MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-197M12
Chromosome	5 (Build37)
Map Location	37,413,741 - 37,588,640
singlet/doublet	doublet
Overlap gene	Jakmip1, EG330070, Gm1043
Upstream gene	Sorcs2, 2310020A21Rik, Grpel1, Ccdc96, Tbc1d14, D5Ertd579e, LOC100040278, LOC100040825, Cno, Mrfap1, Man2b2, Ppp2r2c, Wfs1
Downstream gene	LOC100040936, Crmp1, Evc, Evc2, LOC100040355, LOC100040988, Stk32b, Cytl1, Msx1, Stx18, Nsg1, LOC100040397
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sorcs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310020A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grpel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66717 MGI:1913967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100855 MGI:1098708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D5Ertd579e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	LOC100040825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Cno (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrfap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67568 MGI:1914818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17160 MGI:1195262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269643 MGI:2442660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jakmip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76071 MGI:1923321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Gm1043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100040936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Crmp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12933 MGI:107793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59056 MGI:1890596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68525 MGI:1915775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040988 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Stk32b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64293 MGI:1927552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cytl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231162 MGI:2684993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17701 MGI:97168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71116 MGI:1918366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18196 MGI:109149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Sorcs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301216 GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sortilin-related VPS10 domain containing receptor 2 transcript_id : NM_030889.2

name	2310020A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301213 GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310020A21 gene transcript_id : NM_175249.3

name	Grpel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542920 GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GrpE-like 1, mitochondrial transcript_id : NM_024478.2

name	Ccdc96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541960 GeneID:66717 MGI:1913967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 96 transcript_id : NM_025725.2

name	Tbc1d14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559984 GeneID:100855 MGI:1098708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 14 transcript_id : NM_133910.2

name	D5Ertd579e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486994 GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 579, expressed transcript_id : NM_001081232.1

name	LOC100040278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253859 GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hypothetical protein LOC100040278 transcript_id : XM_001474408.1

name	LOC100040825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253872 GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to D5Ertd579e protein transcript_id : XM_001476163.1

name	Cno (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988412 GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cappuccino transcript_id : NM_133724.3

name	Mrfap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375273 GeneID:67568 MGI:1914818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Morf4 family associated protein 1 transcript_id : NM_026242.2

name	Man2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678791 GeneID:17160 MGI:1195262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B2 transcript_id : NM_008550.1

name	Ppp2r2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475972 GeneID:269643 MGI:2442660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform transcript_id : NM_172994.2

name	Wfs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672922 GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolfram syndrome 1 homolog (human) transcript_id : NM_011716.2

name	Jakmip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801680 GeneID:76071 MGI:1923321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : janus kinase and microtubule interacting protein 1 transcript_id : NM_178394.3

name	EG330070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374698 GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG330070 transcript_id : XM_897537.2

name	Gm1043 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374701 GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 1043, (NCBI) transcript_id : XM_355598.4

name	LOC100040936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253874 GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : hypothetical protein LOC100040936 transcript_id : XM_001476309.1

name	Crmp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068506 GeneID:12933 MGI:107793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : collapsin response mediator protein 1 transcript_id : NM_007765.3

name	Evc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947019 GeneID:59056 MGI:1890596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld gene homolog (human) transcript_id : NM_021292.1

name	Evc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981838 GeneID:68525 MGI:1915775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld syndrome 2 homolog (human) transcript_id : NM_145920.2

name	LOC100040988 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253879 GeneID:100040988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to Ubtf protein transcript_id : XM_001476413.1

name	Stk32b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468970 GeneID:64293 MGI:1927552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 32B transcript_id : NM_022416.1

name	Cytl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487394 GeneID:231162 MGI:2684993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine like 1 transcript_id : NM_001081106.1

name	Msx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199782 GeneID:17701 MGI:97168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box, msh-like 1 transcript_id : NM_010835.2

