MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-236K14
Chromosome	5 (Build37)
Map Location	112,870,370 - 113,044,541
singlet/doublet	doublet
Overlap gene	Sez6l, EG625464
Upstream gene	Mn1, A230057G18Rik, Cryba4, Crybb1, Tpst2, Tfip11, 2810002G02Rik, Hps4, EG625424, Asphd2
Downstream gene	Myo18b, Adrbk2, Crybb2, LOC100042920, Crybb3, 2900026A02Rik, Gm854, Rutbc2, Aym1, C530024P05Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433938 MGI:1261813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230057G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330166 MGI:2444886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs

name	Cryba4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12959 MGI:102716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crybb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12960 MGI:104992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22022 MGI:1309516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tfip11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54723 MGI:1930075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810002G02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70118 MGI:1917368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hps4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192232 MGI:2177742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625424 MGI:3648511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asphd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72898 MGI:1920148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sez6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56747 MGI:1935121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625464 MGI:3648937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	Myo18b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74376 MGI:1921626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins

name	Adrbk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320129 MGI:87941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Crybb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12961 MGI:88519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Crybb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12962 MGI:102717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900026A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243219 MGI:1920194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm854 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333048 MGI:2685700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rutbc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52850 MGI:107320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aym1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503692 MGI:1891321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530024P05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320916 MGI:2445030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486984 GeneID:433938 MGI:1261813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : meningioma 1 transcript_id : NM_001081235.1

name	A230057G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375118 GeneID:330166 MGI:2444886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs product : RIKEN cDNA A230057G18 gene transcript_id : XM_489103.3

name	Cryba4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946671 GeneID:12959 MGI:102716
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta A4 transcript_id : NM_021351.1

name	Crybb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130494 GeneID:12960 MGI:104992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta B1 transcript_id : NM_023695.2

name	Tpst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981951 GeneID:22022 MGI:1309516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-tyrosine sulfotransferase 2 transcript_id : NM_009419.2

name	Tfip11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130732 GeneID:54723 MGI:1930075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuftelin interacting protein 11 transcript_id : NM_018783.4

name	2810002G02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249055 GeneID:70118 MGI:1917368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002G02 gene transcript_id : NM_027323.1

name	Hps4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476086 GeneID:192232 MGI:2177742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 4 homolog (human) transcript_id : NM_138646.2

name	EG625424 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802475 GeneID:625424 MGI:3648511
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625424 transcript_id : NM_001039228.2

name	Asphd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926228 GeneID:72898 MGI:1920148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartate beta-hydroxylase domain containing 2 transcript_id : NM_028386.1

name	Sez6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249081 GeneID:56747 MGI:1935121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seizure related 6 homolog like transcript_id : NM_019982.2

name	EG625464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375085 GeneID:625464 MGI:3648937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : predicted gene, EG625464 transcript_id : XM_894605.2

name	Myo18b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254132 GeneID:74376 MGI:1921626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 5 Proteins product : myosin XVIIIb transcript_id : XM_990203.2

name	Adrbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78711829 GeneID:320129 MGI:87941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 2 transcript_id : NM_177078.3

name	Adrbk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78711827 GeneID:320129 MGI:87941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor kinase, beta 2 transcript_id : NM_001035531.1

name	Crybb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372366 GeneID:12961 MGI:88519
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta B2 transcript_id : NM_007773.2

name	LOC100042920 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254170 GeneID:100042920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042920 transcript_id : XM_001479469.1

name	Crybb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476046 GeneID:12962 MGI:102717
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta B3 transcript_id : NM_021352.2

name	2900026A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373023 GeneID:243219 MGI:1920194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900026A02 gene transcript_id : NM_172884.2

name	Gm854 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803583 GeneID:333048 MGI:2685700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 854, (NCBI) transcript_id : NM_001033428.2

name	Rutbc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352699 GeneID:52850 MGI:107320
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and TBC1 domain containing 2 transcript_id : NM_172718.2

name	Aym1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60678283 GeneID:503692 MGI:1891321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activator of yeast meiotic promoters 1 transcript_id : NM_001012726.1

name	C530024P05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343262 GeneID:320916 MGI:2445030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530024P05 gene transcript_id : NM_177292.2

