MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-194L19
Chromosome	5 (Build37)
Map Location	115,089,988 - 115,235,251
singlet/doublet	doublet
Overlap gene	Trpv4, Gltp, Tchp, Git2, 4930515G01Rik, Ankrd13a
Upstream gene	Cmklr1, LOC381707, D5Ertd40e, Sart3, LOC100041786, Iscu, Tmem119, Selplg, Coro1c, Ssh1, Dao1, Svop, Usp30, Alkbh2, Ung, Acacb, Foxn4, Myo1h, Kctd10, Ube3b, Mmab, Mvk, BC057022
Downstream gene	1500011B03Rik, 2610524H06Rik, LOC664895, 4930519G04Rik, Oasl2, Oasl1, 2210016L21Rik, Tcf1, Sppl3, Acads, AA407659, 2410014A08Rik, Cabp1, Pop5, Rnf10, Coq5, Dynll1, Sfrs9, 2010003O18Rik, Triap1, Cox6a1, Msi1, Pla2g1b, Sirt4, LOC638021, Pxn, Arbp, Gcn1l1, LOC100042199, Rab35, Ccdc64
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cmklr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14747 MGI:109603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC381707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:381707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D5Ertd40e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231630 MGI:1098550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sart3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53890 MGI:1858230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041786 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 496 ESTs, 1 Protein

name	Iscu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66383 MGI:1913633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231633 MGI:2385228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Selplg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20345 MGI:106689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23790 MGI:1345964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231637 MGI:2686240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dao1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13142 MGI:94859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Svop (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68666 MGI:1915916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100756 MGI:2140991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alkbh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231642 MGI:2141032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ung (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Acacb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100705 MGI:2140940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116810 MGI:2151057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231646 MGI:1914674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 9 Proteins

name	Kctd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330171 MGI:2141207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117146 MGI:1891295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77697 MGI:1924947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mvk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17855 MGI:107624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433940 MGI:3605543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63873 MGI:1926945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gltp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56356 MGI:1929253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tchp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77832 MGI:1925082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Git2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	4930515G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68420 MGI:1915670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500011B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66236 MGI:1913486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 111 ESTs

name	2610524H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330173 MGI:2447819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 194 ESTs, 7 Proteins pseudo : _no_value

name	4930519G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67593 MGI:1914843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oasl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23962 MGI:1344390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oasl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231655 MGI:2180849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210016L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72357 MGI:1919607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21405 MGI:98504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sppl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74585 MGI:1891433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acads (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11409 MGI:87868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA407659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106840 MGI:2147162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410014A08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109154 MGI:1924015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29867 MGI:1352750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pop5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117109 MGI:2151221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50849 MGI:1859162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52064 MGI:1098643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dynll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56455 MGI:1861457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108014 MGI:104896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010003O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384281 MGI:1923776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Triap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69076 MGI:1916326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12861 MGI:103099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17690 MGI:107376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18778 MGI:101842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75387 MGI:1922637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs, 7 Proteins

name	LOC638021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Pxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Arbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11837 MGI:88066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcn1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231659 MGI:2444248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs

name	Rab35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77407 MGI:1924657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75665 MGI:1922915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmklr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71896663 GeneID:14747 MGI:109603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine-like receptor 1 transcript_id : NM_008153.2

name	LOC381707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254532 GeneID:381707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC381707 transcript_id : XM_001471974.1

name	D5Ertd40e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803114 GeneID:231630 MGI:1098550
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 40, expressed transcript_id : NM_001010825.2

name	Sart3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394238 GeneID:53890 MGI:1858230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : squamous cell carcinoma antigen recognized by T-cells 3 transcript_id : NM_016926.1

name	LOC100041786 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254565 GeneID:100041786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 496 ESTs, 1 Protein product : similar to 40S ribosomal protein S28 transcript_id : XM_001478306.1

name	Iscu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803041 GeneID:66383 MGI:1913633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IscU iron-sulfur cluster scaffold homolog (E. coli) transcript_id : NM_025526.2

name	Tmem119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343950 GeneID:231633 MGI:2385228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 119 transcript_id : NM_146162.2

name	Selplg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982018 GeneID:20345 MGI:106689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selectin, platelet (p-selectin) ligand transcript_id : NM_009151.2

name	Coro1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365603 GeneID:23790 MGI:1345964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1C transcript_id : NM_011779.3

name	Ssh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350170 GeneID:231637 MGI:2686240
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 1 (Drosophila) transcript_id : NM_198109.3

name	Dao1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815856 GeneID:13142 MGI:94859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : D-amino acid oxidase 1 transcript_id : NM_010018.2

name	Svop (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72534842 GeneID:68666 MGI:1915916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SV2 related protein transcript_id : NM_026805.1