name	Stx18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77736534 GeneID:71116 MGI:1918366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 18 transcript_id : NM_026959.2

name	Nsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77736540 GeneID:18196 MGI:109149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron specific gene family member 1 transcript_id : NM_010942.3

name	LOC100040397 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253861 GeneID:100040397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001474616.1

name	Sorcs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301217 CCDS:CCDS19237.1 GeneID:81840 MGI:1932289
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : VPS10 domain receptor protein product : VPS10 domain receptor protein SORCS 2 protein_id : NP_112151.2

name	2310020A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301214 GeneID:76943 MGI:1924193
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76943 protein_id : NP_780458.2

name	Grpel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277394 CCDS:CCDS19238.1 GeneID:17713 MGI:1334417
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0000774 - adenyl-nucleotide exchange factor activity [Evidence IEA]; GO:0051087 - chaperone binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : GrpE-like 1, mitochondrial protein_id : NP_077798.1

name	Ccdc96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385186 CCDS:CCDS19239.1 GeneID:66717 MGI:1913967
definition	codon_start : 1 product : coiled-coil domain containing 96 protein_id : NP_080001.1

name	Tbc1d14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559985 CCDS:CCDS19240.1 GeneID:100855 MGI:1098708
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 14 protein_id : NP_598671.2

name	D5Ertd579e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486995 GeneID:320661 MGI:1261849
definition	codon_start : 1 product : hypothetical protein LOC320661 protein_id : NP_001074701.1

name	LOC100040825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253873 GeneID:100040825
definition	codon_start : 1 product : similar to D5Ertd579e protein protein_id : XP_001476213.1

name	LOC100040278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253860 GeneID:100040278
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474458.1

name	Cno (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526908 CCDS:CCDS19241.1 GeneID:117197 MGI:1929230
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : cappuccino protein_id : NP_598485.1

name	Mrfap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385746 CCDS:CCDS19242.1 GeneID:67568 MGI:1914818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : protein associated with MRG, 14 kDa protein_id : NP_080518.1

name	Man2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678792 CCDS:CCDS19243.1 GeneID:17160 MGI:1195262
definition	GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 135 kD alpha-D-mannosidase; 135 kDa alpha-D-mannosidase product : mannosidase alpha class 2B member 2 protein_id : NP_032576.1

name	Ppp2r2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370502 CCDS:CCDS19244.1 GeneID:269643 MGI:2442660
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform protein_id : NP_766582.1

name	Wfs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755997 CCDS:CCDS19245.1 GeneID:22393 MGI:1328355
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Wolfram syndrome 1 protein homolog protein_id : NP_035846.1

name	Jakmip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409980 CCDS:CCDS19246.1 GeneID:76071 MGI:1923321
definition	GO_component : GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : gamma-aminobutyric acid (GABA-B) receptor binding protein protein_id : NP_848481.1

name	EG330070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897377 GeneID:330070 MGI:3643506
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902630.1

name	Gm1043 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374702 GeneID:381634 MGI:2685889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355598.4

name	LOC100040936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253875 GeneID:100040936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476359.1

name	Crmp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068507 GeneID:12933 MGI:107793
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : collapsin response mediator protein 1 protein_id : NP_031791.3

name	Evc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947020 CCDS:CCDS19247.1 GeneID:59056 MGI:1890596
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EvC protein (Ellis-van Creveld syndrome) product : Ellis van Creveld gene homolog protein_id : NP_067267.1

name	Evc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122329 CCDS:CCDS19248.1 GeneID:68525 MGI:1915775
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Ellis van Creveld syndrome 2 homolog protein_id : NP_666032.1

name	LOC100040988 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253880 GeneID:100040988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476463.1

name	Stk32b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468971 GeneID:64293 MGI:1927552
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : serine threonine kinase 32 product : serine/threonine kinase 32B protein_id : NP_071861.1

name	Cytl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487395 GeneID:231162 MGI:2684993
definition	codon_start : 1 product : cytokine like 1 protein_id : NP_001074575.1

