MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-197L04
Chromosome	5 (Build37)
Map Location	96,226,406 - 96,382,793
singlet/doublet	doublet
Overlap gene	LOC665943, LOC433921
Upstream gene	LOC100041179, LOC624655, LOC100041166, LOC665469, LOC622894, EG666121, LOC666125, EG666133, LOC100041296, LOC100041253, LOC100041264, EG624049, EG666159, LOC666164, EG666169, D5Ertd577e, LOC100041354, LOC100040503, LOC666187, EG622731, LOC100041380, EG666203, EG666209
Downstream gene	Cxcl13, EG666231, Cnot6l, LOC100040559, Mrpl1, Fras1, Anxa3, EG666266
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 169 ESTs, 49 Proteins

name	LOC624655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041166 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins pseudo : _no_value

name	LOC665469 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665469
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins pseudo : _no_value

name	LOC622894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins pseudo : _no_value

name	EG666121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666121 MGI:3643725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins pseudo : _no_value

name	LOC666125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG666133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666133 MGI:3646599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 42 Proteins

name	LOC100041296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 166 ESTs, 48 Proteins

name	LOC100041253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 168 ESTs, 49 Proteins

name	LOC100041264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 46 Proteins

name	EG624049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624049 MGI:3646666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	EG666159 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666159 MGI:3645939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC666164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666169 MGI:3643214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins

name	D5Ertd577e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320549 MGI:1261918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 62 ESTs, 56 Proteins

name	LOC100040503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC666187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins

name	EG622731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622731 MGI:3643967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins

name	LOC100041380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins pseudo : _no_value

name	EG666203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666203 MGI:3704107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 44 Proteins

name	EG666209 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666209 MGI:3648891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins

name	LOC665943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 68 ESTs, 57 Proteins

name	LOC433921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433921
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	Cxcl13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55985 MGI:1888499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666231 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666231 MGI:3647399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 429 ESTs, 19 Proteins pseudo : _no_value

name	Cnot6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231464 MGI:2443154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mrpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94061 MGI:2137202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fras1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231470 MGI:2385368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11745 MGI:1201378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666266 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666266 MGI:3648644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254073 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 132 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476397.1

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254075 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 143 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476414.1

name	LOC100041179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254077 GeneID:100041179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476427.1

name	EG666133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374958 GeneID:666133 MGI:3646599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 42 Proteins product : predicted gene, EG666133 transcript_id : XM_981835.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254097 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 3 Proteins product : similar to Expressed sequence C87414, transcript variant 3 transcript_id : XM_001476611.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254084 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 131 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 1 transcript_id : XM_001476493.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254086 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 142 ESTs, 46 Proteins product : similar to C87414 protein, transcript variant 2 transcript_id : XM_001476505.1

name	LOC100041253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254088 GeneID:100041253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins product : similar to C87414 protein, transcript variant 3 transcript_id : XM_001476521.1

name	LOC100041264 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254091 GeneID:100041264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 46 Proteins product : similar to CDNA sequence BC061212 transcript_id : XM_001476548.1

name	EG624049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374967 GeneID:624049 MGI:3646666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : predicted gene, EG624049 transcript_id : XM_888575.2

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254095 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 158 ESTs, 45 Proteins product : similar to Expressed sequence C87414, transcript variant 2 transcript_id : XM_001476589.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254093 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 150 ESTs, 45 Proteins product : similar to Expressed sequence C87414, transcript variant 1 transcript_id : XM_001476574.1

name	LOC100041296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254099 GeneID:100041296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 135 ESTs, 3 Proteins product : similar to Expressed sequence C87414, transcript variant 4 transcript_id : XM_001476631.1

name	EG666169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374970 GeneID:666169 MGI:3643214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 45 Proteins product : predicted gene, EG666169 transcript_id : XM_982113.1

name	D5Ertd577e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343011 GeneID:320549 MGI:1261918
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 577, expressed transcript_id : NM_177187.2