name	Usp30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348786 GeneID:100756 MGI:2140991
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 30 transcript_id : NM_001033202.2

name	Alkbh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098161 GeneID:231642 MGI:2141032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alkB, alkylation repair homolog 2 (E. coli) transcript_id : NM_175016.2

name	Ung (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943607 GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uracil DNA glycosylase transcript_id : NM_001040691.1

name	Ung (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:101943420 GeneID:22256 MGI:109352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uracil DNA glycosylase transcript_id : NM_011677.2

name	Acacb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976024 GeneID:100705 MGI:2140940
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetyl-Coenzyme A carboxylase beta transcript_id : NM_133904.1

name	Foxn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598890 GeneID:116810 MGI:2151057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box N4 transcript_id : NM_148935.2

name	Myo1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254534 GeneID:231646 MGI:1914674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 9 Proteins product : myosin 1H transcript_id : XM_972888.2

name	Kctd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387975 GeneID:330171 MGI:2141207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 10 transcript_id : NM_026145.3

name	Ube3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533241 GeneID:117146 MGI:1891295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3B transcript_id : NM_054093.2

name	Mmab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373343 GeneID:77697 MGI:1924947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylmalonic aciduria (cobalamin deficiency) type B homolog (human) transcript_id : NM_029956.3

name	Mvk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980640 GeneID:17855 MGI:107624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mevalonate kinase transcript_id : NM_023556.2

name	BC057022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921354 GeneID:433940 MGI:3605543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057022 transcript_id : NM_001004180.1

name	Trpv4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11528501 GeneID:63873 MGI:1926945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 4 transcript_id : NM_022017.1

name	Gltp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560403 GeneID:56356 MGI:1929253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycolipid transfer protein transcript_id : NM_019821.2

name	Tchp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794203 GeneID:77832 MGI:1925082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trichoplein, keratin filament binding transcript_id : NM_029992.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517289 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077359.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517296 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_019834.3

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517294 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077360.1

name	Ankrd13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651674 GeneID:68420 MGI:1915670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13a transcript_id : NM_026718.2

name	1500011B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254567 GeneID:66236 MGI:1913486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 109 ESTs product : RIKEN cDNA 1500011B03 gene, transcript variant 2 transcript_id : XM_001478612.1

name	2610524H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624788 GeneID:330173 MGI:2447819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610524H06 gene transcript_id : NM_181075.3

name	4930519G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286836 GeneID:67593 MGI:1914843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519G04 gene transcript_id : NM_026263.2

name	Oasl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053897 GeneID:23962 MGI:1344390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase-like 2 transcript_id : NM_011854.2

name	Oasl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381213 GeneID:231655 MGI:2180849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase-like 1 transcript_id : NM_145209.3

name	2210016L21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930440 GeneID:72357 MGI:1919607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210016L21 gene transcript_id : NM_028211.1

name	Tcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364916 GeneID:21405 MGI:98504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 1 transcript_id : NM_009327.2

name	Sppl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62530193 GeneID:74585 MGI:1891433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal peptide peptidase 3 transcript_id : NM_029012.2

name	Acads (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982521 GeneID:11409 MGI:87868
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase, short chain transcript_id : NM_007383.2

name	AA407659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384032 GeneID:106840 MGI:2147162
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA407659 transcript_id : NM_175352.3

name	2410014A08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341805 GeneID:109154 MGI:1924015
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410014A08 gene transcript_id : NM_175403.2

name	Cabp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948853 GeneID:29867 MGI:1352750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 1 transcript_id : NM_013879.2

name	Pop5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347939 GeneID:117109 MGI:2151221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae) transcript_id : NM_026398.3

name	Rnf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710089 GeneID:50849 MGI:1859162
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 10 transcript_id : NM_016698.1

name	Coq5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378282 GeneID:52064 MGI:1098643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q5 homolog, methyltransferase (yeast) transcript_id : NM_026504.2

name	Dynll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358000 GeneID:56455 MGI:1861457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain LC8-type 1 transcript_id : NM_019682.3

name	Sfrs9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130304 GeneID:108014 MGI:104896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine rich 9 transcript_id : NM_025573.3

name	2010003O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388151 GeneID:384281 MGI:1923776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010003O18 gene transcript_id : NM_029645.3

name	Triap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344163 GeneID:69076 MGI:1916326
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TP53 regulated inhibitor of apoptosis 1 transcript_id : NM_026933.2

name	Cox6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131168 GeneID:12861 MGI:103099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VI a, polypeptide 1 transcript_id : NM_007748.3

name	Msi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678939 GeneID:17690 MGI:107376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Musashi homolog 1(Drosophila) transcript_id : NM_008629.1