name	Msx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199783 CCDS:CCDS19249.1 GeneID:17701 MGI:97168
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0030900 - forebrain development [Evidence IMP]; GO:0030901 - midbrain development [Evidence IMP]; GO:0007517 - muscle development [Evidence IPI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : muscle-segment homeobox product : homeo box, msh-like 1 protein_id : NP_034965.2

name	Stx18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77736535 CCDS:CCDS19250.1 GeneID:71116 MGI:1918366
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : syntaxin 18 protein_id : NP_081235.2

name	Nsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543351 CCDS:CCDS19251.1 GeneID:18196 MGI:109149
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050780 - dopamine receptor binding [Evidence IEA] GO_process : GO:0007212 - dopamine receptor signaling pathway [Evidence IEA] codon_start : 1 product : neuron specific gene family member 1 protein_id : NP_035072.2

name	LOC100040397 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253862 GeneID:100040397
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474666.1

name	LOC100040355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040355
definition	number : 1 pseudo : _no_value

clone name	MSMg01-333P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-197M12.b	B6Ng01-197M12.g
ACC	GA019558	GA019559
length	1,140	1,141
definition	B6Ng01-197M12.b	B6Ng01-197M12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(37,587,494 - 37,588,640)	(37,413,741 - 37,414,863)
sequence	gaattccctgtctgttctcaaactgaaaaccaacacatattaagaccaag cccacaggctctggctacgtactgacatacctcggtttctcgtcattgtc cctgtgcaaccttccaggagagaacagagcagggcagggacctctgacct tcctttcaagaggggaaaaggcacctgaggaagagcctgggacgggagct ggaaggtgaggtctaaggacctcagtgtggccttgccatgtgtcaccctg tgcagggtgactatgaagctgtcacagtggaccggtccttcttagagctg cacacaggaaatccttctatcactgcctttgtaccaaagtgggtctgcaa ggcacacggcacctttccagctaaaaccgcaaccgcaagcccttttaaag acaaagacgaaagcactccccactcactgagggctgagagcaagcccgat ttcttaaagtgctctcagaagactctgcttcaaatatttatggaggctgt gaagtggccccggagagtgagtggccctgtcaactccacgcctgctgcag tgatttattggcttgggaattgcttcagacactctctgagtgcttggtgg aaagccagcatcctccaggagttgcagaatggcaagaggctgctggctag gaagagagggtgggatattttgcctccaccccttagacacgatggggaaa gctgtttccccactgctgggcactacccagaatccaggctgagcccgaag acagagacagctggagaagggaaagcagaagtctctgtgtcccttgatgg tggtttctgtgatcacacctcttagcccaggaagatatagcaatgacaag tattgcttacccagcacttttctgtgctggcatcaactgtgaccgttcta aaagggccatcgtcaccgagccacagcccaaggacatggagatggcgacc agttgggctgtcatacccttgccattggagcagtgctggcgtacaggcat tgggctgtggcagaagtgaagtgaaggcttttgttctcaatgacagagaa cacacccttcaacggtagtcgtgtctcctgcatgtaatcctcatgcgctg