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254103 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 41 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 1 transcript_id : XM_001476772.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254105 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 44 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 2 transcript_id : XM_001476793.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254107 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 53 Proteins product : similar to D5Ertd577e protein, transcript variant 3 transcript_id : XM_001476810.1

name	LOC100041354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254109 GeneID:100041354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 3 Proteins product : similar to D5Ertd577e protein, transcript variant 4 transcript_id : XM_001476832.1

name	LOC666187 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374973 GeneID:666187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 21 Proteins product : predicted gene, EG666089 transcript_id : XM_982184.1

name	EG622731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82897870 GeneID:622731 MGI:3643967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 Proteins product : predicted gene, EG622731 transcript_id : XM_889897.1

name	EG666203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374975 GeneID:666203 MGI:3704107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 7 ESTs, 44 Proteins product : predicted gene, EG666203 transcript_id : XM_982294.1

name	EG666209 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374977 GeneID:666209 MGI:3648891
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 47 Proteins product : predicted gene, EG666209 transcript_id : XM_982325.1

name	LOC665943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374930 GeneID:665943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 47 ESTs, 54 Proteins product : similar to D5Ertd577e protein, transcript variant 3 transcript_id : XM_982508.1

name	LOC665943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254114 GeneID:665943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 46 ESTs, 54 Proteins product : similar to D5Ertd577e protein, transcript variant 4 transcript_id : XM_982542.2

name	LOC665943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374934 GeneID:665943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 60 ESTs, 54 Proteins product : similar to D5Ertd577e protein, transcript variant 5 transcript_id : XM_982565.1

name	LOC665943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254115 GeneID:665943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 3 Proteins product : similar to D5Ertd577e protein, transcript variant 2 transcript_id : XM_982469.2

name	Cxcl13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130712 GeneID:55985 MGI:1888499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 13 transcript_id : NM_018866.2

name	Cnot6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674806 GeneID:231464 MGI:2443154
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 6-like transcript_id : NM_178854.3

name	Cnot6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450298 GeneID:231464 MGI:2443154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 6-like transcript_id : NM_144910.1

name	Mrpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875527 GeneID:94061 MGI:2137202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L1 transcript_id : NM_053158.2

name	Mrpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84875531 GeneID:94061 MGI:2137202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L1 transcript_id : NM_001039084.1

name	Fras1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157514 GeneID:231470 MGI:2385368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fraser syndrome 1 homolog (human) transcript_id : NM_175473.3

name	Anxa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304886 GeneID:11745 MGI:1201378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A3 transcript_id : NM_013470.1

name	EG666266 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374982 GeneID:666266 MGI:3648644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : predicted gene, EG666266 transcript_id : XM_982666.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254074 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476447.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254076 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476464.1

name	LOC100041179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254078 GeneID:100041179
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476477.1

name	EG666133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374959 GeneID:666133 MGI:3646599
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986929.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254085 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 1 protein_id : XP_001476543.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254087 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 2 protein_id : XP_001476555.1

name	LOC100041253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254089 GeneID:100041253
definition	codon_start : 1 product : similar to C87414 protein isoform 3 protein_id : XP_001476571.1

name	LOC100041264 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254092 GeneID:100041264
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_001476598.1

name	EG624049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374968 GeneID:624049 MGI:3646666
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893668.2

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254094 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 1 protein_id : XP_001476624.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254096 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 2 protein_id : XP_001476639.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254098 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 3 protein_id : XP_001476661.1

name	LOC100041296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254100 GeneID:100041296
definition	codon_start : 1 product : similar to Expressed sequence C87414 isoform 4 protein_id : XP_001476681.1

name	EG666169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374971 GeneID:666169 MGI:3643214
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987207.1

name	D5Ertd577e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893195 GeneID:320549 MGI:1261918
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320549 protein_id : NP_796161.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254104 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476822.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254106 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476843.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254108 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001476860.1

name	LOC100041354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254110 GeneID:100041354
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001476882.1

name	LOC666187 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374974 GeneID:666187
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_987278.1

name	EG622731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897871 GeneID:622731 MGI:3643967
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894990.1

name	EG666203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374976 GeneID:666203 MGI:3704107
definition	codon_start : 1 product : similar to CDNA sequence BC061212 protein_id : XP_987388.1

name	EG666209 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374978 GeneID:666209 MGI:3648891
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987419.1

name	LOC665943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374931 GeneID:665943
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_987602.1