name	Pla2g1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755089 GeneID:18778 MGI:101842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IB, pancreas transcript_id : NM_011107.1

name	Sirt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254537 GeneID:75387 MGI:1922637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs, 7 Proteins product : sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) transcript_id : XM_485674.5

name	Pxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326501 GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paxillin transcript_id : NM_133915.2

name	Pxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326500 GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paxillin transcript_id : NM_011223.2

name	Arbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372948 GeneID:11837 MGI:88066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acidic ribosomal phosphoprotein P0 transcript_id : NM_007475.3

name	Gcn1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807185 GeneID:231659 MGI:2444248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN1 general control of amino-acid synthesis 1-like 1 (yeast) transcript_id : NM_172719.2

name	LOC100042199 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254569 GeneID:100042199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs product : hypothetical protein LOC100042199 transcript_id : XM_001478983.1

name	Rab35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718982 GeneID:77407 MGI:1924657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB35, member RAS oncogene family transcript_id : NM_198163.1

name	Ccdc64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248513 GeneID:75665 MGI:1922915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 64 transcript_id : NM_001080808.1

name	LOC381707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254533 GeneID:381707
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472024.1

name	D5Ertd40e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58082051 GeneID:231630 MGI:1098550
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : huntingtin interacting protein E product : huntingtin interactor protein E protein_id : NP_001010825.1

name	Sart3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394239 CCDS:CCDS19552.1 GeneID:53890 MGI:1858230
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] codon_start : 1 product : squamous cell carcinoma antigen recognized by T-cells 3 protein_id : NP_058622.1

name	LOC100041786 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254566 GeneID:100041786
definition	codon_start : 1 product : similar to 40S ribosomal protein S28 protein_id : XP_001478356.1

name	Iscu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313484 CCDS:CCDS19553.1 GeneID:66383 MGI:1913633
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : NifU-like N-terminal domain containing product : nitrogen fixation cluster-like protein_id : NP_079802.1

name	Tmem119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122697 CCDS:CCDS19554.1 GeneID:231633 MGI:2385228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC231633 protein_id : NP_666274.1

name	Selplg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982019 GeneID:20345 MGI:106689
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : selectin, platelet (p-selectin) ligand protein_id : NP_033177.2

name	Coro1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542413 CCDS:CCDS19555.1 GeneID:23790 MGI:1345964
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0000147 - actin cortical patch assembly [Evidence TAS]; GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0006909 - phagocytosis [Evidence TAS] codon_start : 1 note : coronin 1c; coronin 3 product : coronin, actin binding protein 1C protein_id : NP_035909.2

name	Ssh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271413 CCDS:CCDS19556.1 GeneID:231637 MGI:2686240
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot 1L; slingshot-like 1 product : slingshot homolog 1 protein_id : NP_932777.2

name	Dao1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815857 CCDS:CCDS19557.1 GeneID:13142 MGI:94859
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003884 - D-amino-acid oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : D-amino acid oxidase 1 protein_id : NP_034148.2

name	Svop (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72534843 GeneID:68666 MGI:1915916
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015075 - ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 product : SV2 related protein protein_id : NP_081081.1

name	Usp30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986575 CCDS:CCDS19558.1 GeneID:100756 MGI:2140991
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 30 protein_id : NP_001028374.1

name	Alkbh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098162 CCDS:CCDS19559.1 GeneID:231642 MGI:2141032
definition	GO_function : GO:0051747 - DNA demethylase activity [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IDA]; GO:0004527 - exonuclease activity [Evidence IDA] codon_start : 1 product : alkB, alkylation repair homolog 2 protein_id : NP_778181.2

name	Ung (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101943608 GeneID:22256 MGI:109352
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IDA] [Evidence IMP]; GO:0045437 - uridine nucleosidase activity [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IGI]; GO:0016447 - somatic recombination of immunoglobulin gene segments [Evidence IMP] [Evidence IGI] codon_start : 1 note : isoform a is encoded by transcript variant 1; uracil-DNA glycosylase product : uracil DNA glycosylase isoform a protein_id : NP_001035781.1

name	Ung (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:101943421 CCDS:CCDS19560.1 GeneID:22256 MGI:109352
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence IDA] [Evidence IMP]; GO:0045437 - uridine nucleosidase activity [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IGI]; GO:0016447 - somatic recombination of immunoglobulin gene segments [Evidence IMP] [Evidence IGI] codon_start : 1 note : isoform b is encoded by transcript variant 2; uracil-DNA glycosylase product : uracil DNA glycosylase isoform b protein_id : NP_035807.2