tcccatgtcactaatgtgcacccacccctggtctggatcc	gaattctttacagaaatctttaacagggttttacaaagcaagaagtaact tggttaactcagttaaccctgagaagaactcagaactgcaaacagatatt atcaacctgtatctaaacatttgtgggacattggttaaggttgctttcaa tgtattggctgcttcccgaaaacgatgaccacaacacacaagtaacacat atacattgttctggggatggaagagtatgtaagataaaattaaagctatg attggtttagcttgtagaagggatagtcagtttggttacattgttccctt caagggaggttaatcttaacatctaagcacacaatagcagagcaggttaa gtcttgagccatctcaaggcataacattaatttggatgcaaggtccagtg aaagttcagtctcttttaaggcaaaagatagttttagaaaatgtgtcact acagactgcacagtaagtttaaagccagcctggaatacgcaaggcactat ttcaaaataacttacagggacagacaaccctttcctggtgacactgcagc acacagtgacatgggttgatggtgggaactaggaaagcaagagggacatg gtacagggtcctaggaacagctattaagaacaaacttcgccgggcagtgg tggcgcatgcctttaatgccagcactcgggaggcagaggcaggcggattt ctgaatttgaggccagcctggtctacaaagtgagttccaggacagccagg gctataccctgtctcaaaacaaaacaaaacaaaacaaacaaaacaaaaca aaaccaaagaacaaaatctctacctagaagctgacagctgtctctaggaa gacgttcccctgaaacagaaattctggcatgtatggaagagtgtttcctg tcattgaccctggctggcagcagtgaagatgctggcgtccaagaggaagt gcttcagtagtgcggagcacagcccatcggaagatgaattaagagaccct acagcactggagggaatttcctaaggtgctgatgttgtgtcagaagggag acccgaaacaatacggcttaatgtctcaacattagaggaacttacttggc tattctgacattccaagtttccccataatcgtgacaacaaa
quality values	Open. Hide. 58 31 42 35 62 62 46 62 62 62 62 62 62 54 62 62 62 62 41 26 62 62 62 62 62 59 62 62 62 62 59 59 62 30 23 32 19 25 23 34 46 32 28 28 33 31 35 49 56 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 59 54 34 48 40 48 46 62 56 42 38 42 48 56 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 54 62 49 47 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 47 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 54 62 62 62 54 54 62 62 62 62 62 62 49 42 62 62 62 58 58 54 54 52 58 50 52 58 58 58 58 58 58 58 54 42 58 58 54 58 52 58 58 54 58 49 58 49 47 48 41 58 42 54 54 52 58 54 58 58 48 45 36 52 58 54 42 58 58 54 58 54 52 58 54 48 58 58 52 54 58 54 58 47 58 52 58 54 58 54 58 58 50 58 42 39 58 58 50 41 58 30 58 33 58 54 38 58 58 58 41 27 47 41 51 58 58 49 50 58 51 48 54 46 42 41 47 50 50 54 40 22 45 46 35 41 49 58 42 46 58 58 49 39 58 51 40 39 51 51 31 58 53 31 48 39 34 35 41 38 46 43 49 40 53 41 28 36 42 50 39 44 41 43 39 40 58 37 33 31 44 37 30 51 43 49 52 44 16 50 43 40 36 49 51 19 47 24 25 39 58 25 32 50 27 40 53 53 53 53 35 26 54 54 12 54 22 50 54 51 26 38 39 14 54 22 19 42 39 53 53 45 54 39 51 35 26 54 37 39 35 35 37 30 34 53 29 54 46 42 54 14 19 40 51 35 31 31 32 40 26 40 29 46 33 37 52 32 45 40 9 34 44 35 26 19 34 31 36 31 37 12 26 40 26 33 32 30 35 32 52 30 23 24 34 35 29 18 42 36 43 24 31 28 21 13 32 14 26 33 18 16 17 16 51 51 32 36 30 39 30 31 29 31 46 43 21 31 32 31 25 15 13 21 23 31 30 31 13 32 22 8 41 22 28 31 30 46 37 12 43 30 7 27 15 30 26 31 36 34 26 38 25 24 36 6 9 11 9 29 18 9 