MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233M14
Chromosome	5 (Build37)
Map Location	130,355,928 - 130,474,919
singlet/doublet	doublet
Overlap gene	Chchd2, 2410018M08Rik, 4930579G22Rik, Vkorc1l1, Gusb
Upstream gene	Rimbp2, Stx2, Ran, LOC100040441, Gpr133, LOC100039355, Sfrs8, Mmp17, EG620248, Zfp11, 1700016K13Rik, Mrps17, Gbas, Psph, Cct6a, LOC100038887, Sumf2, Phkg1
Downstream gene	Asl, Crcp, Tpst1, Kctd7, Rabgef1, 0610007L01Rik, EG625540, Sbds, Tyw1, A330070K13Rik, Caln1, Wbscr17
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rimbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231760 MGI:2443235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13852 MGI:108059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ran (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19384 MGI:1333112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Gpr133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243277 MGI:3041203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 637 ESTs, 5 Proteins

name	Sfrs8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231769 MGI:101760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23948 MGI:1346076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620248 MGI:3643279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2120 ESTs, 8 Proteins

name	Zfp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22648 MGI:99156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700016K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74222 MGI:1921472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	Mrps17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66258 MGI:1913508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14467 MGI:1278343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100678 MGI:97788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12466 MGI:107943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sumf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67902 MGI:1915152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phkg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18682 MGI:97579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14004 MGI:1261428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410018M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71970 MGI:1919220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930579G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69034 MGI:1923099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vkorc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69568 MGI:1916818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gusb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110006 MGI:95872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109900 MGI:88084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crcp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12909 MGI:1100818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22021 MGI:1298231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212919 MGI:2442265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56715 MGI:1929459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610007L01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71667 MGI:1918917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625540 MGI:3646314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Sbds (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66711 MGI:1913961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tyw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100929 MGI:2141161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A330070K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381673 MGI:2685897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Caln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140904 MGI:2155987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212996 MGI:2137594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rimbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487058 GeneID:231760 MGI:2443235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIMS binding protein 2 transcript_id : NM_001081388.1

name	Stx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679666 GeneID:13852 MGI:108059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 2 transcript_id : NM_007941.1

name	Ran (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431265 GeneID:19384 MGI:1333112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN, member RAS oncogene family transcript_id : NM_009391.3

name	Gpr133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486786 GeneID:243277 MGI:3041203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 133 transcript_id : NM_001081342.1

name	LOC100039355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254589 GeneID:100039355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 637 ESTs, 5 Proteins product : similar to Rps16 protein transcript_id : XM_001472799.1

name	Sfrs8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624779 GeneID:231769 MGI:101760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 8 transcript_id : NM_172276.3

name	Mmp17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130008 GeneID:23948 MGI:1346076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 17 transcript_id : NM_011846.4

name	EG620248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254591 GeneID:620248 MGI:3643279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2120 ESTs, 8 Proteins product : predicted gene, EG620248, transcript variant 1 transcript_id : XM_620258.4

name	Zfp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937378 GeneID:22648 MGI:99156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 11 transcript_id : NM_172462.4

name	1700016K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254603 GeneID:74222 MGI:1921472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : RIKEN cDNA 1700016K13 gene transcript_id : XM_980219.2

name	Mrps17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383452 GeneID:66258 MGI:1913508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S17 transcript_id : NM_025450.2

name	Gbas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369366 GeneID:14467 MGI:1278343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glioblastoma amplified sequence transcript_id : NM_008095.3

name	Psph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372741 GeneID:100678 MGI:97788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoserine phosphatase transcript_id : NM_133900.3

name	Cct6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753323 GeneID:12466 MGI:107943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 6a (zeta) transcript_id : NM_009838.1

name	LOC100038887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254606 GeneID:100038887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038887 transcript_id : XM_001471643.1

name	Sumf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381003 GeneID:67902 MGI:1915152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfatase modifying factor 2 transcript_id : NM_026445.2

name	Phkg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404187 GeneID:18682 MGI:97579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase gamma 1 transcript_id : NM_011079.2

name	Chchd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369831 GeneID:14004 MGI:1261428
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 2 transcript_id : NM_024166.5

name	2410018M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053872 GeneID:71970 MGI:1919220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018M08 gene transcript_id : NM_183088.2

name	Vkorc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47717110 GeneID:69568 MGI:1916818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1-like 1 transcript_id : NM_027121.3

name	Vkorc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47717108 GeneID:69568 MGI:1916818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1-like 1 transcript_id : NM_001001327.1

