MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-234B24
Chromosome	5 (Build37)
Map Location	36,218,713 - 36,368,103
singlet/doublet	doublet
Overlap gene	Ablim2, Afap1, LOC100040209, Sorcs2
Upstream gene	Hdh, A930005I04Rik, Rgs12, Hgfac, Dok7, Lrpap1, Adra2c, Hmx1, Cpz, Plk-ps1, 2310079F23Rik, Acox3, Htra3, Sh3tc1
Downstream gene	2310020A21Rik, Grpel1, Ccdc96, Tbc1d14, D5Ertd579e, LOC100040278, LOC100040825, Cno, Mrfap1, Man2b2, Ppp2r2c, Wfs1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Hdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15194 MGI:96067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930005I04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403174 MGI:2684990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71729 MGI:1918979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgfac (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54426 MGI:1859281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231134 MGI:3584043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrpap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16976 MGI:96829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11553 MGI:87936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15371 MGI:107178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242939 MGI:88487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plk-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18818 MGI:103247
definition	note : polo-like kinase, pseudogene 1 pseudo : _no_value

name	2310079F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78890 MGI:1926140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80911 MGI:1933156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sh3tc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231147 MGI:2678949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ablim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231148 MGI:2385758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70292 MGI:1917542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	Sorcs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310020A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grpel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66717 MGI:1913967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100855 MGI:1098708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D5Ertd579e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	LOC100040825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Cno (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrfap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67568 MGI:1914818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17160 MGI:1195262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269643 MGI:2442660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45439303 GeneID:15194 MGI:96067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Huntington disease gene homolog transcript_id : NM_010414.1

name	A930005I04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402310 GeneID:403174 MGI:2684990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930005I04 gene transcript_id : NM_207277.1

name	Rgs12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27777688 GeneID:71729 MGI:1918979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 12 transcript_id : NM_173402.1

name	Hgfac (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506778 GeneID:54426 MGI:1859281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatocyte growth factor activator transcript_id : NM_019447.1

name	Dok7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802689 GeneID:231134 MGI:3584043
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 7 transcript_id : NM_172708.2

name	Lrpap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63999379 GeneID:16976 MGI:96829
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low density lipoprotein receptor-related protein associated protein 1 transcript_id : NM_013587.2

name	Adra2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024218 GeneID:11553 MGI:87936
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 2c transcript_id : NM_007418.2

name	Hmx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129994 GeneID:15371 MGI:107178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H6 homeo box 1 transcript_id : NM_010445.2

name	Cpz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407065 GeneID:242939 MGI:88487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase Z transcript_id : NM_153107.2

name	2310079F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801895 GeneID:78890 MGI:1926140
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310079F23 gene transcript_id : NM_030208.2

name	Acox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328333 GeneID:80911 MGI:1933156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase 3, pristanoyl transcript_id : NM_030721.2

name	Htra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815868 GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 3 transcript_id : NM_030127.2

name	Htra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815866 GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 3 transcript_id : NM_001042615.1

name	Sh3tc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996510 GeneID:231147 MGI:2678949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 domain and tetratricopeptide repeats 1 transcript_id : NM_194344.1

name	Ablim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353512 GeneID:231148 MGI:2385758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-binding LIM protein 2 transcript_id : NM_177678.5

name	Afap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78486554 GeneID:70292 MGI:1917542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin filament associated protein 1 transcript_id : NM_027373.2

name	Sorcs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301216 GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sortilin-related VPS10 domain containing receptor 2 transcript_id : NM_030889.2

name	2310020A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301213 GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310020A21 gene transcript_id : NM_175249.3

name	Grpel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542920 GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GrpE-like 1, mitochondrial transcript_id : NM_024478.2

name	Ccdc96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541960 GeneID:66717 MGI:1913967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 96 transcript_id : NM_025725.2

name	Tbc1d14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559984 GeneID:100855 MGI:1098708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 14 transcript_id : NM_133910.2

name	D5Ertd579e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486994 GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 579, expressed transcript_id : NM_001081232.1

name	LOC100040278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253859 GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hypothetical protein LOC100040278 transcript_id : XM_001474408.1

name	LOC100040825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253872 GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to D5Ertd579e protein transcript_id : XM_001476163.1

name	Cno (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988412 GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cappuccino transcript_id : NM_133724.3

