACGTTCTGTGTG  540

seq1  GTAGATACCATACAAGTGTGAATGTTACCATTCTGAGCTTTGCCAGGTTC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGATACCATACAAGTGTGAATGTTACCATTCTGAGCTTTGCCAGGTTC  590

seq1  TGCCTGCTTCCGGAGTACTGGCTTCTTGGGACAGGGTCACTGGGTCAAAG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTGCTTCCGGAGTACTGGCTTCTTGGGACAGGGTCACTGGGTCAAAG  640

seq1  GGCAGGCTGTTGATTTAAACGGCTGTTTTACTTGTTTCTTTGCGCCTGTG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGCTGTTGATTTAAACGGCTGTTTTACTTGTTTCTTTGCGCCTGTG  690

seq1  AGTCCGTGGTCCTCTCCTTTGTTCCTTCAGGGACTGTGTGAACTATGCAC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCGTGGTCCTCTCCTTTGTTCCTTCAGGGACTGTGTGAACTATGCAC  740

seq1  AACTGCACTGGTTGGCTGTACCATTCTCACATTCCTGCGTTTGAATAGCT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGCACTGGTTGGCTGTACCATTCTCACATTCCTGCGTTTGAATAGCT  790

seq1  CCCTGCCAGGAAGCTGTGGTTGAACTCTTGACCCATCCCTAAGGTTGAAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGCCAGGAAGCTGTGGTTGAACTCTTGACCCATCCCTAAGGTTGAAC  840

seq1  CTAGCCATCTGCTGCTCAGAAGAGAGGCCAGACACTGTTGGGTTCTGTGT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCCATCTGCTGCTCAGAAGAGAGGCCAGACACTGTTGGGTTCTGTGT  890

seq1  GTGTCCTGGTTCCTGGATCACACAGGAAGGCAAAGAGTTGAGAAGGAAGT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCCTGGTTCCTGGATCACACAGGAAGGCAAAGAGTTGAGAAGGAAGT  940

seq1  GAAGCTACCCCCTGGGACACGCCCACCTGGGACACGCCCCCTCGCTTGGC  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTACCCCCTGGGACACGCCCACCTGGGACACGCCCCCTCGCTTGGC  990

seq1  TCTAGCTTTGTCCTAGCTTCTCACTATTCGGTCTCAAACACTCTGTTCAG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGCTTTGTCCTAGCTTCTCACTATTCGGTCTCAAACACTCTGTTCAG  1040

seq1  GAGCAAGGACAATGGCCGTTGGGAATTC  1076
      ||||||||||||||||||||||||||||
seq2  GAGCAAGGACAATGGCCGTTGGGAATTC  1068

seq1: chr5_149355146_149356288
seq2: B6Ng01-190P17.g_67_1222

seq1  GAATTCCTTGGAACATTTATGGATGAAATGAAATCAATTCTTAACAAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTGGAACATTTATGGATGAAATGAAATCAATTCTTAACAAAAA  50

seq1  ATTCTGCAATGTTTTCCAGATCATTTTATGAGGTCAATGTACTCTTGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGCAATGTTTTCCAGATCATTTTATGAGGTCAATGTACTCTTGACA  100

seq1  CCTAGATCTGCCAAAGATTTTTACAAGAAATTAAAATTGTTAATCAGCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGATCTGCCAAAGATTTTTACAAGAAATTAAAATTGTTAATCAGCCT  150

seq1  TTTCCATGAACAAAATCACAAGCATCTGATGTGAGGGATAAGCTAGCATA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCATGAACAAAATCACAAGCATCTGATGTGAGGGATAAGCTAGCATA  200

seq1  CTAAAAAATGTGGGCCTGGAGAGATGGCTCAGAGCACTTTGCTGCTCTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAAAATGTGGGCCTGGAGAGATGGCTCAGAGCACTTTGCTGCTCTTG  250

seq1  CAGAGACCCGGGTTCAATTCCCACCACCTACATTACCATTCATAACTATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGACCCGGGTTCAATTCCCACCACCTACATTACCATTCATAACTATC  300

seq1  AGTAAATCAGTTCCAGGTGATCCAACGTCTTCTTGTGACCTCCTCAGATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAATCAGTTCCAGGTGATCCAACGTCTTCTTGTGACCTCCTCAGATA  350

