MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-212M10
Chromosome	5 (Build37)
Map Location	129,363,651 - 129,487,864
singlet/doublet	doublet
Overlap gene	Rimbp2
Upstream gene	Tmem132d, Fzd10, LOC100040398, Piwil1
Downstream gene	Stx2, Ran, LOC100040441, Gpr133, LOC100039355, Sfrs8, Mmp17, EG620248, Zfp11, 1700016K13Rik, Mrps17, Gbas, Psph, Cct6a, LOC100038887, Sumf2, Phkg1, Chchd2, 2410018M08Rik, 4930579G22Rik, Vkorc1l1, Gusb, Asl
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tmem132d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243274 MGI:3044963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fzd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93897 MGI:2136761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Piwil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57749 MGI:1928897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rimbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231760 MGI:2443235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13852 MGI:108059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ran (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19384 MGI:1333112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Gpr133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243277 MGI:3041203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 637 ESTs, 5 Proteins

name	Sfrs8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231769 MGI:101760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23948 MGI:1346076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620248 MGI:3643279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2120 ESTs, 8 Proteins

name	Zfp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22648 MGI:99156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74222 MGI:1921472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	Mrps17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66258 MGI:1913508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14467 MGI:1278343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100678 MGI:97788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12466 MGI:107943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67902 MGI:1915152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phkg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18682 MGI:97579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14004 MGI:1261428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410018M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71970 MGI:1919220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930579G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69034 MGI:1923099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vkorc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69568 MGI:1916818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gusb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110006 MGI:95872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109900 MGI:88084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem132d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373150 GeneID:243274 MGI:3044963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 132D transcript_id : NM_172885.2

name	Fzd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41282225 GeneID:93897 MGI:2136761
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : frizzled homolog 10 (Drosophila) transcript_id : NM_175284.3

name	LOC100040398 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254601 GeneID:100040398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040398 transcript_id : XM_001474617.1

name	Piwil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130501 GeneID:57749 MGI:1928897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : piwi-like homolog 1 (Drosophila) transcript_id : NM_021311.3

name	Rimbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487058 GeneID:231760 MGI:2443235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIMS binding protein 2 transcript_id : NM_001081388.1

name	Stx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679666 GeneID:13852 MGI:108059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 2 transcript_id : NM_007941.1

name	Ran (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431265 GeneID:19384 MGI:1333112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN, member RAS oncogene family transcript_id : NM_009391.3

name	Gpr133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486786 GeneID:243277 MGI:3041203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 133 transcript_id : NM_001081342.1

name	LOC100039355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254589 GeneID:100039355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 637 ESTs, 5 Proteins product : similar to Rps16 protein transcript_id : XM_001472799.1

name	Sfrs8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624779 GeneID:231769 MGI:101760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 8 transcript_id : NM_172276.3

name	Mmp17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130008 GeneID:23948 MGI:1346076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 17 transcript_id : NM_011846.4

name	EG620248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254591 GeneID:620248 MGI:3643279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2120 ESTs, 8 Proteins product : predicted gene, EG620248, transcript variant 1 transcript_id : XM_620258.4

name	Zfp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937378 GeneID:22648 MGI:99156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 11 transcript_id : NM_172462.4

name	1700016K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254603 GeneID:74222 MGI:1921472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : RIKEN cDNA 1700016K13 gene transcript_id : XM_980219.2

name	Mrps17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383452 GeneID:66258 MGI:1913508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S17 transcript_id : NM_025450.2

name	Gbas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369366 GeneID:14467 MGI:1278343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glioblastoma amplified sequence transcript_id : NM_008095.3

name	Psph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372741 GeneID:100678 MGI:97788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoserine phosphatase transcript_id : NM_133900.3

name	Cct6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753323 GeneID:12466 MGI:107943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 6a (zeta) transcript_id : NM_009838.1

name	LOC100038887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254606 GeneID:100038887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038887 transcript_id : XM_001471643.1

name	Sumf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381003 GeneID:67902 MGI:1915152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfatase modifying factor 2 transcript_id : NM_026445.2

name	Phkg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404187 GeneID:18682 MGI:97579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase gamma 1 transcript_id : NM_011079.2

name	Chchd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369831 GeneID:14004 MGI:1261428
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 2 transcript_id : NM_024166.5