name	Mrfap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375273 GeneID:67568 MGI:1914818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Morf4 family associated protein 1 transcript_id : NM_026242.2

name	Man2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678791 GeneID:17160 MGI:1195262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B2 transcript_id : NM_008550.1

name	Ppp2r2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475972 GeneID:269643 MGI:2442660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform transcript_id : NM_172994.2

name	Wfs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672922 GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolfram syndrome 1 homolog (human) transcript_id : NM_011716.2

name	Hdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45439304 CCDS:CCDS19220.1 GeneID:15194 MGI:96067
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016234 - inclusion body [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0048341 - paraxial mesoderm formation [Evidence IMP]; GO:0047496 - vesicle transport along microtubule [Evidence IDA] codon_start : 1 product : huntingtin protein_id : NP_034544.1

name	A930005I04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402311 CCDS:CCDS19221.1 GeneID:403174 MGI:2684990
definition	codon_start : 1 product : hypothetical protein LOC403174 protein_id : NP_997160.1

name	Rgs12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777689 CCDS:CCDS19222.1 GeneID:71729 MGI:1918979
definition	codon_start : 1 exception : mismatches in translation product : regulator of G-protein signalling 12 protein_id : NP_775578.1

name	Hgfac (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506779 CCDS:CCDS19223.1 GeneID:54426 MGI:1859281
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hepatocyte growth factor activator protein_id : NP_062320.1

name	Dok7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370024 CCDS:CCDS19224.1 GeneID:231134 MGI:3584043
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0031594 - neuromuscular junction [Evidence IDA]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007528 - neuromuscular junction development [Evidence IGI] [Evidence IDA]; GO:0001934 - positive regulation of protein amino acid phosphorylation [Evidence IMP]; GO:0043113 - receptor clustering [Evidence IGI] [Evidence IDA] codon_start : 1 product : downstream of tyrosine kinase 7 protein_id : NP_766296.1

name	Lrpap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63999380 CCDS:CCDS19225.1 GeneID:16976 MGI:96829
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008201 - heparin binding [Evidence IEA]; GO:0050750 - low-density lipoprotein receptor binding [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : low density lipoprotein receptor related protein, associated protein 1 product : low density lipoprotein receptor-related protein associated protein 1 protein_id : NP_038615.2

name	Adra2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680664 CCDS:CCDS19226.1 GeneID:11553 MGI:87936
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004935 - adrenoceptor activity [Evidence IEA]; GO:0004938 - alpha2-adrenergic receptor activity [Evidence IEA] [Evidence TAS]; GO:0004930 - G-protein coupled receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : subtype alpha2-C4 product : adrenergic receptor, alpha 2c protein_id : NP_031444.1

name	Hmx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754218 CCDS:CCDS19228.1 GeneID:15371 MGI:107178
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : H6 homeo box 1 protein_id : NP_034575.1

name	Cpz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407066 CCDS:CCDS19229.1 GeneID:242939 MGI:88487
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0004181 - metallocarboxypeptidase activity [Evidence TAS] GO_process : GO:0016485 - protein processing [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : carboxypeptidase Z protein_id : NP_694747.2

name	2310079F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313518 CCDS:CCDS19230.1 GeneID:78890 MGI:1926140
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC78890 protein_id : NP_084484.1

name	Acox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328334 CCDS:CCDS19232.1 GeneID:80911 MGI:1933156
definition	GO_component : GO:0005782 - peroxisomal matrix [Evidence TAS]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016402 - pristanoyl-CoA oxidase activity [Evidence TAS] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : pristanoyl-CoA oxidase product : acyl-Coenzyme A oxidase 3, pristanoyl protein_id : NP_109646.2

name	Htra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815869 CCDS:CCDS19233.1 GeneID:78558 MGI:1925808
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : isoform a precursor is encoded by transcript variant 1; toll-associated serine protease; pregnancy-related serine protease product : HtrA serine peptidase 3 isoform a precursor protein_id : NP_084403.2

name	Htra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815867 GeneID:78558 MGI:1925808
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : isoform b precursor is encoded by transcript variant 2; toll-associated serine protease; pregnancy-related serine protease product : HtrA serine peptidase 3 isoform b precursor protein_id : NP_001036080.1