8 31 13 30 19 15 20 13 11 14 22 11 38 37 14 7 11 36 37 21 20 11 6 25 20 9 25 18 31 41 10 10 31 32 13 10 12 14 22 21 22 29 10 8 7 8 21 31 18 9 6 6 11 6 5 12 17 31 31 18 26 33 33 19 11 7 16 13 17 15 30 18 22 32 9 21 17 29 7 20 48 7 8 30 7 13 11 21 19 5 6 8 4 18 15 12 9 28 17 10 12 6 24 29 18 5 23 11 22 17 16 13 11 13 11 20 23 7 5 20 4 4 13 25 6 8 15 11 9 27 21 19 19 5 3 3 3 8 19 5 19 15 8 7 11 3 7 17 8 7 11 27 8 25 16 18 5 2 1 5 16 6 7 7 6 7 18 5 4 3 5 7 5 10 9 14 18 19 6 5 2 1 2 6 11 4 9 24 4 11 6 5 1 3 17 26 11 6 4 11 15 19 4 11 10 9 23 4 20 17 4 4 5 2	Open. Hide. 46 49 43 47 62 62 62 49 25 62 47 32 18 24 18 12 19 29 24 45 28 32 28 28 20 43 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 62 62 62 62 49 34 23 28 28 28 36 50 56 35 35 42 54 46 59 62 62 62 62 59 62 62 62 50 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 46 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 58 45 47 54 54 58 58 58 58 54 58 54 58 58 58 58 54 58 58 45 49 52 58 58 47 58 54 58 58 42 41 58 58 42 58 58 58 58 48 39 54 58 54 58 58 58 58 54 54 50 58 58 54 41 58 58 45 49 52 58 58 58 54 42 58 54 58 58 58 54 51 58 49 53 41 58 58 51 50 41 51 58 51 50 54 52 52 58 52 58 41 49 53 54 58 49 58 53 58 52 53 58 40 58 58 52 53 41 39 58 39 50 58 51 40 49 51 50 50 41 51 49 50 58 58 46 26 35 51 21 58 37 50 54 39 49 53 53 50 58 58 25 20 36 32 50 42 39 11 32 41 39 36 49 23 26 41 33 31 49 38 41 50 50 51 23 52 54 52 42 51 32 52 43 52 29 42 53 51 39 38 37 37 42 38 37 39 29 54 53 41 41 44 44 32 36 39 40 35 35 22 51 31 28 37 42 37 52 37 45 52 51 35 41 27 44 31 40 52 52 23 30 37 53 53 33 32 42 52 32 46 11 40 47 29 49 31 33 49 31 51 29 30 40 18 40 36 40 40 33 21 26 40 29 47 31 47 51 23 46 29 32 40 25 47 29 28 52 32 32 53 45 31 32 51 47 32 33 42 36 36 33 31 32 36 33 29 20 32 42 22 29 31 31 31 22 37 29 31 36 35 35 34 29 23 31 26 37 32 31 37 29 31 14 16 21 30 35 46 46 27 31 26 33 42 29 30 31 15 31 37 13 11 21 30 18 42 35 22 20 31 43 21 28 30 33 9 12 41 22 38 14 31 39 23 46 33 18 33 24 29 9 20 9 15 31 28 29 30 46 24 31 25 33 23 31 33 44 22 32 22 31 33 25 10 10 32 31 15 39 35 32 31 31 31 22 13 11 21 25 26 16 31 5 12 7 31 27 32 10 27 31 10 18 10 13 31 24 33 32 20 25 25 16 26 13 26 7 13 19 19 18 6 24 43 26 12 27 15 9 27 24 16 17 23 22 27 22 28 11 25 9 20 7 20 6 17 30 36 32 32 30 10 5 15 21 22 24 32 19 5 8 10 39 19 13 17 25 36 15 23 21 5 4 4 30 19 15 28 16 6 6 23 13 18 6 6 10 17 11 6 5 6 7 15 12 6 30 8 5 5 27 5 12 11 5 5 10 5 5 8 17 19 11 12 10 16 15 13 7 16 15 5 7 3 4 6 11 4 6 5 15 28 28 6 6 19 20 18 7 16 5 19 16 13 22 7 8 19 3 3 3 15 10 13 4 12 16 23 10 9 22 13 5 7 12 6 6 18 18 7 7 14 6 9 2 2 4 8 4 6 6 9 4 15 8 3 2 4 12 30 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_37587494_37588640
seq2: B6Ng01-197M12.b_47_1186 (reverse)