name	Mn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486985 GeneID:433938 MGI:1261813
definition	GO_process : GO:0001957 - intramembranous ossification [Evidence IMP] codon_start : 1 product : meningioma 1 protein_id : NP_001074704.1

name	A230057G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899261 GeneID:330166 MGI:2444886
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489103.2

name	Cryba4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946672 CCDS:CCDS19536.1 GeneID:12959 MGI:102716
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 function : lens structural protein product : crystallin, beta A4 protein_id : NP_067326.1

name	Crybb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963789 CCDS:CCDS19537.1 GeneID:12960 MGI:104992
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 product : crystallin, beta B1 protein_id : NP_076184.1

name	Tpst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678421 CCDS:CCDS19538.1 GeneID:22022 MGI:1309516
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008476 - protein-tyrosine sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : protein-tyrosine sulfotransferase 2 protein_id : NP_033445.1

name	Tfip11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10190660 CCDS:CCDS19539.1 GeneID:54723 MGI:1930075
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] [Evidence NAS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence NAS]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence NAS]; GO:0001503 - ossification [Evidence IEA]; GO:0045045 - secretory pathway [Evidence NAS] codon_start : 1 note : tuftelin-interacting protein 33; tuftelin-interacting protein, 39 kD product : tuftelin interacting protein 11 protein_id : NP_061253.2

name	2810002G02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249056 GeneID:70118 MGI:1917368
definition	GO_process : GO:0048511 - rhythmic process [Evidence IEA] codon_start : 1 note : SRR1-like product : sensitivity to red light reduced-like protein_id : NP_081599.1

name	Hps4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476087 CCDS:CCDS19540.1 GeneID:192232 MGI:2177742
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005764 - lysosome [Evidence ISS]; GO:0042470 - melanosome [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0007599 - hemostasis [Evidence ISS]; GO:0007040 - lysosome organization and biogenesis [Evidence ISS]; GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0006996 - organelle organization and biogenesis [Evidence IMP]; GO:0048081 - positive regulation of cuticle pigmentation [Evidence ISS]; GO:0048075 - positive regulation of eye pigmentation [Evidence ISS]; GO:0050821 - protein stabilization [Evidence ISS]; GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 exception : mismatches in translation note : light ear product : Hermansky-Pudlak syndrome 4 homolog protein_id : NP_619587.2

name	EG625424 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986623 GeneID:625424 MGI:3648511
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC625424 protein_id : NP_001034317.1

name	Asphd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55926229 CCDS:CCDS19542.1 GeneID:72898 MGI:1920148
definition	GO_component : GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA] GO_function : GO:0004597 - peptide-aspartate beta-dioxygenase activity [Evidence IEA] GO_process : GO:0018193 - peptidyl-amino acid modification [Evidence IEA] codon_start : 1 product : aspartate beta-hydroxylase domain containing 2 protein_id : NP_082662.1

name	Sez6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249082 GeneID:56747 MGI:1935121
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : acupuncture induced gene 1 product : seizure related 6 homolog like protein_id : NP_064366.2

name	EG625464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375086 GeneID:625464 MGI:3648937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899698.2

name	Myo18b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254133 GeneID:74376 MGI:1921626
definition	codon_start : 1 product : myosin XVIIIb protein_id : XP_995297.2

name	Adrbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711830 CCDS:CCDS19545.1 GeneID:320129 MGI:87941
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047696 - beta-adrenergic receptor kinase activity [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; beta ARK2 product : adrenergic receptor kinase, beta 2 isoform 1 protein_id : NP_796052.2

name	Adrbk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711828 GeneID:320129 MGI:87941
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0047696 - beta-adrenergic receptor kinase activity [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; beta ARK2 product : adrenergic receptor kinase, beta 2 isoform 2 protein_id : NP_001030608.1

name	Crybb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681035 CCDS:CCDS19546.1 GeneID:12961 MGI:88519
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0005212 - structural constituent of eye lens [Evidence IDA] GO_process : GO:0007423 - sensory organ development [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 function : structural protein note : betaB2-crystallin; Philly cataract product : crystallin, beta B2 protein_id : NP_031799.1

name	LOC100042920 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254171 GeneID:100042920
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479519.1

name	Crybb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946674 CCDS:CCDS19547.1 GeneID:12962 MGI:102717
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IEA] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 product : crystallin, beta B3 protein_id : NP_067327.1