name	Acacb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48976025 CCDS:CCDS19561.1 GeneID:100705 MGI:2140940
definition	GO_function : GO:0003989 - acetyl-CoA carboxylase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0009374 - biotin binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acetyl-Coenzyme A carboxylase beta protein_id : NP_598665.1

name	Foxn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598891 CCDS:CCDS19562.1 GeneID:116810 MGI:2151057
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box N4 protein_id : NP_683737.2

name	Myo1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254535 GeneID:231646 MGI:1914674
definition	codon_start : 1 product : myosin 1H protein_id : XP_977982.2

name	Kctd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29725637 CCDS:CCDS19563.1 GeneID:330171 MGI:2141207
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerization domain-containing 10 protein_id : NP_080421.2

name	Ube3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68533242 CCDS:CCDS19564.1 GeneID:117146 MGI:1891295
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 product : ubiquitin protein ligase E3B protein_id : NP_473434.2

name	Mmab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313396 CCDS:CCDS19565.1 GeneID:77697 MGI:1924947
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008817 - cob(I)yrinic acid a,c-diamide adenosyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATP:Cob(I)alamin Adenosyltransferase product : methylmalonic aciduria (cobalamin deficiency) type B homolog protein_id : NP_084232.1

name	Mvk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963731 CCDS:CCDS19566.1 GeneID:17855 MGI:107624
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004496 - mevalonate kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 product : mevalonate kinase protein_id : NP_076045.1

name	BC057022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921355 CCDS:CCDS19567.1 GeneID:433940 MGI:3605543
definition	codon_start : 1 product : hypothetical protein LOC433940 protein_id : NP_001004180.1

name	Trpv4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528502 CCDS:CCDS19568.1 GeneID:63873 MGI:1926945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] [Evidence ISS]; GO:0005034 - osmosensor activity [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0042538 - hyperosmotic salinity response [Evidence IMP]; GO:0007231 - osmosensory signaling pathway [Evidence IMP] [Evidence ISS] [Evidence IDA]; GO:0006884 - regulation of cell volume [Evidence ISS]; GO:0047484 - regulation of response to osmotic stress [Evidence IMP]; GO:0009612 - response to mechanical stimulus [Evidence ISS]; GO:0006970 - response to osmotic stress [Evidence IPI] [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0030103 - vasopressin secretion [Evidence IMP] codon_start : 1 exception : mismatches in translation note : osmosensitive transient receptor potential channel 4 product : transient receptor potential cation channel, subfamily V, member 4 protein_id : NP_071300.1

name	Gltp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560404 CCDS:CCDS19569.1 GeneID:56356 MGI:1929253
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0051861 - glycolipid binding [Evidence ISS]; GO:0017089 - glycolipid transporter activity [Evidence ISS] GO_process : GO:0046836 - glycolipid transport [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : glycolipid transfer protein protein_id : NP_062795.2

name	Tchp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794204 GeneID:77832 MGI:1925082
definition	GO_component : GO:0045179 - apical cortex [Evidence ISS]; GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence ISS] codon_start : 1 product : trichoplein, keratin filament binding protein_id : NP_084268.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517297 CCDS:CCDS19570.1 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 1 protein_id : NP_062808.3

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517295 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 3 protein_id : NP_001070828.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517290 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 2 protein_id : NP_001070827.1

name	Ankrd13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651675 CCDS:CCDS19572.1 GeneID:68420 MGI:1915670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 13a protein_id : NP_080994.2

name	1500011B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254568 GeneID:66236 MGI:1913486
definition	codon_start : 1 product : hypothetical protein LOC66236 isoform 2 protein_id : XP_001478662.1

name	2610524H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841010 GeneID:330173 MGI:2447819
definition	codon_start : 1 product : hypothetical protein LOC330173 protein_id : NP_851420.1

name	4930519G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735437 CCDS:CCDS19574.1 GeneID:67593 MGI:1914843
definition	codon_start : 1 product : hypothetical protein LOC67593 protein_id : NP_080539.1

name	Oasl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053898 GeneID:23962 MGI:1344390
definition	GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : 2'-5' oligoadenylate synthetase-like product : 2'-5' oligoadenylate synthetase-like 2 protein_id : NP_035984.2

name	Oasl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630289 CCDS:CCDS19575.1 GeneID:231655 MGI:2180849
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : 2,5-oligoadenylate synthetase-like 9 product : 2'-5' oligoadenylate synthetase-like 1 protein_id : NP_660210.1

name	2210016L21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930441 CCDS:CCDS19576.1 GeneID:72357 MGI:1919607
definition	codon_start : 1 product : hypothetical protein LOC72357 protein_id : NP_082487.1