name	2410018M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053872 GeneID:71970 MGI:1919220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018M08 gene transcript_id : NM_183088.2

name	Vkorc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47717110 GeneID:69568 MGI:1916818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1-like 1 transcript_id : NM_027121.3

name	Vkorc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47717108 GeneID:69568 MGI:1916818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1-like 1 transcript_id : NM_001001327.1

name	Gusb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754097 GeneID:110006 MGI:95872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucuronidase, beta transcript_id : NM_010368.1

name	Asl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353065 GeneID:109900 MGI:88084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : argininosuccinate lyase transcript_id : NM_133768.3

name	Tmem132d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370350 GeneID:243274 MGI:3044963
definition	codon_start : 1 product : hypothetical protein LOC243274 protein_id : NP_766473.1

name	Fzd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202015 GeneID:93897 MGI:2136761
definition	GO_function : GO:0004926 - non-G-protein coupled 7TM receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IGI] codon_start : 1 product : frizzled 10 protein_id : NP_780493.1

name	LOC100040398 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254602 GeneID:100040398
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474667.1

name	Piwil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946612 CCDS:CCDS19690.1 GeneID:57749 MGI:1928897
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : piwi like homolog 1 protein_id : NP_067286.1

name	Rimbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487059 GeneID:231760 MGI:2443235
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : RIMS binding protein 2 protein_id : NP_001074857.1

name	Stx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679667 CCDS:CCDS19692.1 GeneID:13852 MGI:108059
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IDA]; GO:0007566 - embryo implantation [Evidence IC]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epimorphin product : syntaxin 2 protein_id : NP_031967.1

name	Ran (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678365 CCDS:CCDS19693.1 GeneID:19384 MGI:1333112
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAN, member RAS oncogene family protein_id : NP_033417.1

name	Gpr133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486787 GeneID:243277 MGI:3041203
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 133 protein_id : NP_001074811.1

name	LOC100039355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254590 GeneID:100039355
definition	codon_start : 1 product : similar to Rps16 protein protein_id : XP_001472849.1

name	Sfrs8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78217391 CCDS:CCDS19694.1 GeneID:231769 MGI:101760
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : splicing factor, arginine/serine-rich 8 protein_id : NP_758480.2

name	Mmp17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543257 CCDS:CCDS19695.1 GeneID:23948 MGI:1346076
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : membrane-type matrix metalloproteinase 4; membrane type-4 matrix metalloproteinase; matrix metalloproteinase-17 product : matrix metalloproteinase 17 protein_id : NP_035976.3

name	EG620248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63531110 GeneID:620248 MGI:3643279
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_620258.1

name	Zfp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27804329 GeneID:22648 MGI:99156
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 11 protein_id : NP_766050.1

name	1700016K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254604 GeneID:74222 MGI:1921472
definition	codon_start : 1 product : hypothetical protein LOC74222 protein_id : XP_985313.2

name	Mrps17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384854 CCDS:CCDS19697.1 GeneID:66258 MGI:1913508
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S17 protein_id : NP_079726.1

name	Gbas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832137 CCDS:CCDS19698.1 GeneID:14467 MGI:1278343
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : glioblastoma amplified protein_id : NP_032121.2

name	Psph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527116 CCDS:CCDS19699.1 GeneID:100678 MGI:97788
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphoserine phosphatase protein_id : NP_598661.1

name	Cct6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753324 GeneID:12466 MGI:107943
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : CCT is a molecular chaperone which assists the folding of proteins in eukaryotic cytosol note : chaperonin containing TCP-1; snoRNA MBI-79 product : chaperonin subunit 6a (zeta) protein_id : NP_033968.1

name	LOC100038887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254607 GeneID:100038887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471693.1

name	Sumf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77377292 CCDS:CCDS19700.1 GeneID:67902 MGI:1915152
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI] codon_start : 1 product : sulfatase modifying factor 2 protein_id : NP_080721.1

name	Phkg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755054 CCDS:CCDS19701.1 GeneID:18682 MGI:97579
definition	GO_component : GO:0005964 - phosphorylase kinase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : phosphorylase kinase gamma 1 protein_id : NP_035209.1

name	Chchd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079334 CCDS:CCDS19702.1 GeneID:14004 MGI:1261428
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ethanol induced 6 product : coiled-coil-helix-coiled-coil-helix domain containing 2 protein_id : NP_077128.2