name	Gusb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754097 GeneID:110006 MGI:95872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucuronidase, beta transcript_id : NM_010368.1

name	Asl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353065 GeneID:109900 MGI:88084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : argininosuccinate lyase transcript_id : NM_133768.3

name	Crcp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131170 GeneID:12909 MGI:1100818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcitonin gene-related peptide-receptor component protein transcript_id : NM_007761.2

name	Tpst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305590 GeneID:22021 MGI:1298231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-tyrosine sulfotransferase 1 transcript_id : NM_013837.1

name	Kctd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802772 GeneID:212919 MGI:2442265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 7 transcript_id : NM_172509.2

name	Rabgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982702 GeneID:56715 MGI:1929459
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_019983.2

name	0610007L01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487090 GeneID:71667 MGI:1918917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610007L01 gene transcript_id : NM_001081394.1

name	EG625540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375698 GeneID:625540 MGI:3646314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG625540 transcript_id : XM_890123.2

name	Sbds (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956137 GeneID:66711 MGI:1913961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Shwachman-Bodian-Diamond syndrome homolog (human) transcript_id : NM_023248.1

name	Tyw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371853 GeneID:100929 MGI:2141161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) transcript_id : NM_178897.3

name	Tyw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62899040 GeneID:100929 MGI:2141161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA-yW synthesizing protein 1 homolog (S. cerevisiae) transcript_id : NM_001015876.1

name	Caln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946703 GeneID:140904 MGI:2155987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calneuron 1 transcript_id : NM_021371.1

name	Wbscr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347503 GeneID:212996 MGI:2137594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 17 homolog (human) transcript_id : NM_145218.3

name	Stx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679667 CCDS:CCDS19692.1 GeneID:13852 MGI:108059
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IDA]; GO:0007566 - embryo implantation [Evidence IC]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epimorphin product : syntaxin 2 protein_id : NP_031967.1

name	Ran (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678365 CCDS:CCDS19693.1 GeneID:19384 MGI:1333112
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAN, member RAS oncogene family protein_id : NP_033417.1

name	Gpr133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486787 GeneID:243277 MGI:3041203
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 133 protein_id : NP_001074811.1

name	LOC100039355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254590 GeneID:100039355
definition	codon_start : 1 product : similar to Rps16 protein protein_id : XP_001472849.1

name	Sfrs8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78217391 CCDS:CCDS19694.1 GeneID:231769 MGI:101760
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : splicing factor, arginine/serine-rich 8 protein_id : NP_758480.2

name	Mmp17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543257 CCDS:CCDS19695.1 GeneID:23948 MGI:1346076
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : membrane-type matrix metalloproteinase 4; membrane type-4 matrix metalloproteinase; matrix metalloproteinase-17 product : matrix metalloproteinase 17 protein_id : NP_035976.3

name	EG620248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63531110 GeneID:620248 MGI:3643279
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_620258.1

name	Zfp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27804329 GeneID:22648 MGI:99156
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 11 protein_id : NP_766050.1

name	1700016K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254604 GeneID:74222 MGI:1921472
definition	codon_start : 1 product : hypothetical protein LOC74222 protein_id : XP_985313.2

name	Mrps17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384854 CCDS:CCDS19697.1 GeneID:66258 MGI:1913508
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S17 protein_id : NP_079726.1

name	Gbas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832137 CCDS:CCDS19698.1 GeneID:14467 MGI:1278343
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : glioblastoma amplified protein_id : NP_032121.2

name	Psph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527116 CCDS:CCDS19699.1 GeneID:100678 MGI:97788
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphoserine phosphatase protein_id : NP_598661.1

name	Cct6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753324 GeneID:12466 MGI:107943
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : CCT is a molecular chaperone which assists the folding of proteins in eukaryotic cytosol note : chaperonin containing TCP-1; snoRNA MBI-79 product : chaperonin subunit 6a (zeta) protein_id : NP_033968.1

name	LOC100038887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254607 GeneID:100038887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471693.1

name	Sumf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77377292 CCDS:CCDS19700.1 GeneID:67902 MGI:1915152
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI] codon_start : 1 product : sulfatase modifying factor 2 protein_id : NP_080721.1

name	Phkg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755054 CCDS:CCDS19701.1 GeneID:18682 MGI:97579
definition	GO_component : GO:0005964 - phosphorylase kinase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : phosphorylase kinase gamma 1 protein_id : NP_035209.1