name	Tcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678241 CCDS:CCDS19577.1 GeneID:21405 MGI:98504
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0045453 - bone resorption [Evidence IGI]; GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hepatocyte nuclear factor 1 product : transcription factor 1 protein_id : NP_033353.1

name	Sppl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62530194 CCDS:CCDS19578.1 GeneID:74585 MGI:1891433
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : upregulated during skeletal muscle growth 3; presenilin-like protein 4 product : signal peptide peptidase 3 protein_id : NP_083288.2

name	Acads (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982522 CCDS:CCDS19579.1 GeneID:11409 MGI:87868
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0004085 - butyryl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acetyl-Coenzyme A dehydrogenase, short chain; short-chain acyl-CoA dehydrogenase product : acyl-Coenzyme A dehydrogenase, short chain protein_id : NP_031409.2

name	AA407659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425054 CCDS:CCDS19580.1 GeneID:106840 MGI:2147162
definition	codon_start : 1 product : hypothetical protein LOC106840 protein_id : NP_780561.1

name	2410014A08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425112 CCDS:CCDS19581.1 GeneID:109154 MGI:1924015
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC109154 protein_id : NP_780612.1

name	Cabp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304939 CCDS:CCDS19582.1 GeneID:29867 MGI:1352750
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 1 protein_id : NP_038907.1

name	Pop5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270200 CCDS:CCDS19583.1 GeneID:117109 MGI:2151221
definition	GO_component : GO:0005655 - nucleolar ribonuclease P complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000172 - ribonuclease MRP complex [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0000171 - ribonuclease MRP activity [Evidence ISS]; GO:0004526 - ribonuclease P activity [Evidence IDA] GO_process : GO:0006364 - rRNA processing [Evidence ISS]; GO:0008033 - tRNA processing [Evidence IDA] codon_start : 1 note : RNase MRP/RNase P protein-like product : processing of precursor 5, ribonuclease P/MRP family protein_id : NP_080674.1

name	Rnf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710090 CCDS:CCDS19584.1 GeneID:50849 MGI:1859162
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 10 protein_id : NP_057907.1

name	Coq5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385992 CCDS:CCDS19585.1 GeneID:52064 MGI:1098643
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006744 - ubiquinone biosynthesis [Evidence IEA] codon_start : 1 product : coenzyme Q5 homolog, methyltransferase protein_id : NP_080780.1

name	Dynll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981035 GeneID:56455 MGI:1861457
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence TAS]; GO:0045019 - negative regulation of nitric oxide biosynthesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : protein inhibitor of nitric oxide synthase; 8kD LC; 8kDa LC; dynein, cytoplasmic, light chain 1 product : dynein, cytoplasmic, light peptide protein_id : NP_062656.2

name	Sfrs9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385016 CCDS:CCDS19587.1 GeneID:108014 MGI:104896
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA] codon_start : 1 note : splicing factor, arginine/serine rich 9 (25 kDa) product : splicing factor, arginine/serine rich 9 protein_id : NP_079849.1

name	2010003O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059159 CCDS:CCDS19588.1 GeneID:384281 MGI:1923776
definition	GO_function : GO:0017068 - glutamyl-tRNA(Gln) amidotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006450 - regulation of translational fidelity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC384281 protein_id : NP_083921.1

name	Triap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312202 GeneID:69076 MGI:1916326
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0006977 - DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest [Evidence ISS] codon_start : 1 product : p53-inducible cell-survival factor protein_id : NP_081209.1

name	Cox6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680988 CCDS:CCDS19590.1 GeneID:12861 MGI:103099
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : subunit VIaL (liver-type) product : cytochrome c oxidase, subunit VI a, polypeptide 1 protein_id : NP_031774.1

name	Msi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678940 CCDS:CCDS19591.1 GeneID:17690 MGI:107376
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005844 - polysome [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008266 - poly(U) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] codon_start : 1 product : Musashi homolog 1 protein_id : NP_032655.1

name	Pla2g1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755090 CCDS:CCDS19592.1 GeneID:18778 MGI:101842
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence TAS]; GO:0006644 - phospholipid metabolism [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 product : phospholipase A2, group IB, pancreas protein_id : NP_035237.1

name	Sirt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254538 GeneID:75387 MGI:1922637
definition	codon_start : 1 product : sirtuin 4 (silent mating type information regulation 2 homolog) 4 protein_id : XP_485674.5

name	Pxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326502 GeneID:19303 MGI:108295
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] [Evidence TAS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048754 - branching morphogenesis of a tube [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS] [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform beta is encoded by transcript variant beta product : paxillin isoform beta protein_id : NP_598676.2

name	Pxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21281693 CCDS:CCDS19593.1 GeneID:19303 MGI:108295
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] [Evidence TAS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048754 - branching morphogenesis of a tube [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS] [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform alpha is encoded by transcript variant alpha product : paxillin isoform alpha protein_id : NP_035353.1