name	LOC665943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374933 GeneID:665943
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_987636.1

name	LOC665943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374935 GeneID:665943
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_987659.1

name	LOC665943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374937 GeneID:665943
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_987563.1

name	Cxcl13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256521 CCDS:CCDS19447.1 GeneID:55985 MGI:1888499
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0048535 - lymph node development [Evidence IMP] codon_start : 1 note : B lymphocyte chemoattractant; small inducible cytokine subfamily B (Cys-X-Cys), member 13 product : chemokine (C-X-C motif) ligand 13 protein_id : NP_061354.1

name	Cnot6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674807 GeneID:231464 MGI:2443154
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : CCR4-NOT transcription complex, subunit 6-like isoform 2 protein_id : NP_849185.2

name	Cnot6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450299 CCDS:CCDS19448.1 GeneID:231464 MGI:2443154
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : CCR4-NOT transcription complex, subunit 6-like isoform 1 protein_id : NP_659159.1

name	Mrpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875528 CCDS:CCDS19449.1 GeneID:94061 MGI:2137202
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : mitochondrial ribosomal protein L1 isoform 1 protein_id : NP_444388.2

name	Mrpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875532 GeneID:94061 MGI:2137202
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : mitochondrial ribosomal protein L1 isoform 2 protein_id : NP_001034173.1

name	Fras1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157515 CCDS:CCDS19450.1 GeneID:231470 MGI:2385368
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0002009 - morphogenesis of an epithelium [Evidence IMP] codon_start : 1 note : blebbed product : Fras1 protein protein_id : NP_780682.3

name	Anxa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304887 GeneID:11745 MGI:1201378
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0019834 - phospholipase A2 inhibitor activity [Evidence IEA]; GO:0004859 - phospholipase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : annexin III product : annexin A3 protein_id : NP_038498.1

name	EG666266 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374983 GeneID:666266 MGI:3648644
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987760.1

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 1 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 2 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 3 pseudo : _no_value

name	LOC624655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624655
definition	number : 4 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 1 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 2 pseudo : _no_value

name	LOC665469 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665469
definition	number : 3 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 3 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 2 pseudo : _no_value

name	LOC666125 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666125
definition	number : 1 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 1 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 2 pseudo : _no_value

name	EG666159 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666159
definition	number : 3 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 3 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 2 pseudo : _no_value

name	LOC666164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666164
definition	number : 1 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 1 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 2 pseudo : _no_value

name	LOC100040503 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040503
definition	number : 3 pseudo : _no_value

name	LOC100040559 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040559
definition	number : 1 pseudo : _no_value

name	LOC100040559 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040559
definition	number : 2 pseudo : _no_value

name	LOC100041166 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254070 GeneID:100041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins product : hypothetical protein LOC100041166 pseudo : _no_value transcript_id : XR_032707.1

name	LOC622894 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254082 GeneID:622894
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 148 ESTs, 39 Proteins product : similar to Expressed sequence C87414 pseudo : _no_value transcript_id : XR_035674.1

name	EG666121 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254083 GeneID:666121 MGI:3643725
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 23 Proteins product : predicted gene, EG666121 pseudo : _no_value transcript_id : XR_032771.1

name	LOC100041380 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254111 GeneID:100041380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 118 ESTs, 10 Proteins product : similar to D5Ertd577e protein pseudo : _no_value transcript_id : XR_032968.1

name	EG666231 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94374979 GeneID:666231 MGI:3647399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 429 ESTs, 19 Proteins product : predicted gene, EG666231 pseudo : _no_value transcript_id : XR_001849.1