name	Chchd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079334 CCDS:CCDS19702.1 GeneID:14004 MGI:1261428
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ethanol induced 6 product : coiled-coil-helix-coiled-coil-helix domain containing 2 protein_id : NP_077128.2

name	2410018M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053873 GeneID:71970 MGI:1919220
definition	codon_start : 1 product : hypothetical protein LOC71970 protein_id : NP_898911.2

name	Vkorc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309457 CCDS:CCDS19703.1 GeneID:69568 MGI:1916818
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0042373 - vitamin K metabolism [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : vitamin K epoxide reductase complex, subunit 1-like 1 isoform 1 protein_id : NP_081397.1

name	Vkorc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47717109 CCDS:CCDS19704.1 GeneID:69568 MGI:1916818
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0042373 - vitamin K metabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : vitamin K epoxide reductase complex, subunit 1-like 1 isoform 2 protein_id : NP_001001327.1

name	Gusb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754098 CCDS:CCDS19705.1 GeneID:110006 MGI:95872
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004566 - beta-glucuronidase activity [Evidence IDA]; GO:0043169 - cation binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : adipose storage deficiency; beta-glucuronidase product : glucuronidase, beta protein_id : NP_034498.1

name	Asl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526986 GeneID:109900 MGI:88084
definition	GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA] codon_start : 1 product : argininosuccinate lyase protein_id : NP_598529.1

name	Crcp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681011 CCDS:CCDS19706.1 GeneID:12909 MGI:1100818
definition	GO_component : GO:0001669 - acrosome [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IDA] codon_start : 1 product : calcitonin gene-related peptide-receptor component protein protein_id : NP_031787.1

name	Tpst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305591 GeneID:22021 MGI:1298231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008476 - protein-tyrosine sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 function : O-sulfation of tyrosine residues within acidic motifs of polypeptides product : protein-tyrosine sulfotransferase 1 protein_id : NP_038865.1

name	Kctd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369698 CCDS:CCDS19707.1 GeneID:212919 MGI:2442265
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 7 protein_id : NP_766097.1

name	Rabgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910316 CCDS:CCDS19708.1 GeneID:56715 MGI:1929459
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Ras negative regulator Rabex-5/Rin2; Rab5 exchange factor product : RAB guanine nucleotide exchange factor (GEF) 1 protein_id : NP_064367.1

name	EG625540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899627 GeneID:625540 MGI:3646314
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895216.1

name	0610007L01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487091 GeneID:71667 MGI:1918917
definition	codon_start : 1 product : hypothetical protein LOC71667 protein_id : NP_001074863.1

name	Sbds (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956138 CCDS:CCDS19710.1 GeneID:66711 MGI:1913961
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 product : Shwachman-Bodian-Diamond syndrome homolog protein_id : NP_075737.1

name	Tyw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725740 CCDS:CCDS19711.1 GeneID:100929 MGI:2141161
definition	GO_component : GO:0009279 - outer membrane (sensu Proteobacteria) [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003958 - NADPH-hemoprotein reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; radical S-adenosyl methionine and flavodoxin domains 1 product : radical S-adenosyl methionine and flavodoxin domains 1 isoform 2 protein_id : NP_849228.1

name	Tyw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62899041 CCDS:CCDS19712.1 GeneID:100929 MGI:2141161
definition	GO_component : GO:0009279 - outer membrane (sensu Proteobacteria) [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0003958 - NADPH-hemoprotein reductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; radical S-adenosyl methionine and flavodoxin domains 1 product : radical S-adenosyl methionine and flavodoxin domains 1 isoform 1 protein_id : NP_001015876.1

name	Caln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946704 CCDS:CCDS19714.1 GeneID:140904 MGI:2155987
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calneuron 1 protein_id : NP_067346.1

name	Wbscr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32401429 GeneID:212996 MGI:2137594
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase; protein-UDP acetylgalactosaminyltransferase-like protein 3 product : UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-like 3 protein_id : NP_660253.2