seq1  GGATCCAGGACAGGGGGTGGGGTGCACATTTAGTGGCCATGGGGACAGCG  50
      ||||||||  ||||||   ||||||||| ||||| | ||| |||||||| 
seq2  GGATCCAGACCAGGGG--TGGGTGCACA-TTAGT-GACAT-GGGACAGC-  44

seq1  GCATGA-GATTACCATGCAGGAGACACCGACTACCCGTGTGAAGGGTGTG  99
      |||||| ||||| ||||||||||||| |||||| |||| |||||||||||
seq2  GCATGAGGATTA-CATGCAGGAGACA-CGACTA-CCGT-TGAAGGGTGTG  90

seq1  TTCTCCTGTCATTGAGAACAAAAGCCTTCACTTCCACTCTGCCACCAGCC  149
      |||| |||||||||||||||||||||||||||||   ||||||| |||||
seq2  TTCT-CTGTCATTGAGAACAAAAGCCTTCACTTCACTTCTGCCA-CAGCC  138

seq1  CAATGCCTGTACGCCAGCACTTGCT-CAATGGC-AGGGTATGACAGCCCA  197
      |||||||||||||||||||| |||| ||||||| ||||||||||||||||
seq2  CAATGCCTGTACGCCAGCAC-TGCTCCAATGGCAAGGGTATGACAGCCCA  187

seq1  ACTGGTCGCCATCTCCATGTCCTT-GGCTGTGGCTCGGTGACGATGG-CC  245
      |||||||||||||||||||||||| |||||||||||||||||||||| ||
seq2  ACTGGTCGCCATCTCCATGTCCTTGGGCTGTGGCTCGGTGACGATGGCCC  237

seq1  TTTTAGAACGGTCACAGTTGATGCCAGCACAG-AAAGTGCTGGGTAAGCA  294
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TTTTAGAACGGTCACAGTTGATGCCAGCACAGAAAAGTGCTGGGTAAGCA  287

seq1  ATACTTGTCATTGCTATATCTTCCTGGGCTAAGAGGTGTGATCACAGAAA  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTTGTCATTGCTATATCTTCCTGGGCTAAGAGGTGTGATCACAGAAA  337

seq1  CCACCATCAAGGGACACAGAGACTTCTGCTTTCCCTTCTCCAGCTGTCTC  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCATCAAGGGACACAGAGACTTCTGCTTTCCCTTCTCCAGCTGTCTC  387

seq1  TGTCTTCGGGCTCAGCCTGGATTCTGGGTAGTGCCCAGCAGTGGGGAAAC  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTCGGGCTCAGCCTGGATTCTGGGTAGTGCCCAGCAGTGGGGAAAC  437

seq1  AGCTTTCCCCATCGTGTCTAAGGGGTGGAGGCAAAATATCCCACCCTCTC  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTTCCCCATCGTGTCTAAGGGGTGGAGGCAAAATATCCCACCCTCTC  487

seq1  TTCCTAGCCAGCAGCCTCTTGCCATTCTGCAACTCCTGGAGGATGCTGGC  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTAGCCAGCAGCCTCTTGCCATTCTGCAACTCCTGGAGGATGCTGGC  537

seq1  TTTCCACCAAGCACTCAGAGAGTGTCTGAAGCAATTCCCAAGCCAATAAA  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCACCAAGCACTCAGAGAGTGTCTGAAGCAATTCCCAAGCCAATAAA  587

seq1  TCACTGCAGCAGGCGTGGAGTTGACAGGGCCACTCACTCTCCGGGGCCAC  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTGCAGCAGGCGTGGAGTTGACAGGGCCACTCACTCTCCGGGGCCAC  637