name	2900026A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370348 GeneID:243219 MGI:1920194
definition	codon_start : 1 product : hypothetical protein LOC243219 protein_id : NP_766472.1

name	Gm854 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701931 CCDS:CCDS19548.1 GeneID:333048 MGI:2685700
definition	codon_start : 1 product : hypothetical protein LOC333048 protein_id : NP_001028600.1

name	Rutbc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370044 GeneID:52850 MGI:107320
definition	codon_start : 1 exception : mismatches in translation product : RUN and TBC1 domain containing 2 protein_id : NP_766306.1

name	Aym1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60678284 GeneID:503692 MGI:1891321
definition	GO_component : GO:0043080 - female germ cell nucleus (sensu Metazoa) [Evidence IDA]; GO:0043081 - male germ cell nucleus (sensu Metazoa) [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy product : activator of yeast meiotic promoters 1 protein_id : NP_001012744.1

name	C530024P05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893385 CCDS:CCDS19550.1 GeneID:320916 MGI:2445030
definition	codon_start : 1 product : hypothetical protein LOC320916 protein_id : NP_796266.1

clone name	MSMg01-128N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-380F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-236K14.b	B6Ng01-236K14.g
ACC	GA047826	GA047827
length	948	1,125
definition	B6Ng01-236K14.b	B6Ng01-236K14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(113,043,601 - 113,044,541)	(112,870,370 - 112,871,488)
sequence	gaattcttccagggagggtggaagagatgcctggaccctaccctcttcct attttacaagcaaggcaatgcaggcgaggcaacataaaatgagaatggga gtcactcacccagggctacccatcagtcgttacacaataagctcagtggg acccctatgtttccttacaccctgaggaggggtggctgaatttcccaaaa cagggggtaatttaatccctggaggggcatccagtgattttaaagataag tttgttcataagcagagtagaccaaatagaatcttctcaggagattccaa gaacaaggttgcgttcccttctatgcccaggccaggccatcacagaatga tggtaggcaagctgtcaatctcactgagctccatctgcagctgaaacagt gcagggtgcaaggtgcaggatgcaggatgcagcatgcaggatgcaggaag gatgtagaatgcactttgccttaaacacagcaagcagagagtcacagatt ggtttcaggccaggaagggatgggttctttctgcccttaaccagctgcgt gactctagccaccgagactccccttctctgaacctcagtttccagtctat aaaatggagactgcaatgccccctctgtgaacagccgagagagagagctt tagctgggttgccatagtgatgccaggaacaagcaagcttccacatcaca cagagactatgttacagcacgggccacagggccccaccctcagcttcaga ttctgtagctctgtggccaggtgggacctgagaatcggcatgatttaact tgcatctcattccaggtgttaggttaacccaaaggccatactccccaaac cactgagtgaattcctatggaaagatgggacagtgtccatcaaagagtta ggaacctcaattaaatatcccagatccctcctattagcttcgccacca	gaattctgggcacggggaaatgtgctggggatgtgccatggtctttcttc tttgatgcagaagatgctgagcaaaggtggtgaggtcccctgatgtgcct gtggttctccaggccctgctgaccacagcctgcctgttcacaggagaaag gtgaactgcttctcattcctcagaatcaacaaagttctcccttgtgtgag ggacagtgaggtgagggtatctacaggacaagcccttgtcattgacactg aagatcgaggtgggtggttattgacacacaaggaaggtccaagtccagcc tgctgagtctgcctgatcctatcccacctgtatcctccgaaatcaccata cctagccagtctcgcatcttatgcaccaggccagctttatgagcccctcc tgtgcccttcctaacctacaggctctggcctggtacacaggcctagcctg ccgagtccacctgaccctagtgcccccctccaccacattttcctggcatc atatccaacttccagacctagcaggggtcatacttactgtgctccagttt ggtctggtgcatcactggatgctagcccacccatgccacatccaatttca aatgtagcccaggttgcacattctgtgcactggggtccagtctggtttgt ctcaaagaccctaggaagcttgcattccacccagccactaacctagattg ggatggggtgtacatttgtgctcctgcgcagcctggtaagttcctggaac cttgcctgtccacaccatgcccaagtcttaagcttagctcagtctcagaa ctcatgtgtcagcttagcctggtgtgtgcccaagaccccatctgtgccat ccttaatgctctggcagaactcaggtacgaatgcctaagtagatcccacc gtttggttgtgggactgtgataggcagcctattttggttgatggagaccc agtaaagaactctacaagggatgggaaagcaggccatgtttctcagaaga caggtgcccgactacacagagccctcaaccttcataatttctggtgacta tagttcacgcagaactatgtccaagcttctgccattctggctagactcca cccccactggttttcttgactatag