name	Sh3tc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996511 CCDS:CCDS19234.1 GeneID:231147 MGI:2678949
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : SH3 domain and tetratricopeptide repeats 1 protein_id : NP_919325.1

name	Ablim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66773171 CCDS:CCDS19235.1 GeneID:231148 MGI:2385758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : actin-binding LIM protein 2 protein_id : NP_808346.3

name	Afap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859696 CCDS:CCDS19236.1 GeneID:70292 MGI:1917542
definition	GO_process : GO:0009966 - regulation of signal transduction [Evidence ISS] codon_start : 1 note : actin filament associated protein product : actin filament associated protein 1 protein_id : NP_081649.1

name	Sorcs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301217 CCDS:CCDS19237.1 GeneID:81840 MGI:1932289
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : VPS10 domain receptor protein product : VPS10 domain receptor protein SORCS 2 protein_id : NP_112151.2

name	2310020A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301214 GeneID:76943 MGI:1924193
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76943 protein_id : NP_780458.2

name	Grpel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277394 CCDS:CCDS19238.1 GeneID:17713 MGI:1334417
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0000774 - adenyl-nucleotide exchange factor activity [Evidence IEA]; GO:0051087 - chaperone binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : GrpE-like 1, mitochondrial protein_id : NP_077798.1

name	Ccdc96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385186 CCDS:CCDS19239.1 GeneID:66717 MGI:1913967
definition	codon_start : 1 product : coiled-coil domain containing 96 protein_id : NP_080001.1

name	Tbc1d14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559985 CCDS:CCDS19240.1 GeneID:100855 MGI:1098708
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 14 protein_id : NP_598671.2

name	D5Ertd579e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486995 GeneID:320661 MGI:1261849
definition	codon_start : 1 product : hypothetical protein LOC320661 protein_id : NP_001074701.1

name	LOC100040825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253873 GeneID:100040825
definition	codon_start : 1 product : similar to D5Ertd579e protein protein_id : XP_001476213.1

name	LOC100040278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253860 GeneID:100040278
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474458.1

name	Cno (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526908 CCDS:CCDS19241.1 GeneID:117197 MGI:1929230
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : cappuccino protein_id : NP_598485.1

name	Mrfap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385746 CCDS:CCDS19242.1 GeneID:67568 MGI:1914818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : protein associated with MRG, 14 kDa protein_id : NP_080518.1

name	Man2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678792 CCDS:CCDS19243.1 GeneID:17160 MGI:1195262
definition	GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 135 kD alpha-D-mannosidase; 135 kDa alpha-D-mannosidase product : mannosidase alpha class 2B member 2 protein_id : NP_032576.1

name	Ppp2r2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370502 CCDS:CCDS19244.1 GeneID:269643 MGI:2442660
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform protein_id : NP_766582.1

name	Wfs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755997 CCDS:CCDS19245.1 GeneID:22393 MGI:1328355
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Wolfram syndrome 1 protein homolog protein_id : NP_035846.1

name	LOC100040209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040209
definition	number : 1 pseudo : _no_value

name	LOC100040209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040209
definition	number : 2 pseudo : _no_value