clone name	MSMg01-329P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-447I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-197L04.b	B6Ng01-197L04.g
ACC	GA019494	GA019495
length	1,117	1,118
definition	B6Ng01-197L04.b	B6Ng01-197L04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(96,226,406 - 96,227,530)	(96,381,667 - 96,382,793)
sequence	gaattcactgtgcccagtttgcctttgcctccagagtgcagggattaaag gtgtttgccacaattccttttacaaatttaattctcttaaagatttagcc tggcagtggtggcacacgcctttattcccaactcaacacttgaaaggcaa aggcagacagacttcttagttcaaggacagcctggtcttagcttgagttc caggacagccagacctacacagagaaaccctgtctcaaaaaaaacaaaac aaaagcgttttcttcactgtgttttggtgtttttcctacatgtatgaatg ttcagcacatgcttgcctggtgtccaagaaggtcagatggagttttcagg tttctggaaactggagttacagatcatttcaagtcaccatgtaggtgttc agaatagagtattaataggtgctcattattggggagcaaactcttcagca cacggctcactcctgatttcatcttgggcaagcatgctggtcagatccta cctgacacattatctgttttctgtcagccaaaggcagcatctccctcaga ccctccaatttctgttgctctttaggtctatttagaagtagacccaaatg taagctcaggctgtccttctatttacaatatggctgatgatggctttgaa tttattcccctgcttccaactcttgaactgtgagtttccaggcatagcca ttatgtctgctgcatacagtgctggagagaggaatggctgtatgctgggt agctccttacaaactgagtgcacacccagcacacttggacactgttaatg gaatcagacaatgctccttcctctaacatttatgtaggtgctactgcagt ttattgaaaaagcatccatttcaggccttgagctccagaacatactcctt tctattaaaactctttgtcctagatccagtgacaataatatcgatgaatt attttctgtctattatcatcatagattaaccctgatctgaggcaaatcag actgacttttgtgcacatgaataaatgggcccaggtgtgtgtttctcaac attaatcctagcagcagactatgctgaggcagagatgtctagaactagaa gtttagaaacatccctg	gaattcacatgatatgcactcactgataagtggttattagcccagaagct cggaatacccaagacacaatttgcaaaacacatgaaactcaagaataagg aagaccaaagtgtggatactttcttcctccttagaatggggaacaaaata cccatggaaggagttacagagacaaagtttggagctgagatggaaggaaa aaccatccagagactgccccacccgggatccatcccataatcagccatca aacacagacactattgcatatgccagcaagattttgttgaaaggaccctg atatagctgtctcttgtgaggctatgccagtgcctggcaaatacagaagt ggacgctcacagtcatctattaaatggaacacggggcccccaatggagaa gctagagaaagaacccaaggagatgaagaggtctgtatcctataggagga acaataatatgaaccaactagtacctccatctgcttctatacactccata tccctccctctcttctctcacacacccctttgcctctgtcctttgctgtt tgaaataaatggttcagtctgttgtggtcagtatccagtcccgtctcttc ctcctgtctacttaagctgcctcagaaatctaacagtttgattaaaaaag ccaccagggctgaggggtgattccagagaactcctgagtttgagttttag tcccttcatactcagaattctgtttttatgctatcctttctgcttcaaga cgggattgggggtcgggcagttctgatagccagattgcctcagaatcaga ttctctaataccatttagagtagatgtatgcattctaaaatcttagaagc ccaggaacaagaaaatttgagcagataggaccaaatcaatacgttttatt tttaaatttttaatttgtagtatgtgtttgtgtgtgcatgcacacatgtg ctcatgaatatgtgtagtatttgtgtaccctgcagatgtttgtagtcaga gacaattgcagaaacggttcctcttcctacagtgtgggtccaggactgac tcaagtggcagcttgcagcagcagcctgtaacttgctgagcaattcagcg acctaaagtcctttattt
quality values	Open. Hide. 62 47 31 39 62 41 20 62 62 62 49 62 62 62 44 23 62 62 62 62 35 62 62 62 62 62 62 62 62 62 62 59 36 62 62 62 54 62 62 54 62 54 54 59 49 59 62 62 59 54 54 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 52 58 52 58 58 58 58 45 41 58 58 58 58 58 58 58 51 58 58 58 58 54 58 58 54 52 45 54 52 54 58 58 58 58 54 54 52 58 58 48 58 58 52 58 54 58 58 37 58 58 58 58 58 51 58 51 58 58 58 51 42 58 49 58 58 51 51 51 58 58 53 53 53 51 58 58 50 51 33 58 49 58 54 58 58 50 58 54 41 39 58 58 40 58 58 49 58 58 51 51 58 49 41 58 49 46 53 58 51 58 43 43 44 58 58 51 35 40 47 