quality values	Open. Hide. 52 47 27 38 62 62 54 62 62 39 23 62 62 47 41 47 62 49 47 62 62 49 62 62 62 59 43 31 59 59 56 34 32 25 16 23 28 28 36 39 43 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 56 62 56 43 43 49 48 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 62 62 59 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 59 59 62 62 62 59 62 59 59 51 62 59 62 62 62 62 56 62 59 62 62 62 59 59 62 62 62 62 62 51 43 62 59 59 56 59 56 51 62 62 59 59 62 62 46 62 62 62 56 62 62 59 62 59 56 59 59 62 59 59 59 59 59 59 59 59 62 62 62 62 59 59 62 62 59 62 62 62 56 62 62 62 62 62 62 56 56 54 51 62 54 54 54 62 62 62 62 62 51 51 62 56 51 51 56 56 62 62 47 62 46 62 39 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 37 45 56 56 62 62 62 56 62 62 62 56 62 56 56 53 43 56 56 43 56 56 36 47 56 62 43 43 46 47 38 56 62 47 48 43 43 42 42 62 35 39 62 54 62 52 47 46 62 47 54 52 27 20 27 20 29 33 62 42 62 62 52 52 58 58 58 35 58 46 42 54 39 47 40 52 52 50 52 47 50 50 46 28 34 37 52 52 52 52 52 27 28 27 37 22 52 46 54 48 58 46 58 27 38 33 30 27 33 33 34 22 46 52 52 47 39 37 50 42 14 28 35 52 47 37 50 51 46 26 33 32 37 27 23 33 48 50 29 16 47 34 30 34 50 37 47 41 49 32 41 20 50 25 51 41 41 50 32 31 20 13 40 28 26 27 19 35 40 41 29 29 29 46 31 21 32 34 37 29 26 43 21 37 33 34 22 40 40 20 16 30 23 29 21 23 23 28 37 40 36 26 13 17 10 9 10 9 52 32 53 53 52 58 33 34 31 31 39 34 20 20 28 38 33 20 40 32 37 36 13 39 30 38 49 18 29 24 47 42 9 28 31 23 24 31 41 30 23 21 52 23 17 31 46 32 40 34 24 42 53 34 37 42 33 33 30 32 13 18 26 38 35 12 29 37 53 42 29 13 4 8 10 33 35 31 33 32 22 21 45 52 24 47 13 12 16 34 33 31 25 32 32 47 36 46 26 24 18 14 11 12 28 34 42 15 30 29 14 41 33 35 28 29 28 34 24 31 18 11 28 30 13 25 15 31 41 33 42 31 31 21 14 22 9 10 41 28 42 31 31 42 31 31 31 17 20 8 21 17 31 24 16 7 25 18 28 31 6 6 6 20 32 18 22 13 30 21 24 11 11 12 23 13 25 28 6 36 31 16 6 7 18 12 9 19 13 30 30 12 5 8 13 15 6 17 7	Open. Hide. 62 47 47 47 62 62 62 62 62 62 42 32 39 21 32 27 22 15 41 44 44 62 62 62 62 62 62 62 62 62 59 43 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 59 50 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 46 46 62 62 62 62 54 62 62 62 62 62 62 62 56 56 46 30 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 47 54 62 62 56 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 45 54 58 52 58 54 54 45 41 47 54 43 47 58 58 52 58 47 36 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 54 58 58 58 58 52 58 58 54 58 54 47 48 58 58 58 58 54 58 54 54 54 42 58 58 58 52 54 54 54 47 58 54 58 51 50 51 50 58 58 47 41 58 53 58 58 50 35 58 58 46 54 50 49 50 52 58 44 49 42 58 51 49 58 50 50 48 32 58 50 50 51 53 52 48 30 28 50 49 41 39 58 44 50 35 50 36 50 51 50 48 41 49 51 58 50 50 50 51 51 50 40 48 44 19 51 50 42 50 52 51 37 50 50 40 32 50 46 46 50 49 32 49 50 35 41 35 40 37 34 19 22 33 40 34 41 49 38 51 50 50 47 40 30 47 37 46 58 38 39 37 35 46 58 58 44 18 47 32 49 40 29 53 54 42 42 37 38 37 50 32 52 49 53 49 25 49 42 25 54 45 40 40 34 16 17 38 32 46 53 39 49 53 45 34 38 24 22 44 20 23 26 28 25 33 42 37 23 27 27 37 32 25 44 37 39 39 37 34 27 32 38 27 32 32 53 24 31 32 40 27 41 46 41 26 29 45 26 7 10 13 32 53 30 31 21 33 33 32 53 30 29 40 46 33 33 32 28 34 16 51 34 31 41 23 36 32 31 40 33 31 45 32 32 38 31 28 40 32 27 30 18 46 24 25 26 24 21 32 30 31 45 31 37 30 29 21 31 23 14 8 27 41 21 28 35 23 31 31 30 30 20 15 27 18 34 30 21 32 31 9 5 7 14 7 5 5 28 14 22 27 13 25 28 29 37 19 31 36 29 31 31 21 46 41 19 23 30 24 13 39 13 9 30 26 29 31 16 30 41 9 37 21 11 31 25 31 21 9 14 14 29 19 27 21 20 20 31 30 24 46 44 26 31 26 17 23 19 29 8 21 22 25 8 12 7 11 13 16 18 12 6 24 11 18 30 29 21 32 42 34 27 25 19 6 24 48 19 5 9 13 43 7 43 40 32 17 16 21 7 10 14 15 15 12 27 17 34 11 14 6 12 5 6 9 17 8 29 6 6 32 29 10 9 17 25 16 13 11 7 10 9 16 5 6 9 9 19 5 29 29 18 5 22 6 11 8 8 26 25 15 19 21 11 28 10 38 20 13 10 9 5 6 6 13 6 6 4 3 3 3 14 8 14 19 10 12 8 5 8 26 13 5 4 15 4 3 3 4 22 5 10 16 8 15 16 10 8 17 5 9 11 21 7 14 16 19 16 11 15 21 10 25 13 16 16 23 8 8 28 26 27 20 4 3 2 3 8 7 27 25 7 22 10 5 6 7 4 4 4 4 6 1