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 1 pseudo : _no_value

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 2 pseudo : _no_value

name	LOC100040441 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040441
definition	number : 3 pseudo : _no_value

name	4930579G22Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254608 GeneID:69034 MGI:1923099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930579G22 gene transcript_id : XR_035134.1

name	A330070K13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254616 GeneID:381673 MGI:2685897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA A330070K13 gene transcript_id : XR_035246.1

clone name	MSMg01-108P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233M14.b	B6Ng01-233M14.g
ACC	GA045744	GA045745
length	1,154	1,067
definition	B6Ng01-233M14.b	B6Ng01-233M14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(130,355,928 - 130,357,081)	(130,473,855 - 130,474,919)
sequence	gaattcactctgtagaccagggtggccttgaactcagaaatttgcctgcc tcctctgcctcccaagtgctgggattaaactcgtgtgctaccattgccca gtgaagacaagactcttattacacaactctgacgacccagaaaccgtgca gaccaagaggcctccacacttgcactcctgcttctgcttgtgtgttggca ctatagggtgcaacaccaagcatgactttttttttttaagttttttattt tatgtatgtgagtacactgtagctgtctttagacataccagaggagggca tcggatgccattacagatggtttgtgagccaccatgtagttgctgggaat tgaactccatgtttttgttgttgatgtttggctggtttttgtgtgggaca gggttctctgtgtagccccagctgtcctggagctcaccctgtagacccgg ccagcctcagactctcagggatccaccggctgtgatcccagagctgtgat taagtgtgcactaccacgcctggctacaggatggtttttaactgggtatg gtggcacaagcctctaatcccagcacttgggaggctgaggcaggataggc catttacacagatctggactatatagggagacccaacggcttgcgtacgc tgcctccatgcagacacgcagtgtcacgtggccatcggaggtctcagtaa tgtctacctgcttaccacttacttagctacttggtttgttggcatggctg aagacaggactcaagcctggtgaatactagacaagcctgctgcagctgag tatcacaccagctccctgacacatcacaattagcatgtgatcaaagttaa aaaatatatatatatatatctctgtctcctgggattaaaagcatgtacca ctttacctgggcctaagctttttcctagattcgatgcctccagatcagaa agctgtgttttttgatgaggaactgttattaaaaggccagagcactagag ctgagcacctcctggactagacgatgacagcataaagaattggcttctct taggatgctacctatgttcaccagtccaacacattaagggacgcttaccc acaccttcgattaccaaatttatttgtttactccaatctcgaacacagtc caag	gaattccaagacagccagagctccatagtgagaccctgtctcaaacaatc agtgtgtccctccaacccccacctcccaacaaaacaaatcccaaaaccag ccgagctgtggtggcacatacttttaatcccagaatttgggagccaaggc aggtggatctctataagttggagccagccttgtctatggagttccagaac atttagggctacacagagaaaccctgttttgcaaacgaaaccaaaccaaa ccaaaacataaccaaaaccaaacagcagagagatgcctgcctgtaatttt agcacttgggagggacaggcaggagaatcaggagttctaggtcatcctta gctacaagtgaggccagcctgagctacatgagcctgtatttaaaaaaaaa aaaaaaaaaaaactccagtggtgtggggtgaggccttcctgttgggtgac gcgcagtccacctggatgttcttgcctgccacatcggctctcctaggtga aggtgacaacaactgagtctgtgactgactactacacccttcctatcggg attcgaacagtggctgtcacaaagagcaagttcctcataaacgggaagcc cttctatttccaaggggtcaataagcacgaggattcagatgtgagtagga gctgtggcatcaatgtgtggcatgttgggagtcattgatatctccttccc ctacctctgtgccctgggaagatagcatcgtgtggtgctgtttgtggtga acctacatagggtggacggggtgagtccaggggcggggcttttagaagaa agtgcgaactctccagtcacaagggtagaggtcacgcagccctgctgtcc tcctagatccgagggaaggcttcgactggccgctgctggttaaaggattt caacctgctccgttggctcggggcaaatttccttcgtaccagccactatc ccttactcagaggaggtactcagcttttgtgaccgatacgggatgtggtc atcgatgagtgtcccggtgtgggcatgtggctacggtgagtgcccgcccc tcgcagctctacgatgc
quality values	Open. Hide. 58 33 18 28 58 28 19 54 58 58 58 58 58 52 58 38 42 33 31 62 62 62 62 62 49 62 62 62 62 54 39 51 56 56 37 21 21 38 38 44 44 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 59 62 59 62 59 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 59 54 33 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 56 62 51 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 56 62 62 62 47 47 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 44 62 62 62 62 62 58 54 58 54 42 54 54 58 58 45 49 54 52 54 47 52 54 58 54 58 52 52 42 45 58 54 42 58 58 32 58 58 58 38 52 58 54 54 58 58 41 45 52 51 58 58 52 58 58 52 39 54 54 52 58 58 58 