seq1  TTCACAGCCTCCATAAATATTTGAAGCAGAGTCTTCTGAGAGCACTTTAA  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACAGCCTCCATAAATATTTGAAGCAGAGTCTTCTGAGAGCACTTTAA  687

seq1  GAAATCGGGCTTGCTCTCAGCCCTCAGTGAGTGGGGAGTGCTTTCGTCTT  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATCGGGCTTGCTCTCAGCCCTCAGTGAGTGGGGAGTGCTTTCGTCTT  737

seq1  TGTCTTTAAAAGGGCTTGCGGTTGCGGTTTTAGCTGGAAAGGTGCCGTGT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTTAAAAGGGCTTGCGGTTGCGGTTTTAGCTGGAAAGGTGCCGTGT  787

seq1  GCCTTGCAGACCCACTTTGGTACAAAGGCAGTGATAGAAGGATTTCCTGT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTGCAGACCCACTTTGGTACAAAGGCAGTGATAGAAGGATTTCCTGT  837

seq1  GTGCAGCTCTAAGAAGGACCGGTCCACTGTGACAGCTTCATAGTCACCCT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGCTCTAAGAAGGACCGGTCCACTGTGACAGCTTCATAGTCACCCT  887

seq1  GCACAGGGTGACACATGGCAAGGCCACACTGAGGTCCTTAGACCTCACCT  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGGGTGACACATGGCAAGGCCACACTGAGGTCCTTAGACCTCACCT  937

seq1  TCCAGCTCCCGTCCCAGGCTCTTCCTCAGGTGCCTTTTCCCCTCTTGAAA  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCTCCCGTCCCAGGCTCTTCCTCAGGTGCCTTTTCCCCTCTTGAAA  987

seq1  GGAAGGTCAGAGGTCCCTGCCCTGCTCTGTTCTCTCCTGGAAGGTTGCAC  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGTCAGAGGTCCCTGCCCTGCTCTGTTCTCTCCTGGAAGGTTGCAC  1037

seq1  AGGGACAATGACGAGAAACCGAGGTATGTCAGTACGTAGCCAGAGCCTGT  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACAATGACGAGAAACCGAGGTATGTCAGTACGTAGCCAGAGCCTGT  1087

seq1  GGGCTTGGTCTTAATATGTGTTGGTTTTCAGTTTGAGAACAGACAGGGAA  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTTGGTCTTAATATGTGTTGGTTTTCAGTTTGAGAACAGACAGGGAA  1137

seq1  TTC  1147
      |||
seq2  TTC  1140

seq1: chr5_37413741_37414863
seq2: B6Ng01-197M12.g_77_1206

seq1  AGAAATCTTTAACAGGGTTTTACAAAGCAAGAAGTAACTTGGTTAACTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATCTTTAACAGGGTTTTACAAAGCAAGAAGTAACTTGGTTAACTCA  50

seq1  GTTAACCCTGAGAAGAACTCAGAACTGCAAACAGATATTATCAACCTGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAACCCTGAGAAGAACTCAGAACTGCAAACAGATATTATCAACCTGTA  100

seq1  TCTAAACATTTGTGGGACATTGGTTAAGGTTGCTTTCAATGTATTGGCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAACATTTGTGGGACATTGGTTAAGGTTGCTTTCAATGTATTGGCTG  150

seq1  CTTCCCGAAAACGATGACCACAACACACAAGTAACACATATACATTGTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCGAAAACGATGACCACAACACACAAGTAACACATATACATTGTTC  200

seq1  TGGGGATGGAAGAGTATGTAAGATAAAATTAAAGCTATGATTGGTTTAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGATGGAAGAGTATGTAAGATAAAATTAAAGCTATGATTGGTTTAGC  250

seq1  TTGTAGAAGGGATAGTCAGTTTGGTTACATTGTTCCCTTCAAGGGAGGTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAGAAGGGATAGTCAGTTTGGTTACATTGTTCCCTTCAAGGGAGGTT  300