clone name	MSMg01-486I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-443A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-234B24.b	B6Ng01-234B24.g
ACC	GA045974	GA045975
length	770	1,132
definition	B6Ng01-234B24.b	B6Ng01-234B24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(36,218,713 - 36,219,481)	(36,366,975 - 36,368,103)
sequence	gaattcacatgactgaagggtcccttcaggtatgtctggatcaaggacta agcagtatttcacaaacccagtggctgagtttcctctatactggctctag ggagacaccttctcctgtcctgagctcaaggtttttgggggagaaaacca tctctcttgtctgcctttgtacaacccacagtgagcctctgggtagtcat tacccaacccctacctctaaaccaaccagttctacccagggcaatcaatg ttctgagcagccggctttaccaggaggtaagtcggctgctggcactgcct gagctagagagacccaggtcgttcctggaagaaactgagacctgccacct gagatggcaagagaactgctaggcaatgggcaggtggcaagtgtccacct agggaggggcagggaggggacagtacagcagagcaaagcccagcaagatc acaaacaagtagttactcagtgcagccagtccacatggcacgtatcggtg gcaccagctgaagatccacatagccaaagctatgatgcttgaaggatgtt agcagaatgcttggagctcactgcaaacgaggaaaggccagtggagcatt cttgtgtgtttcgatgtgtgtatcatttgcgggaagggccagaagctgga ctctctcagaagctgtgagactggcaggtggggggtggggggctggaggc cactcagagttaaggactctacctgtagtctaaagagtctgggccccaga gtccctttgcctgagtgtca	gaattctagcacgtcctccatgaggctccttgaccaggagcaccttggga actgtcgtcagagaggtccccagatgctgagtgctgagtagcctgtggga caatggtagcttgctaggcactaggctgactgcctggtgttagtgtgtag gaatatgttcagtgtgagcccataacaagtgtccagatggaggcaaagcc ttctctcctccaaatgctggaattctgtgcctggcatagcttctggctct gccccagtggatgtagctaaagtcggaatcccagagacatagccacatgg aaatgagtgtcagagggcctcataatgggccctggacagtgactgatagg tggtaagatacagatggtgacgggctctgatgtgtgtcatgagcctcacc tactggccatgttatggggaatcttttgaggagggcattgtgcttgccac ccccacccccaactcccctcataggtaggatgccctgccctgtctcatct ttgtgagctcccacttcctagaagcttcactgaccagggtgggggacttg tggagcactccaggtcttccagctgacacactgagactcttctctctgtt ctgcgctggaatgagagcttgctgatggcagggcttccggcaccatcagt ggctcctagtgaacctggctggtgggctttcatgccattccctgataagg acactgagcatcagccagcatcccttcccagccccgagggactccagtgg tccaggcctcagagctttcctgcctcctttgctttcagagactggcagcc gtgcagcaggcgctgaactctcatagaatcagcttcatccttcgaggagg gcttcgtatcctggtggagctgagggacacagacacaggtgacagactcg ggcttagctcctccctggagcagggtgggcatgggcccaggcctgcggat gctaaagtgactgtaggatttgaatgggcttttatctagctgccagtgac ccttctggctgggacatctctggctagatgcacccaccctgcacagccag ctctggtcctcacaatcctggctggatctgtggtgagcagcctccacatc atcaggaaacctgccgtgaattccattcaaaa
quality values	Open. Hide. 62 41 38 31 62 37 15 47 39 62 62 47 62 62 62 47 62 62 62 59 59 62 62 62 62 62 59 44 59 62 51 51 54 38 38 56 54 49 54 59 54 54 46 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 54 62 59 59 62 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 42 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 54 47 54 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 54 52 62 62 52 62 62 62 62 62 62 54 47 62 62 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 48 58 45 41 58 58 58 58 58 58 58 