54 54 54 50 54 54 52 58 54 53 52 54 49 53 58 49 46 58 58 51 25 51 49 58 58 46 20 58 46 46 30 58 47 40 51 37 34 37 50 34 49 51 58 41 51 32 49 28 32 48 50 52 54 58 58 47 29 39 53 50 46 53 47 41 58 51 52 40 41 29 38 51 29 29 35 58 58 46 58 40 52 50 50 39 35 41 29 47 52 52 35 50 52 39 39 26 50 40 40 50 29 53 37 35 31 41 47 49 39 39 53 50 40 33 42 50 52 47 28 16 18 11 40 49 22 23 32 7 49 32 53 52 42 37 30 29 54 51 35 53 34 49 33 35 42 39 42 53 42 38 46 34 52 46 30 42 33 54 39 41 28 21 42 32 51 33 39 39 26 37 53 53 17 54 37 53 28 38 37 27 26 39 31 39 49 37 45 32 52 40 32 31 21 33 26 52 42 30 53 33 10 44 39 37 41 31 52 32 32 40 41 33 35 25 34 39 39 13 32 18 29 28 27 34 52 33 52 31 31 36 34 28 32 39 33 26 32 10 51 21 31 25 31 30 33 33 45 29 16 25 33 30 51 34 29 34 36 27 23 31 28 36 35 30 33 22 21 34 38 25 13 35 32 33 38 32 36 31 32 14 12 37 29 27 42 10 12 46 46 46 47 44 32 31 31 31 19 18 31 38 33 34 35 31 31 35 37 30 26 32 29 39 31 34 31 31 38 27 38 41 24 37 21 27 31 46 48 33 22 26 27 34 43 14 25 38 27 22 21 11 46 37 32 32 31 33 42 48 31 18 30 24 17 26 18 33 22 48 38 48 19 21 42 24 31 10 5 6 21 31 10 34 27 32 23 18 18 11 31 13 19 31 31 27 31 9 19 43 25 18 32 24 17 7 19 16 48 31 43 39 17 11 17 27 24 20 14 14 23 30 32 24 29 13 28 28 11 29 23 31 34 24 13 17 13 22 14 12 30 10 27 18 24 30 8 9 7 3 4 20 20 28 11 28 16 24 25 9 6 6 7 12 15 16 24 27 24 20 13 10 13 25 7 11 8 5 9 15 12 10 6 3 3 7 13 20 28 11 12 28 14 19 27 14 15 7 26 27 5 4 7 8 17 14 19 18 8 7 13 7 14 10 7 11 12 22 6 4 10 13 6 7 3 6 5 6 7 11 4 6 6 7 12 12 13 13 28 11 6 12 8 21 9 13 9 24 18 10 5 10 5 10 6 7 4 4 4 3 3 4 11 7 15 4 21 5 17 27 6 3 3 17 13 4 22 24 16 6 7 5 4 9 10 6 4 5 4 13 5 18 7 5 4 6 6 7 11 4 6 5 1 3	Open. Hide. 62 47 35 41 62 62 37 26 54 62 41 46 39 38 56 42 29 20 28 21 50 62 62 54 44 62 62 62 62 62 54 62 59 59 62 62 62 59 59 62 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 46 56 56 62 47 42 38 36 46 56 56 62 56 62 62 56 56 41 38 39 43 62 43 62 62 52 52 52 52 52 47 62 62 47 43 47 52 54 50 42 52 46 52 48 31 54 62 46 52 41 52 52 49 47 38 42 52 52 52 52 52 52 52 48 52 52 58 54 54 46 50 47 54 54 47 38 40 53 52 54 52 54 47 54 37 58 52 54 58 54 48 41 40 54 54 37 52 54 49 42 54 54 54 52 45 19 48 52 54 54 52 49 42 39 54 54 43 48 54 51 49 41 48 52 50 54 58 54 58 46 50 50 49 53 51 50 50 49 54 42 36 49 51 25 58 47 50 49 52 40 49 41 37 49 58 50 40 46 50 46 58 44 24 58 50 46 58 58 35 58 46 53 46 52 52 50 52 46 58 48 42 49 58 46 58 53 40 49 58 43 52 53 50 49 32 41 58 39 47 32 27 50 46 58 41 58 50 39 32 50 50 52 53 41 39 32 37 23 44 39 41 39 29 50 52 52 22 53 35 42 40 52 53 33 53 45 32 46 54 26 45 45 53 32 50 44 35 26 40 45 23 49 32 52 42 34 32 54 54 31 29 31 53 26 41 51 44 34 41 32 25 36 30 21 47 40 37 23 40 39 36 45 53 52 31 52 42 54 54 51 37 34 53 52 38 40 30 53 42 33 41 51 35 32 42 52 30 27 32 20 42 21 53 31 32 35 35 53 29 37 40 18 33 33 25 45 31 35 40 26 51 34 47 29 53 39 27 29 34 34 32 37 31 34 34 19 36 31 31 51 38 22 39 29 22 16 26 51 51 33 23 31 41 26 36 34 31 31 34 51 51 37 30 27 51 51 33 14 28 38 31 28 32 21 31 31 11 33 42 32 24 31 29 24 13 31 25 24 27 28 33 33 36 28 30 34 32 23 16 5 13 23 46 20 29 36 13 37 31 31 30 31 21 32 29 31 23 21 41 41 31 31 31 31 31 27 18 15 8 13 18 32 27 36 14 32 33 24 25 6 38 19 39 21 46 17 6 13 18 27 30 34 13 32 22 21 31 22 14 31 17 34 38 18 22 22 10 36 8 7 35 44 26 13 23 27 22 44 30 15 8 37 12 25 33 28 27 38 18 29 33 31 14 19 30 23 31 27 23 32 33 30 9 11 24 21 24 32 10 6 6 34 29 17 18 21 31 8 33 21 14 30 21 18 32 18 17 32 12 32 27 7 9 31 18 17 24 11 8 20 9 33 19 9 32 10 16 12 27 9 13 16 20 15 6 5 7 20 10 11 28 16 16 10 29 6 5 11 15 28 6 26 30 12 5 13 26 13 17 16 27 18 11 29 24 12 32 8 5 16 6 15 47 17 13 12 18 27 9 9 30 25 21 20 18 3 3 6 17 27 24 7 16 5 9 14 5 4 4 14 10 11 27 23 5 17 17 13 6 12 11 12 15 4 4 4 5 4 7 23 7 5 18 9 6 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_130355928_130357081
seq2: B6Ng01-233M14.b_42_1195