name	2410018M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053873 GeneID:71970 MGI:1919220
definition	codon_start : 1 product : hypothetical protein LOC71970 protein_id : NP_898911.2

name	Vkorc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309457 CCDS:CCDS19703.1 GeneID:69568 MGI:1916818
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0042373 - vitamin K metabolism [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : vitamin K epoxide reductase complex, subunit 1-like 1 isoform 1 protein_id : NP_081397.1

name	Vkorc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47717109 CCDS:CCDS19704.1 GeneID:69568 MGI:1916818
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0042373 - vitamin K metabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : vitamin K epoxide reductase complex, subunit 1-like 1 isoform 2 protein_id : NP_001001327.1

name	Gusb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754098 CCDS:CCDS19705.1 GeneID:110006 MGI:95872
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004566 - beta-glucuronidase activity [Evidence IDA]; GO:0043169 - cation binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : adipose storage deficiency; beta-glucuronidase product : glucuronidase, beta protein_id : NP_034498.1

name	Asl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526986 GeneID:109900 MGI:88084
definition	GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA] codon_start : 1 product : argininosuccinate lyase protein_id : NP_598529.1

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 1 pseudo : _no_value

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 2 pseudo : _no_value

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 3 pseudo : _no_value

name	4930579G22Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254608 GeneID:69034 MGI:1923099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579G22 gene transcript_id : XR_035134.1