52 58 58 45 58 58 58 58 58 58 58 47 58 58 54 54 54 58 58 58 54 58 58 58 58 58 42 58 54 58 58 42 54 33 58 49 51 50 58 58 41 40 58 51 51 58 54 54 58 58 58 58 50 58 51 58 51 47 58 49 49 58 58 58 54 58 53 51 53 50 51 58 58 58 58 50 58 58 58 58 51 41 58 51 39 58 43 48 58 51 37 54 58 50 58 37 37 51 53 58 53 58 50 50 31 58 58 32 54 58 58 51 46 49 36 44 40 54 58 58 50 47 33 58 52 58 36 38 58 58 58 42 53 58 49 49 58 58 39 51 33 30 28 9 35 13 17 11 13 25 19 9 5 38 34 23 29 25 13 9 21 16 12 11 9 9 11 23 13 19 18 25 18 15 10 12 9 6 9 11 13 13 10 13 20 18 17 6 10 14 16 16 14 9 9 7 12 9 9 15 6 16 31 9 25 10 14 14 11 9 9 21 16 24 15 9	Open. Hide. 62 47 39 47 62 62 62 49 62 44 35 51 38 32 41 32 46 56 44 44 62 35 59 59 62 62 62 62 62 62 62 59 59 59 59 59 62 62 59 59 62 59 59 62 62 62 59 62 62 59 62 59 62 62 59 62 56 38 62 56 59 62 54 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 46 46 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 52 58 58 58 54 58 58 58 52 58 58 52 58 58 58 58 54 58 58 58 54 45 45 48 54 58 58 31 58 58 58 58 58 45 33 58 58 58 58 58 58 58 46 58 48 42 58 58 51 51 47 58 58 58 58 58 49 49 41 49 58 58 58 58 50 46 51 54 58 58 49 45 41 58 50 58 53 58 58 49 51 52 58 53 58 58 58 51 53 53 58 52 53 58 54 58 58 58 58 41 58 58 47 51 46 51 51 51 58 48 58 54 51 39 58 58 46 49 53 58 51 48 58 52 50 58 41 58 52 42 47 49 39 54 51 52 49 39 46 51 40 44 42 46 40 51 41 50 53 41 38 29 43 50 54 44 50 38 58 58 38 58 58 51 42 53 54 51 45 39 47 51 39 39 31 51 52 29 33 28 40 38 32 31 38 42 18 54 39 39 45 41 51 49 39 25 51 35 42 42 53 35 54 34 33 37 53 45 45 37 33 44 46 40 30 54 33 32 34 44 51 44 25 17 41 35 54 53 31 18 29 21 46 34 31 24 37 51 25 31 33 28 32 46 28 33 41 31 35 26 46 28 32 53 52 51 31 36 36 41 18 36 34 28 33 32 52 47 31 32 32 52 33 28 31 23 51 31 37 26 31 32 29 30 31 22 32 37 31 33 41 31 31 32 45 42 25 30 21 20 32 37 28 44 34 28 42 32 41 30 29 37 37 18 32 32 31 27 21 25 36 46 22 27 28 36 31 43 33 35 31 30 30 18 43 42 19 47 31 21 27 25 34 17 18 27 31 31 32 30 31 39 24 31 32 31 13 29 32 31 38 10 47 32 34 23 22 27 21 17 27 24 14 28 21 14 27 26 32 31 20 27 27 31 14 6 44 8 38 19 19 18 24 29 17 33 33 14 15 14 22 44 23 27 24 33 17 15 31 25 26 43 12 16 31 36 31 17 19 27 20 43 30 33 36 19 9 17 17 18 14 29 32 22 8 13 19 21 26 20 32 21 43 39 18 23 27 31 28 27 29 20 16 17 12 29 17 48 26 18 15 19 13 28 43 28 13 20 32 34 9 16 28 21 26 28 16 29 16 15 12 18 9 7 7 9 16 14 28 13 3 7 19 17 19 25 11 20 10 30 8 3 4 16 13 9 14 11 7 8 9 11 8 11 14 27 17 27 16 13 6 34 13 10 7 20 12 8 21 18 10 6 17 6 14 9 11 7 6 8 6 17 21 24 7 20 8 16 7 4 18 4 6 22 9 5 10 21 16 8 6 5 7 12 7 7 19 10 9 5 6 4 2 3 2 13 6 10 13 4 3 3 1 4 4 2 2 9 9 15 16 13 25 24 8 24 5 6 16 6 7 6 5 5 7 8 8 8 16 10 8 9 6 17 8 13 12 4 14 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_36218713_36219481
seq2: B6Ng01-234B24.b_42_811