seq1  AATCTTAACATCTAAGCACACAATAGCAGAGCAGGTTAAGTCTTGAGCCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTAACATCTAAGCACACAATAGCAGAGCAGGTTAAGTCTTGAGCCA  350

seq1  TCTCAAGGCATAACATTAATTTGGATGCAAGGTCCAGTGAAAGTTCAGTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAAGGCATAACATTAATTTGGATGCAAGGTCCAGTGAAAGTTCAGTC  400

seq1  TCTTTTAAGGCAAAAGATAGTTTTAGAAAATGTGTCACTACAGACTGCAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTAAGGCAAAAGATAGTTTTAGAAAATGTGTCACTACAGACTGCAC  450

seq1  AGTAAGTTTAAAGCCAGCCTGGAATACGCAAGGCACTATTTCAAAATAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAGTTTAAAGCCAGCCTGGAATACGCAAGGCACTATTTCAAAATAAC  500

seq1  TTACAGGGACAGACAACCCTTTCCTGGTGACACTGCAGCACACAGTGACA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAGGGACAGACAACCCTTTCCTGGTGACACTGCAGCACACAGTGACA  550

seq1  TGGGTTGATGGTGGGAACTAGGAAAGCAAGAGGGACATGGTACAGGGTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTTGATGGTGGGAACTAGGAAAGCAAGAGGGACATGGTACAGGGTCC  600

seq1  TAGGAACAGCTATTAAGAACAAACTTCGCCGGGCAGTGGTGGCGCATGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGAACAGCTATTAAGAACAAACTTCGCCGGGCAGTGGTGGCGCATGCC  650

seq1  TTTAATGCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAATTTGAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATGCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAATTTGAG  700

seq1  GCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACCCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACCCTG  750

seq1  TCTCAAAACAAAACAAAACAAAACAAAACAAAACAAAACAAAACCAAAGA  800
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TCTCAAAACAAAACAAAACAAAAC-AAACAAAACAAAACAAAACCAAAGA  799

seq1  ACAAAATCTCTACCTAGAAGCTGACAGCTGTCTCTAGGAAGACGTTCCCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAATCTCTACCTAGAAGCTGACAGCTGTCTCTAGGAAGACGTTCCCC  849

seq1  TGAAACAGAAATTCTGGCATGTATGGAAGAGTGTTTCCTGTCATTGACCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAACAGAAATTCTGGCATGTATGGAAGAGTGTTTCCTGTCATTGACCC  899

seq1  TGGCTGGCAGCAGTGAAGATGCTGGCGTCCAAGAGGAAGTGC-TCAGTAG  949
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TGGCTGGCAGCAGTGAAGATGCTGGCGTCCAAGAGGAAGTGCTTCAGTAG  949

seq1  TGCGGAGCACAGCCCATCGGAAGATGAATT-AGAGACCCTACAGCACTGG  998
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TGCGGAGCACAGCCCATCGGAAGATGAATTAAGAGACCCTACAGCACTGG  999

seq1  AGGGAATTTCCTAAGGTGCTGATGTGTGTG-CAG-AGGGAGAACCAGAAC  1046
      ||||||||||||||||||||||||| |||| ||| ||||||| ||  |||
seq2  AGGGAATTTCCTAAGGTGCTGATGT-TGTGTCAGAAGGGAGACCCGAAAC  1048

seq1  AATACGGC-TAATGTCTCAGCATTAGAGG-ACTTACCTGGCCTATCTGAC  1094
      |||||||| |||||||||| ||||||||| |||||| ||||   ||||||
seq2  AATACGGCTTAATGTCTCAACATTAGAGGAACTTACTTGGCTATTCTGAC  1098

seq1  ATT-CAAGTTCCCCC--AGTACTGACAACAAA  1123
      ||| |||||| ||||  | |  ||||||||||
seq2  ATTCCAAGTTTCCCCATAATCGTGACAACAAA  1130

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information