clone name	MSMg01-425I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447K17
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-184D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-212M10.b	B6Ng01-212M10.g
ACC	GA030486	GA030487
length	798	910
definition	B6Ng01-212M10.b	B6Ng01-212M10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(129,363,651 - 129,364,442)	(129,486,960 - 129,487,864)
sequence	gaattcatactgtatcatactttcaaggaccacactaactcataccggcc tttgggctgttgcacacactggcagtctaacaaatgagtagctgcttatt gttaggatttcactgccaaccagcaccatggtgggttcctaacacaaggg tcataacacaagatgctcgtgcaaactgaagatcctcctatgggaaaaga agtgtcccgatgtcctggccgtgactctggccagatgacctgctcagaag ccccaagtatagtcagtaatggggctccccagggaacccccaagataaac cctgatcttatgagctatatcctagctggggagatacacaaaggaccacg atgtgccagatgaattaggttctaggaaaagacaactcagagcaagagag agagagagagagagagagagagagagagagagagagagaacagaactgtg acatgaaccaagcctaggaaggaagagttcgtggatatctcaagagcaga ggccctggggagatgaaaacaggagttctgggagaatcggaaccagatag ggcttcaacagataatcaagaagacaaggtagggggagccaggatgccac tagctgcccctaagacccagcacacagcaccagtcaaaatgtatggcctc gtgtggatccatggcattacctagctagagagagcgccatgtgtgagctg tcatctgtgggacctactggggaatctttctctctgatactgtagcttca ctggggctccgaaaccctgaaatttccccctttttctgcagaactgag	gaattctctccccgagacacccacgtggctcactcccacactagtctggg gccttagccttaaggccacctgctcagagaggcctaacatggcctgtact ctcatagacacccctccccgcacctcacccctacccccacacaccgtttt ccatttcttcctagggctgtctctgccctccacaccggagtcactcatgt actatccgttctgaccagcaggtggcagcattgctcaccgtgccctctgt gctatatagggcacactgtccgatacataaaaatgattaaggctcagaat aggagccaccatctccagtacctgctcatgtccttgccgttaaatgctac cgctgatttaatgcaatgactcaactgcttcgttcaagtgtgggcaagta tagaggtaccgtttaagcaggactctggcatctaaatccgggaaaagcca atgaaatgagctctgttcagaagaggggtgtgttaaagggattttttttt tcctttttaaaatacatggagaacaaccgaggaagggtttattttggctt ccagtttctgaggttttggcactattggcctggctccatcgctttgggac agaggtaactagaaagtgtgacagtcagaaagcagagagatatggaaaag gaccagggatagaataaccctacagagacaccccactccccacacccacc ccacacgggaccttgtgctagctagttttttttttttgttgttgttgttt ttgttttttgtttttgttgttgttttttttttttttaaacttgacacaag ctagaaatcatctgagaggaaggaaacctaatggagaaaatgcctccata agattaacctgtgtgtaaacctgtgggtcggtttctttgactgctgattg atggcgggga
quality values	Open. Hide. 49 36 28 33 62 38 27 62 62 62 62 49 62 56 49 37 42 62 62 62 62 62 62 32 24 47 62 62 59 59 47 43 39 34 32 34 39 27 28 31 20 23 43 43 48 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 59 48 62 56 48 54 62 54 62 48 49 42 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 59 62 51 59 34 39 34 34 23 18 36 24 43 56 59 49 50 51 51 51 46 62 62 62 62 59 51 43 43 51 59 59 59 44 50 59 56 45 46 56 46 59 62 59 51 51 50 43 45 59 51 62 44 47 62 59 59 59 59 51 59 62 51 51 51 38 62 51 56 39 45 45 45 50 43 51 51 47 44 56 50 39 44 44 32 32 47 42 30 56 44 32 42 42 62 47 62 20 14 11 10 22 16 10 10 11 16 30 56 62 62 42 38 62 47 56 51 56 56 42 39 26 43 31 38 38 38 27 56 51 42 39 38 38 22 25 20 50 39 24 56 39 20 31 32 56 23 38 50 62 62 31 43 36 22 27 39 39 38 38 36 56 56 47 47 23 42 27 24 20 27 33 56 43 43 35 32 32 22 30 22 56 46 46 38 10 19 30 22 52 35 47 35 15 21 10 18 22 14 27 42 33 43 43 34 46 46 52 42 31 50 47 40 24 41 43 39 33 31 41 43 52 34 48 42 41 41 27 25 40 33 27 28 36 28 22 31 34 23 15 10 13 17 16 23 35 13 33 29 30 33 39 29 49 37 39 45 52 52 52 52 27 42 19 35 32 32 19 42 30 36 52 33 46 14 28 33 20 35 27 27 22 19 25 32 20 54 52 34 42 37 36 37 25 32 37 54 52 39 28 30 19 22 37 31 38 24 42 50 15 25 12 13 35 29 28 9 13 20 28 34 24 44 32 45 16 48 27 50 37 9 12 33 33 19 34 13 25 9 9 7 26 32 24 33 19 12 9 9 11 12 8 11 7 37 16 28 10 29 15 12 22 25 32 12	Open. Hide. 62 47 62 47 62 62 62 62 62 62 38 38 38 21 24 21 15 32 32 28 34 28 43 38 33 46 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 54 59 59 59 62 59 59 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 46 49 62 44 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 47 42 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 47 62 62 62 62 62 56 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 47 39 62 62 46 62 62 62 46 62 47 62 62 41 47 54 31 62 62 62 62 53 62 52 62 48 46 42 62 62 62 62 47 46 52 54 54 49 58 58 58 54 54 58 54 58 52 44 58 52 58 40 52 41 34 32 52 50 54 54 52 46 41 35 46 52 58 33 54 54 58 54 38 54 49 54 58 58 58 45 49 54 38 54 43 52 52 54 58 54 42 46 58 58 58 52 54 52 33 58 31 58 52 42 29 46 45 58 49 49 58 58 58 40 49 43 42 47 41 33 50 58 30 50 47 37 46 50 39 50 49 47 27 28 48 37 46 50 39 51 46 52 31 37 48 44 48 50 50 49 58 40 51 51 49 46 49 50 49 58 51 50 41 28 35 40 39 47 52 50 46 58 46 26 15 49 41 33 50 12 46 42 33 49 32 33 28 39 58 19 58 54 58 54 50 49 50 49 51 43 26 49 26 36 58 16 26 58 34 50 58 39 51 51 50 37 58 33 52 41 58 50 24 22 21 50 51 41 47 54 14 28 54 25 30 51 49 50 50 52 54 54 40 32 51 25 41 40 50 34 33 52 36 39 33 32 38 30 33 30 40 32 24 37 33 21 32 18 13 54 27 52 52 23 37 33 31 52 31 13 28 12 35 32 40 34 30 34 27 28 25 15 25 28 14 25 49 37 36 9 40 47 40 21 19 29 9 25 32 31 32 21 23 40 38 15 34 21 17 12 29 31 14 13 26 17 31 10 12 21 23 47 14 15 47 30 33 11 12 24 12 13 29 19 33 17 32 9 8 10 37 8 26 26 30 28 31 16 22 11 14 23 19 13 13 22 8 27 23 21 32 40 31 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_129363651_129364442
seq2: B6Ng01-212M10.b_43_840