seq1  GAATTCACATGACTGAAGGGTCCCTTCAGGTATGTCTGGATCAAGGACTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACATGACTGAAGGGTCCCTTCAGGTATGTCTGGATCAAGGACTA  50

seq1  AGCAGTATTTCACAAACCCAGTGGCTGAGTTTCCTCTATACTGGCTCTAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGTATTTCACAAACCCAGTGGCTGAGTTTCCTCTATACTGGCTCTAG  100

seq1  GGAGACACCTTCTCCTGTCCTGAGCTCAAGGTTTTTGGGGGAGAAAACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGACACCTTCTCCTGTCCTGAGCTCAAGGTTTTTGGGGGAGAAAACCA  150

seq1  TCTCTCTTGTCTGCCTTTGTACAACCCACAGTGAGCCTCTGGGTAGTCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTTGTCTGCCTTTGTACAACCCACAGTGAGCCTCTGGGTAGTCAT  200

seq1  TACCCAACCCCTACCTCTAAACCAACCAGTTCTACCCAGGGCAATCAATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCAACCCCTACCTCTAAACCAACCAGTTCTACCCAGGGCAATCAATG  250

seq1  TTCTGAGCAGCCGGCTTTACCAGGAGGTAAGTCGGCTGCTGGCACTGCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGCAGCCGGCTTTACCAGGAGGTAAGTCGGCTGCTGGCACTGCCT  300

seq1  GAGCTAGAGAGACCCAGGTCGTTCCTGGAAGAAACTGAGACCTGCCACCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTAGAGAGACCCAGGTCGTTCCTGGAAGAAACTGAGACCTGCCACCT  350

seq1  GAGATGGCAAGAGAACTGCTAGGCAATGGGCAGGTGGCAAGTGTCCACCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATGGCAAGAGAACTGCTAGGCAATGGGCAGGTGGCAAGTGTCCACCT  400

seq1  AGGGAGGGGCAGGGAGGGGACAGTACAGCAGAGCAAAGCCCAGCAAGATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGGGCAGGGAGGGGACAGTACAGCAGAGCAAAGCCCAGCAAGATC  450

seq1  ACAAACAAGTAGTTACTCAGTGCAGCCAGTCCACATGGCACGTATCGGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAGTAGTTACTCAGTGCAGCCAGTCCACATGGCACGTATCGGTG  500

seq1  GCACCAGCTGAAGATCCACATAGCCAAAGCTATGATGCTTGAAGGATGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCAGCTGAAGATCCACATAGCCAAAGCTATGATGCTTGAAGGATGTT  550

seq1  AGCAGAATGCTTGGAGCTCACTGCAAACGAGGAAAGGCCAGTGGAGCATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGAATGCTTGGAGCTCACTGCAAACGAGGAAAGGCCAGTGGAGCATT  600

seq1  CTTGTGTGTTTCGATGTGTGTATCATTTGCGGGAAGGGCCAGAAGCTGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTGTGTTTCGATGTGTGTATCATTTGCGGGAAGGGCCAGAAGCTGGA  650

seq1  CTCTCTCAGAAGCTGTGAGACTGGCAGGTGGGGGGTGGGGGGCTGGAGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTCAGAAGCTGTGAGACTGGCAGGTGGGGGGTGGGGGGCTGGAGGC  700

seq1  CACTCAGAGTT-AGGACTCTACCTGTAGTCTAAAGAGCCTGGGCCCCAGG  749
      ||||||||||| ||||||||||||||||||||||||| |||||||||| |
seq2  CACTCAGAGTTAAGGACTCTACCTGTAGTCTAAAGAGTCTGGGCCCCA-G  749

seq1  AGT-CCTTTGCCTGAGTGTCA  769
      ||| |||||||||||||||||
seq2  AGTCCCTTTGCCTGAGTGTCA  770

seq1: chr5_36366975_36368103
seq2: B6Ng01-234B24.g_64_1195 (reverse)

seq1  TTTTGAAT-GAAT---CAGCAGG-TTCCTGATGGTTGTGGAAGCTGCTTC  45
      |||||||| ||||   | ||||| |||||||| | |||||| ||||| ||
seq2  TTTTGAATGGAATTCACGGCAGGTTTCCTGAT-GATGTGGAGGCTGC-TC  48

seq1  CACACAGATCAAGCCA-GATGGTGAGGCCCAGAGCTGGCTGTGCAGGGGT  94
        |||||||| ||||| ||| |||||| ||||||||||||||||| ||||
seq2  ACCACAGATCCAGCCAGGATTGTGAGGACCAGAGCTGGCTGTGCA-GGGT  97

seq1  GGGTGCATCTAGCCAGAGATGTCCCAGCCAGAAGGGTCACTGGCAGCTAG  144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGCATCTAGCCAGAGATGTCCCAGCCAGAAGGGTCACTGGCAGCTAG  147

seq1  ATAAAAGCCCATTCAAATCCTACAGTCACTTTTAGCATCCGCAGGCCTGG  194
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  ATAAAAGCCCATTCAAATCCTACAGTCAC-TTTAGCATCCGCAGGCCTGG  196

seq1  GCCCATGCCCACCCTGCTCCAGGGAGGAGCTAAG-CCGGGTCTGTCACCT  243
      |||||||||||||||||||||||||||||||||| ||| |||||||||||
seq2  GCCCATGCCCACCCTGCTCCAGGGAGGAGCTAAGCCCGAGTCTGTCACCT  246