26 58 53 58 52 58 58 51 58 58 52 53 58 53 54 58 42 51 54 50 40 43 30 39 58 50 52 54 53 50 58 58 39 51 50 52 42 54 53 54 53 51 52 51 52 52 45 53 42 45 39 53 45 54 49 49 51 51 54 24 51 23 54 32 53 53 35 37 54 51 36 49 51 41 40 44 47 47 49 32 36 54 40 52 37 38 47 35 46 40 54 31 42 31 54 33 33 35 35 51 31 37 41 28 33 45 40 52 51 54 32 34 52 33 31 34 34 51 32 35 36 22 27 32 45 32 52 19 20 24 53 32 40 40 52 32 32 32 31 24 31 27 30 35 31 38 30 36 28 41 28 31 29 46 31 42 31 26 23 34 33 33 51 30 31 30 31 32 31 25 46 33 37 35 33 31 31 24 41 33 31 27 29 46 30 34 26 30 42 31 48 47 46 35 30 38 31 36 23 27 46 9 46 18 31 25 33 27 20 22 27 25 27 29 13 41 42 24 30 19 15 39 25 19 16 28 33 26 26 31 33 36 47 37 29 26 22 18 25 19 46 48 46 28 31 32 31 46 33 31 22 20 20 20 33 24 24 28 18 24 30 33 35 37 33 25 10 31 25 21 20 21 19 31 33 28 26 32 32 32 21 15 22 34 31 44 43 26 20 15 31 21 27 26 22 21 20 31 32 32 32 32 20 30 11 21 24 33 17 9 25 30 14 37 18 21 32 23 27 18 27 32 33 13 20 31 23 48 28 19 19 12 14 37 22 32 27 28 19 18 34 34 13 11 8 19 20 16 13 6 10 10 30 8 12 27 34 18 11 4 32 7 19 28 11 13 16 9 5 10 12 10 3 4 15 40 13 7 10 20 19 6 6 6 13 11 13 6 25 15 14 10 21 7 20 19 11 19 25 10 18 9 17 20 10 8 21 9 7 22 8 15 12 12 22 5 6 5 13 6 6 7 18 16 10 16 11 6 18 5 6 11 19 4 14 22 9 7 5 22 26 9 15 8 2 4 22 19 6 13	Open. Hide. 62 47 56 47 62 47 42 62 47 62 62 59 62 62 44 37 62 59 62 62 59 51 62 62 59 59 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 49 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 52 58 58 58 58 54 47 58 58 47 58 58 54 58 58 54 58 58 58 58 41 48 58 52 58 54 58 48 58 51 39 53 58 58 58 58 58 58 51 58 51 58 54 58 58 54 53 58 52 58 50 58 41 51 50 58 47 52 58 53 58 58 58 50 58 54 47 47 39 58 58 58 52 58 51 58 58 52 51 50 58 58 58 58 51 31 51 51 58 58 58 58 58 32 43 44 42 50 50 50 52 58 58 54 50 58 39 13 38 58 58 36 58 53 39 50 50 44 35 53 58 32 35 42 50 51 53 58 53 58 33 21 51 58 40 50 51 34 53 54 54 42 51 39 42 47 54 54 53 53 39 39 39 52 53 52 45 45 33 54 35 26 51 52 42 46 24 54 54 54 41 49 33 37 47 37 40 52 53 42 37 54 42 45 43 45 40 30 31 40 30 53 42 37 32 14 46 51 41 40 37 31 54 54 54 49 32 33 25 52 52 32 42 26 42 32 35 42 32 42 22 34 26 42 42 31 31 40 24 32 41 18 25 21 32 34 22 53 29 30 32 30 31 51 31 45 45 30 33 31 30 32 30 33 12 27 33 31 51 30 36 31 38 32 27 38 28 33 27 42 34 31 30 31 35 25 29 31 42 31 46 48 48 31 27 31 31 24 32 16 27 33 25 31 46 31 25 17 30 31 27 30 13 33 30 33 46 46 15 31 46 33 22 32 26 31 28 13 32 18 27 17 32 26 18 32 27 47 30 31 32 28 30 30 29 33 34 42 48 46 38 42 32 46 46 46 29 25 46 31 24 44 44 48 29 30 32 33 48 27 35 23 32 20 20 28 21 31 14 30 17 36 31 31 12 31 18 31 13 33 31 21 19 35 21 9 10 7 31 16 32 26 10 21 31 14 31 21 25 21 32 22 33 27 31 32 21 20 22 4 4 5 8 5 43 24 22 12 14 8 11 33 39 30 25 4 4 9 14 37 15 17 19 48 22 32 13 14 4 5 12 26 6 11 3 5 10 12 13 13 13 27 16 7 6 20 40 22 28 23 19 6 7 5 9 15 16 13 25 8 13 28 13 12 7 6 5 7 4 12 25 22 25 8 9 20 11 21 14 5 11 7 17 4 13 6 5 4 21 4 6 7 2 4 6 5 17 6 19 9 22 19 18 8 4 6 10 4 16 16 10 18 7 13 4 6 7 11 20 16 13 10 11 5 15 5 5 24 24 13 9 4 11 5 4 12 7 9 8 26 7 8 4 8 5 25 28 9 20 13 15 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_96226406_96227530
seq2: B6Ng01-197L04.b_47_1163