name	Arbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671569 CCDS:CCDS19594.1 GeneID:11837 MGI:88066
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0042254 - ribosome biogenesis and assembly [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 product : acidic ribosomal phosphoprotein P0 protein_id : NP_031501.1

name	Gcn1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807186 CCDS:CCDS19595.1 GeneID:231659 MGI:2444248
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : GCN1 general control of amino-acid synthesis 1-like 1 protein_id : NP_766307.2

name	LOC100042199 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254570 GeneID:100042199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479033.1

name	Rab35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718983 CCDS:CCDS19596.1 GeneID:77407 MGI:1924657
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB35, member RAS oncogene family protein_id : NP_937806.1

name	Ccdc64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248514 GeneID:75665 MGI:1922915
definition	codon_start : 1 product : coiled-coil domain containing 64 protein_id : NP_001074277.1

name	LOC638021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638021
definition	number : 1 pseudo : _no_value

name	4930515G01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254529 GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930515G01 gene transcript_id : XR_035133.1

name	LOC664895 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254536 GeneID:664895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 194 ESTs, 7 Proteins product : similar to Ywhaq protein pseudo : _no_value transcript_id : XR_030651.1

clone name	MSMg01-268G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-194L19.b	B6Ng01-194L19.g
ACC	GA017350	GA017351
length	994	399
definition	B6Ng01-194L19.b	B6Ng01-194L19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(115,089,988 - 115,090,951)	(115,234,847 - 115,235,251)
sequence	gaattccgtaacgtggtgaaggatgcaggagtccagactctacccaatga tcttctgtgtgtttggcccaaagagatacgcaaaccggggaagaggatta cccaagcagagcagacccctccccctgcccactggtgcggctcaccccgg aactcctcatcagtcaggcgcttcttgtgggtcaacaagaaggagagcag tccatctaggtccgcagtggagccccgggacacaatgtcaaagaggatgg gccgattgaagactttgaggatggggggtggctggggtgcaggagctttg gggctctgtggctgcttcctagaagggaaaaaagaaggataccaggagtt tagcctctgcctgcactgtgctccctcacctaaggtagtcagaggttggg ggaaatgaaacccaagggactaaagaatactatgggatgctttgcccagg aagaggtaagctggcctactgtgtgttgggcagaaaaacaggaaaaggat gcaagcctgcacatcctctagcccacccacctcccccctccatctaacca ctcactcactcagtcacctatccacccacccatccatccatctgtccacc cacccacccacccatccatccatctatccactcacccacccatccatcca tctacccactcatcacccatccatccatccctctattcacccactcaccc ctccccccactcaccccctccctccatcttttatgctcatctgttcatcc tttccacctcaccactcgctgcctacccccttcatccctctcacctgcct attcatcttcccccgtcctccatctaacattttactgaacacctttgtgt gtgagagacagggtcttgtgttcacccagaacttggttttgttaagagac attgccaacccaaactgatcttggattgtcccacccttggcctccttgaa atgatggggacgtcaatgcaagccaactatgtccttgcctttat	cagatgcccaggagcagcagcagaggacacagcaggcctcactgagcggg agtgagacctgtcggacacgcccgtgaacatgcgtgtacaggaatcggag aggacacacatcgtttctcaacatacactgggtctgcggtcctccctctt ccccttggctccccagagccaagtggcccagtctgatggtgtatcagtgt cctggctctgcctgtgctgcacaactgcaagttcttccaaggacacggtg aacaggagtctttctgagcgccagccggtccttgggaaagaaaggggctt tgccttgacagtccagttgtttaggtacaaaccatagtcttcaaacaatc gcctcacaggcctgaggaaggaagttgagcgggacgggggggggggggg
quality values	Open. Hide. 43 31 28 41 62 62 47 47 62 62 62 54 62 62 62 62 62 62 49 62 62 54 44 20 47 62 62 62 62 59 62 62 51 47 36 28 37 40 62 62 59 62 62 62 59 49 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 54 62 62 59 59 62 59 54 62 62 62 62 54 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 54 62 62 62 62 59 62 62 62 62 62 59 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 46 62 62 51 62 62 62 47 47 62 62 62 62 62 56 56 56 56 62 56 62 51 62 62 62 62 62 62 47 42 56 62 62 62 62 62 56 56 62 62 62 62 41 47 62 42 47 62 62 62 62 56 56 56 47 62 62 47 54 62 45 47 62 62 47 56 62 56 52 40 62 54 62 62 62 52 24 33 47 62 38 47 52 47 43 46 48 62 43 47 62 62 52 52 62 62 62 52 26 18 17 10 24 20 47 62 62 39 42 39 46 52 39 42 32 47 38 47 28 40 38 54 58 43 43 45 48 48 48 32 47 46 46 46 52 52 46 50 41 39 34 33 34 33 37 33 42 34 52 52 42 41 37 38 32 33 19 34 25 52 52 52 27 19 52 39 52 40 35 33 34 31 48 38 52 25 28 42 52 54 52 48 50 52 52 52 52 48 41 42 51 46 41 35 33 47 34 19 32 39 52 52 52 50 25 17 50 19 7 37 23 27 38 46 50 29 26 39 46 50 50 50 47 33 32 39 31 34 23 20 16 27 39 32 27 18 25 37 16 20 23 31 50 49 36 43 37 50 40 46 32 37 54 50 45 21 42 42 42 40 58 34 34 40 35 37 28 28 50 40 51 28 39 49 32 19 41 15 24 24 25 15 25 22 21 33 29 39 39 31 33 25 35 7 12 34 32 26 24 21 39 32 39 25 8 5 20 20 26 37 51 54 13 16 35 26 36 47 18 17 13 22 9 10 10 25 35 25 30 11 24 21 10 32 24 21 12 16 23 28 39 54 32 17 26 26 32 31 12 13 7 7 12 13 19 34 17 18 7 25 17 6 14 6 16 11 11 30 23 24 28 7 12 51 18 20 7 6 24 15 8 13 12 19 13 20 21 29 34 45 11 8 22 40 28 31 21 15 25 25 28 24 12 5 9 6 6 9 21 31 35 24 24 26 40 11 17 33 32 11 6 5 22 10 9 22 31 24 21 51 7 18 19 12 8 37 40 41 7 24 9 9 14 13 12 15 30 31 18 21 22 20 7 34 9 10 18 31 31 25 21 10 11 26 8 11 26 9 7 31 30 21 16 23	Open. Hide. 59 36 62 59 62 62 62 59 59 43 32 32 26 33 56 59 62 62 62 62 62 62 62 59 59 62 59 49 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 54 59 62 62 62 62 33 42 62 62 62 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 46 62 62 62 62 62 62 62 62 62 41 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_115089988_115090951
seq2: B6Ng01-194L19.b_49_1029