seq1  GTGTCTGTGTCCCTCAGCTCCACCAGGATACGAAGCCCTCCTCGAAGGAT  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTGTGTCCCTCAGCTCCACCAGGATACGAAGCCCTCCTCGAAGGAT  296

seq1  GAAGCTGATTCTATGAGAGTTCAGCGCCTGCTGCACGGCTGCCAGTCTCT  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTGATTCTATGAGAGTTCAGCGCCTGCTGCACGGCTGCCAGTCTCT  346

seq1  GAAAGCAAAGGAGGCAGGAAAGCTCTGAGGCCTGGACCACTGGAGTCCCT  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGCAAAGGAGGCAGGAAAGCTCTGAGGCCTGGACCACTGGAGTCCCT  396

seq1  CGGGGCTGGGAAGGGATGCTGGCTGATGCTCAGTGTCCTTATCAGGGAAT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGCTGGGAAGGGATGCTGGCTGATGCTCAGTGTCCTTATCAGGGAAT  446

seq1  GGCATGAAAGCCCACCAGCCAGGTTCACTAGGAGCCACTGATGGTGCCGG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGAAAGCCCACCAGCCAGGTTCACTAGGAGCCACTGATGGTGCCGG  496

seq1  AAGCCCTGCCATCAGCAAGCTCTCATTCCAGCGCAGAACAGAGAGAAGAG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCCTGCCATCAGCAAGCTCTCATTCCAGCGCAGAACAGAGAGAAGAG  546

seq1  TCTCAGTGTGTCAGCTGGAAGACCTGGAGTGCTCCACAAGTCCCCCACCC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAGTGTGTCAGCTGGAAGACCTGGAGTGCTCCACAAGTCCCCCACCC  596

seq1  TGGTCAGTGAAGCTTCTAGGAAGTGGGAGCTCACAAAGATGAGACAGGGC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCAGTGAAGCTTCTAGGAAGTGGGAGCTCACAAAGATGAGACAGGGC  646

seq1  AGGGCATCCTACCTATGAGGGGAGTTGGGGGTGGGGGTGGCAAGCACAAT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCATCCTACCTATGAGGGGAGTTGGGGGTGGGGGTGGCAAGCACAAT  696

seq1  GCCCTCCTCAAAAGATTCCCCATAACATGGCCAGTAGGTGAGGCTCATGA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTCCTCAAAAGATTCCCCATAACATGGCCAGTAGGTGAGGCTCATGA  746

seq1  CACACATCAGAGCCCGTCACCATCTGTATCTTACCACCTATCAGTCACTG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACATCAGAGCCCGTCACCATCTGTATCTTACCACCTATCAGTCACTG  796

seq1  TCCAGGGCCCATTATGAGGCCCTCTGACACTCATTTCCATGTGGCTATGT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGGCCCATTATGAGGCCCTCTGACACTCATTTCCATGTGGCTATGT  846

seq1  CTCTGGGATTCCGACTTTAGCTACATCCACTGGGGCAGAGCCAGAAGCTA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGGATTCCGACTTTAGCTACATCCACTGGGGCAGAGCCAGAAGCTA  896

seq1  TGCCAGGCACAGAATTCCAGCATTTGGAGGAGAGAAGGCTTTGCCTCCAT  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAGGCACAGAATTCCAGCATTTGGAGGAGAGAAGGCTTTGCCTCCAT  946

seq1  CTGGACACTTGTTATGGGCTCACACTGAACATATTCCTACACACTAACAC  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGACACTTGTTATGGGCTCACACTGAACATATTCCTACACACTAACAC  996

seq1  CAGGCAGTCAGCCTAGTGCCTAGCAAGCTACCATTGTCCCACAGGCTACT  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCAGTCAGCCTAGTGCCTAGCAAGCTACCATTGTCCCACAGGCTACT  1046

seq1  CAGCACTCAGCATCTGGGGACCTCTCTGACGACAGTTCCCAAGGTGCTCC  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACTCAGCATCTGGGGACCTCTCTGACGACAGTTCCCAAGGTGCTCC  1096

seq1  TGGTCAAGGAGCCTCATGGAGGACGTGCTAGAATTC  1129
      ||||||||||||||||||||||||||||||||||||
seq2  TGGTCAAGGAGCCTCATGGAGGACGTGCTAGAATTC  1132

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information