seq1  GAATTCACTCTGTAGACCAGGGTGGCCTTGAACTCAGAAATTTGCCTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTGTAGACCAGGGTGGCCTTGAACTCAGAAATTTGCCTGCC  50

seq1  TCCTCTGCCTCCCAAGTGCTGGGATTAAACTCGTGTGCTACCATTGCCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTGCCTCCCAAGTGCTGGGATTAAACTCGTGTGCTACCATTGCCCA  100

seq1  GTGAAGACAAGACTCTTATTACACAACTCTGACGACCCAGAAACCGTGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAGACAAGACTCTTATTACACAACTCTGACGACCCAGAAACCGTGCA  150

seq1  GACCAAGAGGCCTCCACACTTGCACTCCTGCTTCTGCTTGTGTGTTGGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAAGAGGCCTCCACACTTGCACTCCTGCTTCTGCTTGTGTGTTGGCA  200

seq1  CTATAGGGTGCAACACCAAGCATGACTTTTTTTTTTTAAGTTTTTTATTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAGGGTGCAACACCAAGCATGACTTTTTTTTTTTAAGTTTTTTATTT  250

seq1  TATGTATGTGAGTACACTGTAGCTGTCTTTAGACATACCAGAGGAGGGCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTATGTGAGTACACTGTAGCTGTCTTTAGACATACCAGAGGAGGGCA  300

seq1  TCGGATGCCATTACAGATGGTTTGTGAGCCACCATGTAGTTGCTGGGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGATGCCATTACAGATGGTTTGTGAGCCACCATGTAGTTGCTGGGAAT  350

seq1  TGAACTCCATGTTTTTGTTGTTGATGTTTGGCTGGTTTTTGTGTGGGACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTCCATGTTTTTGTTGTTGATGTTTGGCTGGTTTTTGTGTGGGACA  400

seq1  GGGTTCTCTGTGTAGCCCCAGCTGTCCTGGAGCTCACCCTGTAGACCCGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCTCTGTGTAGCCCCAGCTGTCCTGGAGCTCACCCTGTAGACCCGG  450

seq1  CCAGCCTCAGACTCTCAGGGATCCACCGGCTGTGATCCCAGAGCTGTGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCTCAGACTCTCAGGGATCCACCGGCTGTGATCCCAGAGCTGTGAT  500

seq1  TAAGTGTGCACTACCACGCCTGGCTACAGGATGGTTTTTAACTGGGTATG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTGTGCACTACCACGCCTGGCTACAGGATGGTTTTTAACTGGGTATG  550