seq1  GAATTCCGTAACGTGGTGAAGGATGCAGGAGTCCAGACTCTACCCAATGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCGTAACGTGGTGAAGGATGCAGGAGTCCAGACTCTACCCAATGA  50

seq1  TCTTCTGTGTGTTTGGCCCAAAGAGATACGCAAACCGGGGAAGAGGATTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCTGTGTGTTTGGCCCAAAGAGATACGCAAACCGGGGAAGAGGATTA  100

seq1  CCCAAGCAGAGCAGACCCCTCCCCCTGCCCACTGGTGCGGCTCACCCCGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGCAGAGCAGACCCCTCCCCCTGCCCACTGGTGCGGCTCACCCCGG  150

seq1  AACTCCTCATCAGTCAGGCGCTTCTTGTGGGTCAACAAGAAGGAGAGCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCTCATCAGTCAGGCGCTTCTTGTGGGTCAACAAGAAGGAGAGCAG  200

seq1  TCCATCTAGGTCCGCAGTGGAGCCCCGGGACACAATGTCAAAGAGGATGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATCTAGGTCCGCAGTGGAGCCCCGGGACACAATGTCAAAGAGGATGG  250

seq1  GCCGATTGAAGACTTTGAGGATGGGGGGTGGCTGGGGTGCAGGAGCTTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGATTGAAGACTTTGAGGATGGGGGGTGGCTGGGGTGCAGGAGCTTTG  300

seq1  GGGCTCTGTGGCTGCTTCCTAGAAGGGAAAAAAGAAGGATACCAGGAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTCTGTGGCTGCTTCCTAGAAGGGAAAAAAGAAGGATACCAGGAGTT  350

seq1  TAGCCTCTGCCTGCACTGTGCTCCCTCACCTAAGGTAGTCAGAGGTTGGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCTCTGCCTGCACTGTGCTCCCTCACCTAAGGTAGTCAGAGGTTGGG  400

seq1  GGAAATGAAACCCAAGGGACTAAAGAATACTATGGGATGCTTTGCCCAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATGAAACCCAAGGGACTAAAGAATACTATGGGATGCTTTGCCCAGG  450

seq1  AAGAGGTAAGCTGGCCTACTGTGTGTTGGGCAGAAAAACAGGAAAAGGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGTAAGCTGGCCTACTGTGTGTTGGGCAGAAAAACAGGAAAAGGAT  500