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_113043601_113044541
seq2: B6Ng01-236K14.b_46_993 (reverse)

seq1  TGGTGGCGAAGCTAATAGGAAGGATCT-GGATATTT-ATTGA-GTTCCT-  46
      |||||||||||||||||||| |||||| |||||||| ||||| |||||| 
seq2  TGGTGGCGAAGCTAATAGGAGGGATCTGGGATATTTAATTGAGGTTCCTA  50

seq1  ACTCTTTGATGGACACTGTCCCATC-TTCCATAGGAATTCACTCAGTGGT  95
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  ACTCTTTGATGGACACTGTCCCATCTTTCCATAGGAATTCACTCAGTGGT  100

seq1  TTGGGGAGTATGGCCTTTGGGTTAACCTAACACCTGG-ATGAGATGCAAG  144
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTGGGGAGTATGGCCTTTGGGTTAACCTAACACCTGGAATGAGATGCAAG  150

seq1  TTAAATCATGCCGATTCTCAGGTCCCACCTGGCCACAGAGCTACAGAATC  194
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATCATGCCGATTCTCAGGTCCCACCTGGCCACAGAGCTACAGAATC  200

seq1  TGAAGCTGAGGGTGGGGCCCTGTGGCCCGTGCTGTAACATAGTCTCTGTG  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCTGAGGGTGGGGCCCTGTGGCCCGTGCTGTAACATAGTCTCTGTG  250

seq1  TGATGTGGAAGCTTGCTTGTTCCTGGCATCACTATGGCAACCCAGCT-AA  293
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  TGATGTGGAAGCTTGCTTGTTCCTGGCATCACTATGGCAACCCAGCTAAA  300

seq1  GCTCTCTCTCTCGGCTGTTCACAGAGGGGGCATTGCAGTCTCCATTTTAT  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTCTCTCTCGGCTGTTCACAGAGGGGGCATTGCAGTCTCCATTTTAT  350

seq1  AGACTGGAAACTGAGGTTCAGAGAAGGGGAGTCTCGGTGGCTAGAGTCAC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTGGAAACTGAGGTTCAGAGAAGGGGAGTCTCGGTGGCTAGAGTCAC  400