seq1  GTGGCACAAGCCTCTAATCCCAGCACTTGGGAGGCTGAGGCAGGATAGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCACAAGCCTCTAATCCCAGCACTTGGGAGGCTGAGGCAGGATAGGC  600

seq1  CATTTACACAGATCTGGACTATATAGGGAGACCCAACGGCTTGCGTACGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTACACAGATCTGGACTATATAGGGAGACCCAACGGCTTGCGTACGC  650

seq1  TGCCTCCATGCAGACACGCAGTGTCACGTGGCCATCGGAGGTCTCAGTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTCCATGCAGACACGCAGTGTCACGTGGCCATCGGAGGTCTCAGTAA  700

seq1  TGTCTACCTGCTTACCACTTACTTAGCTACTTGGTTTGTTGGCATGGCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTACCTGCTTACCACTTACTTAGCTACTTGGTTTGTTGGCATGGCTG  750

seq1  AAGACAGGACTCAAGCCTGGTGAATACTAGACAAGCCTGCTGCAGCTGAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGGACTCAAGCCTGGTGAATACTAGACAAGCCTGCTGCAGCTGAG  800

seq1  TATCACACCAGCTCCCTGACACATCACAATTAGCATGTGATCAAAGTTAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCACACCAGCTCCCTGACACATCACAATTAGCATGTGATCAAAGTTAA  850

seq1  AAAATATATATATATATATCTCTGTCTCCTGGGATTAAAAGCATGTACCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATATATATATATATATCTCTGTCTCCTGGGATTAAAAGCATGTACCA  900

seq1  CTTTACCTGGGCCTAAGC-TTTTCCTAGATTCGATGCCTCCAGATCAGAA  949
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  CTTTACCTGGGCCTAAGCTTTTTCCTAGATTCGATGCCTCCAGATCAGAA  950

seq1  AGCTGTG-TTTTTGATGAGGAACTG-TATTAAAAGGCCAGAGCACTAGGA  997
      ||||||| ||||||||||||||||| ||||||||||||||||||||||  
seq2  AGCTGTGTTTTTTGATGAGGAACTGTTATTAAAAGGCCAGAGCACTAG--  998

seq1  AGGCTGAGCACCT-CTGGACTAGACGAATGACAGGCATAGAGAA-TGGCT  1045
        ||||||||||| |||||||||||| |||||| ||||| |||| |||||
seq2  -AGCTGAGCACCTCCTGGACTAGACG-ATGACA-GCATAAAGAATTGGCT  1045

seq1  TCTCTTAGGATGCTA-CTATGTTCACCAGGCACACACAATAA-GGACGCT  1093
      ||||||||||||||| ||||||||||||| |  ||||| ||| |||||||
seq2  TCTCTTAGGATGCTACCTATGTTCACCAGTCCAACACATTAAGGGACGCT  1095

seq1  ACCACACACTTCAGAATAACCAATTTATTTTTTTTAACTCACAATCAC-A  1142
        | ||||| |  || || | ||||||||| |||  |||| ||||| | |
seq2  TACCCACACCTTCGATTACCAAATTTATTTGTTT--ACTC-CAATCTCGA  1142

seq1  ACACAGTCCAAG  1154
      ||||||||||||
seq2  ACACAGTCCAAG  1154

seq1: chr5_130473855_130474919
seq2: B6Ng01-233M14.g_65_1131 (reverse)

seq1  GCATCGTAGA-CGGCGAGGGGGCGGGCACTCACGGTAGCACAATGCCCAC  49
      |||||||||| | |||| ||||||||||||||| |||||   ||||||||
seq2  GCATCGTAGAGCTGCGA-GGGGCGGGCACTCACCGTAGCCACATGCCCAC  49

seq1  ACCGGGACACTCATCGATGACCACAATCCCGTATCGGTCAC-AGAGCTGA  98
      |||||||||||||||||||||||| |||||||||||||||| | ||||| 
seq2  ACCGGGACACTCATCGATGACCAC-ATCCCGTATCGGTCACAAAAGCTG-  97

seq1  AGTACCTCCTCTGAGT-AGGGATAGTGGCTGGTACGAAAGGAATTTGCCC  147
      |||||||||||||||| ||||||||||||||||||||| | |||||||||
seq2  AGTACCTCCTCTGAGTAAGGGATAGTGGCTGGTACGAAGGAAATTTGCCC  147