seq1  GCAAGCCTGCACATCCTCTAGCCCACCCACCTCCCCCCTCCATCTAACCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCCTGCACATCCTCTAGCCCACCCACCTCCCCCCTCCATCTAACCA  550

seq1  CTCACTCACTCAGTCACCTATCCACCCACCCATCCATCCATCTGTCCACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTCACTCAGTCACCTATCCACCCACCCATCCATCCATCTGTCCACC  600

seq1  CACCCACCCACCCATCCATCCATCTATCCACTCACCCACCCATCCATCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCACCCACCCATCCATCCATCTATCCACTCACCCACCCATCCATCCA  650

seq1  TCTACCCACTCATCACCCATCCATCCATCCCTCTATTCACCCACTCACCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACCCACTCATCACCCATCCATCCATCCCTCTATTCACCCACTCACCC  700

seq1  CTCCCCCCACTCA-CCCCTCCCTCCATC-TTTATGCTCATCTGTTCATCC  748
      ||||||||||||| |||||||||||||| |||||||||||||||||||||
seq2  CTCCCCCCACTCACCCCCTCCCTCCATCTTTTATGCTCATCTGTTCATCC  750

seq1  -TTCCACCTCACCACTCGCTGCCTACCCCCTTCATCCCTCTCACCTGCCT  797
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCACCTCACCACTCGCTGCCTACCCCCTTCATCCCTCTCACCTGCCT  800

seq1  ATTCATCTT-CCCCGTCCTCCATCTAACA-TTTACTGAACACCTTTGTGT  845
      ||||||||| ||||||||||||||||||| ||||||||||||||||||||
seq2  ATTCATCTTCCCCCGTCCTCCATCTAACATTTTACTGAACACCTTTGTGT  850

seq1  GTGAGAGACAGGGTCTTGTG-TCACCCAGA--CTGGCTTTG-TAAGGGAC  891
      |||||||||||||||||||| |||||||||   ||| |||| |||| |||
seq2  GTGAGAGACAGGGTCTTGTGTTCACCCAGAACTTGGTTTTGTTAAGAGAC  900

seq1  AT--GCAACCCAAACTGATCTT-GAATGTCCCA-CCTTGGCCT-CTTG-A  935
      ||   ||||||||||||||||| || ||||||| ||||||||| |||| |
seq2  ATTGCCAACCCAAACTGATCTTGGATTGTCCCACCCTTGGCCTCCTTGAA  950

seq1  ATGAT-GGGACGTCAATGCAAGCC-ACTATG  964
      ||||| |||||||||||||||||| ||||||
seq2  ATGATGGGGACGTCAATGCAAGCCAACTATG  981

seq1: chr5_115234847_115235251
seq2: B6Ng01-194L19.g_65_469 (reverse)

seq1  CCCCCCCCCCCCCCGTCCCGCTCAACTTCCTTCCTCAGGCCTGTGAGGCG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCCCCCCCCGTCCCGCTCAACTTCCTTCCTCAGGCCTGTGAGGCG  50

seq1  ATTGTTTGAAGACTATGGTTTGTACCTAAACAACTGGACTGTCAAGGCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTTGAAGACTATGGTTTGTACCTAAACAACTGGACTGTCAAGGCAA  100

seq1  AGCCCCTTTCTTTCCCAAGGACCGGCTGGCGCTCAGAAAGACTCCTGTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCCTTTCTTTCCCAAGGACCGGCTGGCGCTCAGAAAGACTCCTGTTC  150

seq1  ACCGTGTCCTTGGAAGAACTTGCAGTTGTGCAGCACAGGCAGAGCCAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGTGTCCTTGGAAGAACTTGCAGTTGTGCAGCACAGGCAGAGCCAGGA  200

seq1  CACTGATACACCATCAGACTGGGCCACTTGGCTCTGGGGAGCCAAGGGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGATACACCATCAGACTGGGCCACTTGGCTCTGGGGAGCCAAGGGGA  250

seq1  AGAGGGAGGACCGCAGACCCAGTGTATGTTGAGAAACGATGTGTGTCCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGGAGGACCGCAGACCCAGTGTATGTTGAGAAACGATGTGTGTCCTC  300

seq1  TCCGATTCCTGTACACGCATGTTCACGGGCGTGTCCGACAGGTCTCACTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGATTCCTGTACACGCATGTTCACGGGCGTGTCCGACAGGTCTCACTC  350

seq1  CCGCTCAGTGAGGCCTGCTGTGTCCTCTGCTGCTGCTCCTGGGCATCTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGCTCAGTGAGGCCTGCTGTGTCCTCTGCTGCTGCTCCTGGGCATCTGG  400

seq1  AATTC  405
      |||||
seq2  AATTC  405

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information