seq1  GAATTCACTGTGCCCAGTTTGCCTTTGCCTCCAGAGTGCAGGGATTAAAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTGTGCCCAGTTTGCCTTTGCCTCCAGAGTGCAGGGATTAAAG  50

seq1  GTGTTTGCCACAATTCCTTTTACAAATTTAATTCTCTTAAAGATTTAGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTTGCCACAATTCCTTTTACAAATTTAATTCTCTTAAAGATTTAGCC  100

seq1  TGGCAGTGGTGGCACACGCCTTTATTCCCAACTCAACACTTGAAAGGCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAGTGGTGGCACACGCCTTTATTCCCAACTCAACACTTGAAAGGCAA  150

seq1  AGGCAGACAGACTTCTTAGTTCAAGGACAGCCTGGTCTTAGCTTGAGTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGACAGACTTCTTAGTTCAAGGACAGCCTGGTCTTAGCTTGAGTTC  200

seq1  CAGGACAGCCAGACCTACACAGAGAAACCCTGTCTCAAAAAAAACAAAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACAGCCAGACCTACACAGAGAAACCCTGTCTCAAAAAAAACAAAAC  250

seq1  AAAAGCGTTTTCTTCACTGTGTTTTGGTGTTTTTCCTACATGTATGAATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCGTTTTCTTCACTGTGTTTTGGTGTTTTTCCTACATGTATGAATG  300

seq1  TTCAGCACATGCTTGCCTGGTGTCCAAGAAGGTCAGATGGAGTTTTCAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCACATGCTTGCCTGGTGTCCAAGAAGGTCAGATGGAGTTTTCAGG  350

seq1  TTTCTGGAAACTGGAGTTACAGATCATTTCAAGTCACCATGTAGGTGTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGGAAACTGGAGTTACAGATCATTTCAAGTCACCATGTAGGTGTTC  400

seq1  AGAATAGAGTATTAATAGGTGCTCATTATTGGGGAGCAAACTCTTCAGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATAGAGTATTAATAGGTGCTCATTATTGGGGAGCAAACTCTTCAGCA  450

seq1  CACGGCTCACTCCTGATTTCATCTTGGGCAAGCATGCTGGTCAGATCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGGCTCACTCCTGATTTCATCTTGGGCAAGCATGCTGGTCAGATCCTA  500

seq1  CCTGACACATTATCTGTTTTCTGTCAGCCAAAGGCAGCATCTCCCTCAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGACACATTATCTGTTTTCTGTCAGCCAAAGGCAGCATCTCCCTCAGA  550

seq1  CCCTCCAATTTCTGTTGCTCTTTAGGTCTATTTAGAAGTAGACCCAAATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCAATTTCTGTTGCTCTTTAGGTCTATTTAGAAGTAGACCCAAATG  600

seq1  TAAGCTCAGGCTGTCCTTCTATTTACAATATGGCTGATGATGGCTTTGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCTCAGGCTGTCCTTCTATTTACAATATGGCTGATGATGGCTTTGAA  650