seq1  GAATTCATACTGTATCATACTTTCAAGGACCACACTAACTCATACCGGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATACTGTATCATACTTTCAAGGACCACACTAACTCATACCGGCC  50

seq1  TTTGGGCTGTTGCACACACTGGCAGTCTAACAAATGAGTAGCTGCTTATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGCTGTTGCACACACTGGCAGTCTAACAAATGAGTAGCTGCTTATT  100

seq1  GTTAGGATTTCACTGCCAACCAGCACCATGGTGGGTTCCTAACACAAGGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGGATTTCACTGCCAACCAGCACCATGGTGGGTTCCTAACACAAGGG  150

seq1  TCATAACACAAGATGCTCGTGCAAACTGAAGATCCTCCTATGGGAAAAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAACACAAGATGCTCGTGCAAACTGAAGATCCTCCTATGGGAAAAGA  200

seq1  AGTGTCCCGATGTCCTGGCCGTGACTCTGGCCAGATGACCTGCTCAGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTCCCGATGTCCTGGCCGTGACTCTGGCCAGATGACCTGCTCAGAAG  250

seq1  CCCCAAGTATAGTCAGTAATGGGGCTCCCCAGGGAACCCCCAAGATAAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAAGTATAGTCAGTAATGGGGCTCCCCAGGGAACCCCCAAGATAAAC  300

seq1  CCTGATCTTATGAGCTATATCCTAGCTGGGGAGATACACAAAGGACCACG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGATCTTATGAGCTATATCCTAGCTGGGGAGATACACAAAGGACCACG  350

seq1  ATGTGCCAGATGAATTAGGTTCTAGGAAAAGACAACTCAGAGCAAGAGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGCCAGATGAATTAGGTTCTAGGAAAAGACAACTCAGAGCAAGAGAG  400

seq1  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAACAGAACTGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAACAGAACTGTG  450

seq1  ACATGAACCAAGCCTAGGAAGGAAGAGTTCGTGGATATCTCAAGAGCAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGAACCAAGCCTAGGAAGGAAGAGTTCGTGGATATCTCAAGAGCAGA  500

seq1  GGCCCTGGGGAGATGAAAACAGGAGTTCTGGGAGAATCGGAACCAGATAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCTGGGGAGATGAAAACAGGAGTTCTGGGAGAATCGGAACCAGATAG  550

seq1  GGCTTCAACAGATAATCAAGAAGACAAGGTAGGGGGAGCCAGGATGCCAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCAACAGATAATCAAGAAGACAAGGTAGGGGGAGCCAGGATGCCAC  600

seq1  TAGCTGCCCCTAAGACCCAGCACACAGCACCAGTCAAAATGTATGGCCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTGCCCCTAAGACCCAGCACACAGCACCAGTCAAAATGTATGGCCTC  650

seq1  GTGTGGATCCATGGCATTACCTAGCTAGAGAGAGCGCCATGTGTGAGCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGGATCCATGGCATTACCTAGCTAGAGAGAGCGCCATGTGTGAGCTG  700

seq1  TCATCTGT-GGACCTACT-GGGAATCTTTCTCTCTGATACTGTAGCTTCA  748
      |||||||| ||||||||| |||||||||||||||||||||||||||||||
seq2  TCATCTGTGGGACCTACTGGGGAATCTTTCTCTCTGATACTGTAGCTTCA  750

seq1  CTGGGGCTCCG-AACCCTG-AATTTCCCC--TTTCCTGCAGAACTGAG  792
      ||||||||||| ||||||| |||||||||  ||| |||||||||||||
seq2  CTGGGGCTCCGAAACCCTGAAATTTCCCCCTTTTTCTGCAGAACTGAG  798

seq1: chr5_129486960_129487864
seq2: B6Ng01-212M10.g_67_976 (reverse)

seq1  TCCCCG-CATCAATCAGCAGTC-AAGAAACCGA-CCACAGGTTTACACAC  47
      |||||| ||||||||||||||| |||||||||| ||||||||||||||||
seq2  TCCCCGCCATCAATCAGCAGTCAAAGAAACCGACCCACAGGTTTACACAC  50