seq1  GCAGCTGGTTAAGGGCAGAAAGAACCCATCCCTTCCTGGCCTGAAACCAA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTGGTTAAGGGCAGAAAGAACCCATCCCTTCCTGGCCTGAAACCAA  450

seq1  TCTGTGACTCTCTGCTTGCTGTGTTTAAGGCAAAGTGCATTCTACATCCT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGACTCTCTGCTTGCTGTGTTTAAGGCAAAGTGCATTCTACATCCT  500

seq1  TCCTGCATCCTGCATGCTGCATCCTGCATCCTGCACCTTGCACCCTGCAC  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCATCCTGCATGCTGCATCCTGCATCCTGCACCTTGCACCCTGCAC  550

seq1  TGTTTCAGCTGCAGATGGAGCTCAGTGAGATTGACAGCTTGCCTACCATC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCAGCTGCAGATGGAGCTCAGTGAGATTGACAGCTTGCCTACCATC  600

seq1  ATTCTGTGATGGCCTGGCCTGGGCATAGAAGGGAACGCAACCTTGTTCTT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTGTGATGGCCTGGCCTGGGCATAGAAGGGAACGCAACCTTGTTCTT  650

seq1  GGAATCTCCTGAGAAGATTCTATTTGGTCTACTCTGCTTATGAACAAACT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATCTCCTGAGAAGATTCTATTTGGTCTACTCTGCTTATGAACAAACT  700

seq1  TATCTTTAAAATCACTGGATGCCCCTCCAGGGATTAAATTACCCCCTGTT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTTTAAAATCACTGGATGCCCCTCCAGGGATTAAATTACCCCCTGTT  750

seq1  TTGGGAAATTCAGCCACCCCTCCTCAGGGTGTAAGGAAACATAGGGGTCC  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGAAATTCAGCCACCCCTCCTCAGGGTGTAAGGAAACATAGGGGTCC  800

seq1  CACTGAGCTTATTGTGTAACGACTGATGGGTAGCCCTGGGTGAGTGACTC  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGAGCTTATTGTGTAACGACTGATGGGTAGCCCTGGGTGAGTGACTC  850

seq1  CCATTCTCATTTTATGTTGCCTCGCCTGCATTGCCTTGCTTGTAAAATAG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTCTCATTTTATGTTGCCTCGCCTGCATTGCCTTGCTTGTAAAATAG  900

seq1  GAAGAGGGTAGGGTCCAGGCATCTCTTCCACCCTCCCTGGAAGAATTC  941
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGGGTAGGGTCCAGGCATCTCTTCCACCCTCCCTGGAAGAATTC  948

seq1: chr5_112870370_112871488
seq2: B6Ng01-236K14.g_68_1192

seq1  GAATTCTGGGCACGGGGAAATGTGCTGGGGATGTGCCATGGTCTTTCTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGGGCACGGGGAAATGTGCTGGGGATGTGCCATGGTCTTTCTTC  50

seq1  TTTGATGCAGAAGATGCTGAGCAAAGGTGGTGAGGTCCCCTGATGTGCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATGCAGAAGATGCTGAGCAAAGGTGGTGAGGTCCCCTGATGTGCCT  100

seq1  GTGGTTCTCCAGGCCCTGCTGACCACAGCCTGCCTGTTCACAGGAGAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTTCTCCAGGCCCTGCTGACCACAGCCTGCCTGTTCACAGGAGAAAG  150

seq1  GTGAACTGCTTCTCATTCCTCAGAATCAACAAAGTTCTCCCTTGTGTGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAACTGCTTCTCATTCCTCAGAATCAACAAAGTTCTCCCTTGTGTGAG  200

seq1  GGACAGTGAGGTGAGGGTATCTACAGGACAAGCCCTTGTCATTGACACTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAGTGAGGTGAGGGTATCTACAGGACAAGCCCTTGTCATTGACACTG  250

seq1  AAGATCGAGGTGGGTGGTTATTGACACACAAGGAAGGTCCAAGTCCAGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATCGAGGTGGGTGGTTATTGACACACAAGGAAGGTCCAAGTCCAGCC  300