seq1  TTTATTCCCCTGCTTCCAACTCTTGAACTGTGAGTTTCCAGGCATAGCCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTCCCCTGCTTCCAACTCTTGAACTGTGAGTTTCCAGGCATAGCCA  700

seq1  TTATGTCTGCTGCATACAGTGCTGGAGAGAGGAATGGCTGTATGCTGGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTCTGCTGCATACAGTGCTGGAGAGAGGAATGGCTGTATGCTGGGT  750

seq1  AGCTCCTTACAAACTGAGTGCACACCCAGCACACTTGGACACTGTTAATG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCCTTACAAACTGAGTGCACACCCAGCACACTTGGACACTGTTAATG  800

seq1  GAATCAGACAATGCTCCTTCCTCTAACATTTATGTAGGTGCTACTGCAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCAGACAATGCTCCTTCCTCTAACATTTATGTAGGTGCTACTGCAGT  850

seq1  TTATTGAAAAAGCATCCAATTCAGGCCTTGAGCTCCAGAACATACTCCTT  900
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  TTATTGAAAAAGCATCCATTTCAGGCCTTGAGCTCCAGAACATACTCCTT  900

seq1  TCTATTAAAAACTCTTTGTCCTAGATCCAGTGACAATAATATCGATGAAT  950
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATT-AAAACTCTTTGTCCTAGATCCAGTGACAATAATATCGATGAAT  949

seq1  TATTTTCTGTCTATTATCATCAATAGATTAAACCCTGATCTGAGGCAAAT  1000
      ||||||||||||||||||||| ||||||| ||||||||||||||||||||
seq2  TATTTTCTGTCTATTATCATC-ATAGATT-AACCCTGATCTGAGGCAAAT  997

seq1  CAGACTGAC-TTTGTGCACATGAATAAAATTGGCCCAGGTGTGGTGTTTC  1049
      ||||||||| ||||||||||||||| |||| ||||||||||| |||||||
seq2  CAGACTGACTTTTGTGCACATGAAT-AAATGGGCCCAGGTGT-GTGTTTC  1045

seq1  TCAACATTAATCCTAGCAGCAAGAACTATGCTGAGGCAGGAGGATTGCTA  1099
      |||||||||||||||||||||   |||||||||||||||   |||  |||
seq2  TCAACATTAATCCTAGCAGCA--GACTATGCTGAGGCAG--AGATGTCTA  1091

seq1  GAACTTAGAGTTTAGAAACAACCCTG  1125
      |||||   |||||||||||| |||||
seq2  GAACTAGAAGTTTAGAAACATCCCTG  1117

seq1: chr5_96381667_96382793
seq2: B6Ng01-197L04.g_69_1186 (reverse)

seq1  AAATAAAGACCTTTAGGCTGCTGAAATGGCTCAGCAAG-TACAGGCTGCT  49
      ||||||||  |||||||  |||| ||| |||||||||| |||||||||||
seq2  AAATAAAGGACTTTAGGTCGCTG-AATTGCTCAGCAAGTTACAGGCTGCT  49

seq1  GCTGCCAAGCCTGGCCACCTGAGTTCAGTTCCTGGAACCCACACTGTAGG  99
      |||| |||||   ||||| |||| |||| |||||| ||||||||||||||
seq2  GCTG-CAAGC--TGCCACTTGAG-TCAG-TCCTGG-ACCCACACTGTAGG  93

seq1  AAGAGAACCCGTTTCTGCAATTGTCTTCTGACCTACAAACATCTGCCAGG  149
      ||||| | ||||||||||||||||| ||||| ||||||||||||| ||||
seq2  AAGAGGAACCGTTTCTGCAATTGTC-TCTGA-CTACAAACATCTG-CAGG  140

seq1  GTACACAAATACCTACACATATTCATGAGCACATGTGTGCATGCACACAC  199
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  GTACACAAATA-CTACACATATTCATGAGCACATGTGTGCATGCACACAC  189

seq1  AAACACATACTACAAATTAAAAATTTAAAAATAAAACGTATTGATTTGGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACATACTACAAATTAAAAATTTAAAAATAAAACGTATTGATTTGGT  239