seq1  AGGTTAATCTTATGGAGGCATTTTCTCCATTAGGTTTCCTTCCTCTCAGA  97
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTAATCTTATGGAGGCATTTTCTCCATTAGGTTTCCTTCCTCTCAGA  100

seq1  TGA-TTCTAGCTTGTGTCAAGTTTAAAAAAAAAAAAAACAACAACAAAAA  146
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTCTAGCTTGTGTCAAGTTTAAAAAAAAAAAAAACAACAACAAAAA  150

seq1  CAAAAAACAAAAACAACAACAAC-AAAAAAAAAAACTAGCTAGCACAAGG  195
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  CAAAAAACAAAAACAACAACAACAAAAAAAAAAAACTAGCTAGCACAAGG  200

seq1  TCCCGTGTGGGGTGGGTGTGGGGAGTGGGGTGTCTCTGTAGGGTTATTCT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGTGTGGGGTGGGTGTGGGGAGTGGGGTGTCTCTGTAGGGTTATTCT  250

seq1  ATCCCTGGTCCTTTTCCATATCTCTCTGCTTTCTGACTGTCACACTTTCT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCTGGTCCTTTTCCATATCTCTCTGCTTTCTGACTGTCACACTTTCT  300

seq1  AGTTACCTCTGTCCCAAAGCGATGGAGCCAGGCCAATAGTGCCAAAACCT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTACCTCTGTCCCAAAGCGATGGAGCCAGGCCAATAGTGCCAAAACCT  350

seq1  CAGAAACTGGAAGCCAAAATAAACCCTTCCTCGGTTGTTCTCCATGTATT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAACTGGAAGCCAAAATAAACCCTTCCTCGGTTGTTCTCCATGTATT  400

seq1  TTAAAAAGGAAAAAAAAAATCCCTTTAACACACCCCTCTTCTGAACAGAG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAGGAAAAAAAAAATCCCTTTAACACACCCCTCTTCTGAACAGAG  450

seq1  CTCATTTCATTGGCTTTTCCCGGATTTAGATGCCAGAGTCCTGCTTAAAC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATTTCATTGGCTTTTCCCGGATTTAGATGCCAGAGTCCTGCTTAAAC  500

seq1  GGTACCTCTATACTTGCCCACACTTGAACGAAGCAGTTGAGTCATTGCAT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACCTCTATACTTGCCCACACTTGAACGAAGCAGTTGAGTCATTGCAT  550

seq1  TAAATCAGCGGTAGCATTTAACGGCAAGGACATGAGCAGGTACTGGAGAT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATCAGCGGTAGCATTTAACGGCAAGGACATGAGCAGGTACTGGAGAT  600

seq1  GGTGGCTCCTATTCTGAGCCTTAATCATTTTTATGTATCGGACAGTGTGC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCTCCTATTCTGAGCCTTAATCATTTTTATGTATCGGACAGTGTGC  650

seq1  CCTATATAGCACAGAGGGCACGGTGAGCAATGCTGCCACCTGCTGGTCAG  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATATAGCACAGAGGGCACGGTGAGCAATGCTGCCACCTGCTGGTCAG  700

seq1  AACGGATAGTACATGAGTGACTCCGGTGTGGAGGGCAGAGACAGCCCTAG  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGGATAGTACATGAGTGACTCCGGTGTGGAGGGCAGAGACAGCCCTAG  750

seq1  GAAGAAATGGAAAACGGTGTGTGGGGGTAGGGGTGAGGTGCGGGGAGGGG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAATGGAAAACGGTGTGTGGGGGTAGGGGTGAGGTGCGGGGAGGGG  800

seq1  TGTCTATGAGAGTACAGGCCATGTTAGGCCTCTCTGAGCAGGTGGCCTTA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTATGAGAGTACAGGCCATGTTAGGCCTCTCTGAGCAGGTGGCCTTA  850

seq1  AGGCTAAGGCCCCAGACTAGTGTGGGAGTGAGCCACGTGGGTGTCTCGGG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTAAGGCCCCAGACTAGTGTGGGAGTGAGCCACGTGGGTGTCTCGGG  900

seq1  GAGAGAATTC  905
      ||||||||||
seq2  GAGAGAATTC  910

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information