seq1  TGCTGAGTCTGCCTGATCCTATCCCACCTGTATCCTCCGAAATCACCATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGAGTCTGCCTGATCCTATCCCACCTGTATCCTCCGAAATCACCATA  350

seq1  CCTAGCCAGTCTCGCATCTTATGCACCAGGCCAGCTTTATGAGCCCCTCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCCAGTCTCGCATCTTATGCACCAGGCCAGCTTTATGAGCCCCTCC  400

seq1  TGTGCCCTTCCTAACCTACAGGCTCTGGCCTGGTACACAGGCCTAGCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCCTTCCTAACCTACAGGCTCTGGCCTGGTACACAGGCCTAGCCTG  450

seq1  CCGAGTCCACCTGACCCTAGTGCCCCCCTCCACCACATTTTCCTGGCATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGAGTCCACCTGACCCTAGTGCCCCCCTCCACCACATTTTCCTGGCATC  500

seq1  ATATCCAACTTCCAGACCTAGCAGGGGTCATACTTACTGTGCTCCAGTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCCAACTTCCAGACCTAGCAGGGGTCATACTTACTGTGCTCCAGTTT  550

seq1  GGTCTGGTGCATCACTGGATGCTAGCCCACCCATGCCACATCCAATTTCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTGGTGCATCACTGGATGCTAGCCCACCCATGCCACATCCAATTTCA  600

seq1  AATGTAGCCCAGGTTGCACATTCTGTGCACTGGGGTCCAGTCTGGTTTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAGCCCAGGTTGCACATTCTGTGCACTGGGGTCCAGTCTGGTTTGT  650

seq1  CTCAAAGACCCTAGGAAGCTTGCATTCCACCCAGCCACTAACCTAGATTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAAGACCCTAGGAAGCTTGCATTCCACCCAGCCACTAACCTAGATTG  700

seq1  GGATGGGGTGTACATTTGTGCTCCTGCGCAGCCTGGTAAGTTCCTGGAAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGGGTGTACATTTGTGCTCCTGCGCAGCCTGGTAAGTTCCTGGAAC  750

seq1  CTTGCCTGTCCACACCATGCCCAAGTCTTAAGCTTAGCTCAGGTCTCAGA  800
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  CTTGCCTGTCCACACCATGCCCAAGTCTTAAGCTTAGCTCA-GTCTCAGA  799

seq1  ACTCATGTGTCAGCTTAGCCTGGTGTGTGCCCAAGACCCCATCTGTGCCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATGTGTCAGCTTAGCCTGGTGTGTGCCCAAGACCCCATCTGTGCCA  849

seq1  TCCTTAATGCTCTGGCAGAACTCAGGTACGAATGCCTAAGTAGATCCCAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTAATGCTCTGGCAGAACTCAGGTACGAATGCCTAAGTAGATCCCAC  899

seq1  CG-TTGGTTGTGGGACTGTGATAGGCAGCCTATTTTGGTTGAATGGAGAC  949
      || |||||||||||||||||||||||||||||||||||||| ||||||||
seq2  CGTTTGGTTGTGGGACTGTGATAGGCAGCCTATTTTGGTTG-ATGGAGAC  948

seq1  CCAGTAAAGAACTCTACAAGGGATGGAAAAGCAAGCCATG-TTCCCAG-A  997
      |||||||||||||||||||||||||| |||||| |||||| ||| ||| |
seq2  CCAGTAAAGAACTCTACAAGGGATGGGAAAGCAGGCCATGTTTCTCAGAA  998

seq1  GACAGGTGCCCGACACCACAGAGCCCCCAA-CTTCATAA-TTCT-GTGAC  1044
      ||||||||||||||  |||||||||| ||| |||||||| |||| |||||
seq2  GACAGGTGCCCGACTACACAGAGCCCTCAACCTTCATAATTTCTGGTGAC  1048

seq1  TATAAGTCACGCAG-ACAATGTCCCAAGCTTCTGGCATTCTGGCTAGACT  1093
      ||||  |||||||| || |||| ||||||||||| |||||||||||||||
seq2  TATAGTTCACGCAGAACTATGT-CCAAGCTTCTGCCATTCTGGCTAGACT  1097

seq1  CCACCCCCACTG--TTTCCTGACTATAG  1119
      ||||||||||||  |||| |||||||||
seq2  CCACCCCCACTGGTTTTCTTGACTATAG  1125

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information