seq1  CGAGCCAACGGAGCAGGTTGAAATCCTTT-ACCAGCAGCGGCCAGTCGAA  196
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  CGAGCCAACGGAGCAGGTTGAAATCCTTTAACCAGCAGCGGCCAGTCGAA  197

seq1  GCCTTTCCCTCGGATCTAGGA-GACAGCAGGGCTGCGTGACCTCTACCCT  245
      ||| ||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GCC-TTCCCTCGGATCTAGGAGGACAGCAGGGCTGCGTGACCTCTACCCT  246

seq1  TGTGACTGGAGAGTTCGCACTTTCTTCT-AAAGCCCCGCCCCTGGACTCA  294
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  TGTGACTGGAGAGTTCGCACTTTCTTCTAAAAGCCCCGCCCCTGGACTCA  296

seq1  CCCCGTCCACCCTATGTAGGTTCACCACAAACAGCACCACACGATGCTAT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCGTCCACCCTATGTAGGTTCACCACAAACAGCACCACACGATGCTAT  346

seq1  CTTCCCAGGGCACAGAGGTAGGGGAAGGAGATATCAATGACTCCCAACAT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCAGGGCACAGAGGTAGGGGAAGGAGATATCAATGACTCCCAACAT  396

seq1  GCCACACATTGATGCCACAGCTCCTACTCACATCTGAATCCTCGTGCTTA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACACATTGATGCCACAGCTCCTACTCACATCTGAATCCTCGTGCTTA  446

seq1  TTGACCCCTTGGAAATAGAAGGGCTTCCCGTTTATGAGGAACTTGCTCTT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACCCCTTGGAAATAGAAGGGCTTCCCGTTTATGAGGAACTTGCTCTT  496

seq1  TGTGACAGCCACTGTTCGAATCCCGATAGGAAGGGTGTAGTAGTCAGTCA  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACAGCCACTGTTCGAATCCCGATAGGAAGGGTGTAGTAGTCAGTCA  546

seq1  CAGACTCAGTTGTTGTCACCTTCACCTAGGAGAGCCGATGTGGCAGGCAA  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTCAGTTGTTGTCACCTTCACCTAGGAGAGCCGATGTGGCAGGCAA  596

seq1  GAACATCCAGGTGGACTGCGCGTCACCCAACAGGAAGGCCTCACCCCACA  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACATCCAGGTGGACTGCGCGTCACCCAACAGGAAGGCCTCACCCCACA  646

seq1  CCACTGGAGTTTTTTTTTTTTTTTTTTTTTAAATACAGGCTCATGTAGCT  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGGAGTTTTTTTTTTTTTTTTTTTTTAAATACAGGCTCATGTAGCT  696

seq1  CAGGCTGGCCTCACTTGTAGCTAAGGATGACCTAGAACTCCTGATTCTCC  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTGGCCTCACTTGTAGCTAAGGATGACCTAGAACTCCTGATTCTCC  746

seq1  TGCCTGTCCCTCCCAAGTGCTAAAATTACAGGCAGGCATCTCTCTGCTGT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTGTCCCTCCCAAGTGCTAAAATTACAGGCAGGCATCTCTCTGCTGT  796

seq1  TTGGTTTTGGTTATGTTTTGGTTTGGTTTGGTTTCGTTTGCAAAACAGGG  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTTTGGTTATGTTTTGGTTTGGTTTGGTTTCGTTTGCAAAACAGGG  846

seq1  TTTCTCTGTGTAGCCCTAAATGTTCTGGAACTCCATAGACAAGGCTGGCT  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTCTGTGTAGCCCTAAATGTTCTGGAACTCCATAGACAAGGCTGGCT  896

seq1  CCAACTTATAGAGATCCACCTGCCTTGGCTCCCAAATTCTGGGATTAAAA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACTTATAGAGATCCACCTGCCTTGGCTCCCAAATTCTGGGATTAAAA  946

seq1  GTATGTGCCACCACAGCTCGGCTGGTTTTGGGATTTGTTTTGTTGGGAGG  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTGCCACCACAGCTCGGCTGGTTTTGGGATTTGTTTTGTTGGGAGG  996

seq1  TGGGGGTTGGAGGGACACACTGATTGTTTGAGACAGGGTCTCACTATGGA  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGTTGGAGGGACACACTGATTGTTTGAGACAGGGTCTCACTATGGA  1046

seq1  GCTCTGGCTGTCTTGGAATTC  1065
      |||||||||||||||||||||
seq2  GCTCTGGCTGTCTTGGAATTC  1067

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information