seq1  TCAAGCAGGCACATGGTTGGTGCACACACACATACAGACAAAACACACAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCAGGCACATGGTTGGTGCACACACACATACAGACAAAACACACAT  400

seq1  ATAAGAAGTAAATCTGTAAATAAAGTATTTTTTTAAAAAAAGAAAATGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGAAGTAAATCTGTAAATAAAGTATTTTTTTAAAAAAAGAAAATGCA  450

seq1  GCTATTTGTGGTAGCACATGCTTCTAATCCCAGCACTAAGGAGGCTGAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATTTGTGGTAGCACATGCTTCTAATCCCAGCACTAAGGAGGCTGAGC  500

seq1  CAGGAGGATGGAGATCCAGGATAGCCTGGGCTATCCAGATACAAGGGAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGGATGGAGATCCAGGATAGCCTGGGCTATCCAGATACAAGGGAGA  550

seq1  CCTGGACCCGATCTCAAAACAAAAGCCAAAGGGAAGGGAAAAGACAGGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGACCCGATCTCAAAACAAAAGCCAAAGGGAAGGGAAAAGACAGGAG  600

seq1  AGAGGGCGTAGTAAAATAGCCACATTCAACTGGTAAGTCAAGGGTTTTGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGGCGTAGTAAAATAGCCACATTCAACTGGTAAGTCAAGGGTTTTGC  650

seq1  TTTGTTTTTTAATTATGAAATTGGTACCTTCCCATCTATGACTTCAATAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTTAATTATGAAATTGGTACCTTCCCATCTATGACTTCAATAA  700

seq1  CTGACCTATTTTTTGGCACAACAACTACATTCCTAAGAACTTTATTTTAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACCTATTTTTTGGCACAACAACTACATTCCTAAGAACTTTATTTTAA  750

seq1  GGAGTACTCACAAGGCATGTTTGAGAATAGCCATGAAACTACTGTTTCCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTACTCACAAGGCATGTTTGAGAATAGCCATGAAACTACTGTTTCCC  800

seq1  ACAGCTTTTAAATACCTGCTGTGGTCTGAGTGTATCCTGAAGAGTCAGGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCTTTTAAATACCTGCTGTGGTCTGAGTGTATCCTGAAGAGTCAGGT  850

seq1  GTTGGGAACTCAATCCCCAATGTGGCACTGGTGAGGTGGGGACTT-AAGG  899
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GTTGGGAACTCAATCCCCAATGTGGCACTGGTGAGGTGGGGACTTAAAGG  900

seq1  AAGCTAAGGCTTAGGCCTCTCCCCACACCTCCCAGTCTCCTG-TGCTTTC  948
      ||||||||||||| |||||||||||||||||||||||||||| |||||||
seq2  AAGCTAAGGCTTA-GCCTCTCCCCACACCTCCCAGTCTCCTGTTGCTTTC  949

seq1  TAGACTTACAGCAGCAAGGAATGAAACAG-AATGATGTCTGCAAATGTGC  997
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TAGACTTACAGCAGCAAGGAATGAAACAGAAATGATGTCTGCAAATGTGC  999

seq1  AAA-TAGTTAAGTAAC-TGACATCCACT-AGAATCA-GTTTAATGA-TTC  1042
      ||| |||||||||||| ||||||||||| ||||||| ||||||||| |||
seq2  AAATTAGTTAAGTAACTTGACATCCACTAAGAATCAGGTTTAATGATTTC  1049

seq1  TATTACAATGTGGTTTTATCCTTATTTGTATAGATGATGTGACTGCA-TA  1091
      || ||||||||| |||||||| ||||||||||||||||||||||||| ||
seq2  TA-TACAATGTGTTTTTATCCCTATTTGTATAGATGATGTGACTGCATTA  1098

seq1  AAAAAAATCAAGTATTTCTAAAGCAA--AATTTTAC--TTTTC--TATTA  1135
      || |||||||||||||||||| ||||  ||||||||   ||||  | |||
seq2  AAGAAAATCAAGTATTTCTAAGGCAAACAATTTTACCTCTTTCGATTTTA  1148

seq1  AAGAAAAT  1143
      ||||||||
seq2  AAGAAAAT  1156

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information