seq1  CCTATCTGCTCAAA-TTTCTTGTTCCTGGGCTTCTAAGATTTTAGAATGC  298
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  CCTATCTGCTCAAATTTTCTTGTTCCTGGGCTTCTAAGATTTTAGAATGC  289

seq1  ATACATCTACTCTAAATGGTATTAGAGAATCTGATTCTGAGGCAATCTGG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATCTACTCTAAATGGTATTAGAGAATCTGATTCTGAGGCAATCTGG  339

seq1  CTATCAGAACTGCCCGACCCCCAATCCCGTCTTGAAGCAGAAAGGATAGC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCAGAACTGCCCGACCCCCAATCCCGTCTTGAAGCAGAAAGGATAGC  389

seq1  ATAAAAACAGAATTCTGAGTATGAAGGGACTAAAACTCAAACTCAGGAGT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAACAGAATTCTGAGTATGAAGGGACTAAAACTCAAACTCAGGAGT  439

seq1  TCTCTGGAATCACCCCTCAGCCCTGGTGGCTTTTTTAATCAAACTGTTAG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGGAATCACCCCTCAGCCCTGGTGGCTTTTTTAATCAAACTGTTAG  489

seq1  ATTTCTGAGGCAGCTTAAGTAGACAGGAGGAAGAGACGGGACTGGATACT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTGAGGCAGCTTAAGTAGACAGGAGGAAGAGACGGGACTGGATACT  539

seq1  GACCACAACAGACTGAACCATTTATTTCAAACAGCAAAGGACAGAGGCAA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCACAACAGACTGAACCATTTATTTCAAACAGCAAAGGACAGAGGCAA  589

seq1  AGGGGTGTGTGAGAGAAGAGAGGGAGGGATATGGAGTGTATAGAAGCAGA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTGTGTGAGAGAAGAGAGGGAGGGATATGGAGTGTATAGAAGCAGA  639

seq1  TGGAGGTACTAGTTGGTTCATATTATTGTTCCTCCTATAGGATACAGACC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGGTACTAGTTGGTTCATATTATTGTTCCTCCTATAGGATACAGACC  689

seq1  TCTTCATCTCCTTGGGTTCTTTCTCTAGCTTCTCCATTGGGGGCCCCGTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCATCTCCTTGGGTTCTTTCTCTAGCTTCTCCATTGGGGGCCCCGTG  739

seq1  TTCCATTTAATAGATGACTGTGAGCGTCCACTTCTGTATTTGCCAGGCAC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCATTTAATAGATGACTGTGAGCGTCCACTTCTGTATTTGCCAGGCAC  789

seq1  TGGCATAGCCTCACAAGAGACAGCTATATCAGGGTCCTTTCAACAAAATC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCATAGCCTCACAAGAGACAGCTATATCAGGGTCCTTTCAACAAAATC  839

seq1  TTGCTGGCATATGCAATAGTGTCTGTGTTTGATGGCTGATTATGGGATGG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTGGCATATGCAATAGTGTCTGTGTTTGATGGCTGATTATGGGATGG  889

seq1  ATCCCGGGTGGGGCAGTCTCTGGATGGTTTTTCCTTCCATCTCAGCTCCA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCGGGTGGGGCAGTCTCTGGATGGTTTTTCCTTCCATCTCAGCTCCA  939

seq1  AACTTTGTCTCTGTAACTCCTTCCATGGGTATTTTGTTCCCCATTCTAAG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTGTCTCTGTAACTCCTTCCATGGGTATTTTGTTCCCCATTCTAAG  989

seq1  GAGGAAGAAAGTATCCACACTTTGGTCTTCCTTATTCTTGAGTTTCATGT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAGAAAGTATCCACACTTTGGTCTTCCTTATTCTTGAGTTTCATGT  1039

seq1  GTTTTGCAAATTGTGTCTTGGGTATTCCGAGCTTCTGGGCTAATAACCAC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTGCAAATTGTGTCTTGGGTATTCCGAGCTTCTGGGCTAATAACCAC  1089

seq1  TTATCAGTGAGTGCATATCATGTGAATTC  1127
      |||||||||||||||||||||||||||||
seq2  TTATCAGTGAGTGCATATCATGTGAATTC  1118

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information