MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-240M05
Chromosome	5 (Build37)
Map Location	146,405,927 - 146,407,087
singlet/doublet	singlet
Overlap gene	LOC667065
Upstream gene	EG621967, Tmem130, LOC100039427, Trrap, Smurf1, AW146299, EG231885, EG666992, 1700018F24Rik, Arpc1a, Arpc1b, Pdap1, Bud31, Ptcd1, Cpsf4, Atp5j2, Zkscan14, Zkscan5, EG622116, Zfp655, LOC677270, EG666311, EG622127, LOC100039566, Cyp3a16, LOC100041375
Downstream gene	Cyp3a41, Cyp3a44, Cyp3a11, Cyp3a25, LOC667098, LOC667104, LOC100041449, LOC433961, EG622306, 1700001J03Rik, LOC667121, Rnf6, Cdk8, Wasf3, LOC623198, LOC622924, 4930449I24Rik, LOC100041548, LOC100041554, LOC100041566, LOC100041578, EG667172, Gpr12
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG621967 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621967 MGI:3643871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Tmem130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243339 MGI:3607706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Trrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100683 MGI:2153272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smurf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	AW146299 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381686 MGI:2141165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG231885 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231885 MGI:3648713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein

name	EG666992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666992 MGI:3647320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	1700018F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69396 MGI:1916646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56443 MGI:1928896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11867 MGI:1343142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231887 MGI:2448536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bud31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231889 MGI:2141291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71799 MGI:1919049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54188 MGI:1861602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5j2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57423 MGI:1927558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zkscan14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67235 MGI:1914485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zkscan5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22757 MGI:107533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622116 MGI:3643197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72611 MGI:1919861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG666311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins

name	LOC100039566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cyp3a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13114 MGI:106099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins

name	LOC667065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Cyp3a41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53973 MGI:1858451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13112 MGI:88609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56388 MGI:1930638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins

name	LOC433961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	EG622306 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins

name	1700001J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69282 MGI:1916532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Rnf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wasf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245880 MGI:2658986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC622924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins

name	4930449I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041548 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins

name	LOC100041554 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins

name	LOC100041566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 3 Proteins

name	LOC100041578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins

name	EG667172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins pseudo : _no_value

name	Gpr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14738 MGI:101909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG621967 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82899793 GeneID:621967 MGI:3643871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG621967 transcript_id : XM_886369.1

name	Tmem130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130473 GeneID:243339 MGI:3607706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 130 transcript_id : NM_177735.4

name	LOC100039427 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254737 GeneID:100039427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039427 transcript_id : XM_001472864.1

name	Trrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486948 GeneID:100683 MGI:2153272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation/transcription domain-associated protein transcript_id : NM_001081362.1

name	Smurf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044885 GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMAD specific E3 ubiquitin protein ligase 1 transcript_id : NM_029438.3

name	Smurf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044889 GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMAD specific E3 ubiquitin protein ligase 1 transcript_id : NM_001038627.1

name	AW146299 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446031 GeneID:381686 MGI:2141165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW146299 transcript_id : NM_001013774.2

name	EG231885 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254742 GeneID:231885 MGI:3648713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein product : predicted gene, EG231885, transcript variant 1 transcript_id : XM_124689.4

name	1700018F24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380212 GeneID:69396 MGI:1916646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700018F24 gene transcript_id : NM_027069.2

name	Arpc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130576 GeneID:56443 MGI:1928896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 1A transcript_id : NM_019767.2

name	Arpc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963526 GeneID:11867 MGI:1343142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 1B transcript_id : NM_023142.1

name	Pdap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351074 GeneID:231887 MGI:2448536
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDGFA associated protein 1 transcript_id : NM_001033313.2

name	Bud31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222237 GeneID:231889 MGI:2141291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BUD31 homolog (yeast) transcript_id : NM_001008705.1

name	Ptcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526931 GeneID:71799 MGI:1919049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pentatricopeptide repeat domain 1 transcript_id : NM_133735.1

name	Cpsf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802866 GeneID:54188 MGI:1861602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specific factor 4 transcript_id : NM_178576.2

name	Atp5j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372981 GeneID:57423 MGI:1927558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2 transcript_id : NM_020582.2

name	Zkscan14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158684 GeneID:67235 MGI:1914485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 14 transcript_id : NM_023322.2

name	Zkscan5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46409653 GeneID:22757 MGI:107533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 5 transcript_id : NM_016683.1

name	EG622116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375840 GeneID:622116 MGI:3643197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG622116 transcript_id : XM_896865.2

name	Zfp655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130475 GeneID:72611 MGI:1919861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 655 transcript_id : NM_028298.3

name	EG666311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487458 GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666311 transcript_id : NM_001081431.1

name	EG622127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254740 GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins product : predicted gene, EG622127 transcript_id : XM_001473095.1

name	Cyp3a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681116 GeneID:13114 MGI:106099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 16 transcript_id : NM_007820.1

name	LOC100041375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254743 GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins product : similar to cytochrome P450 transcript_id : XM_001476442.1

name	Cyp3a41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802389 GeneID:53973 MGI:1858451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 41 transcript_id : NM_017396.2

name	Cyp3a44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130400 GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 44 transcript_id : NM_177380.3

name	Cyp3a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131163 GeneID:13112 MGI:88609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 11 transcript_id : NM_007818.3

name	Cyp3a25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469130 GeneID:56388 MGI:1930638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 25 transcript_id : NM_019792.1

name	LOC100041449 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254753 GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins product : similar to cytochrome P450IIIA25 transcript_id : XM_001476549.1

name	LOC433961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375847 GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : hypothetical LOC433961 transcript_id : XM_485697.4

name	EG622306 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375836 GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins product : predicted gene, EG622306 transcript_id : XM_886734.2

name	1700001J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606116 GeneID:69282 MGI:1916532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001J03 gene transcript_id : NM_001008547.1

name	Rnf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803555 GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein (C3H2C3 type) 6 transcript_id : NM_028774.2

name	Cdk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611229 GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 8 transcript_id : NM_153599.3

name	Wasf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130090 GeneID:245880 MGI:2658986
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS protein family, member 3 transcript_id : NM_145155.2

name	LOC623198 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254755 GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : hypothetical LOC623198 transcript_id : XM_001476794.1

name	LOC622924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254757 GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins product : hypothetical LOC622924 transcript_id : XM_001476811.1

name	4930449I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360372 GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930449I24 gene transcript_id : NM_026136.2

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254759 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : hypothetical protein LOC100041548, transcript variant 1 transcript_id : XM_001476853.1

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254761 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041548, transcript variant 2 transcript_id : XM_001476864.1

name	LOC100041554 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254763 GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins product : hypothetical protein LOC100041554 transcript_id : XM_001476873.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254765 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 3 Proteins product : hypothetical protein LOC100041566, transcript variant 1 transcript_id : XM_001476887.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254767 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041566, transcript variant 2 transcript_id : XM_001476901.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254769 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 3 Proteins product : hypothetical protein LOC100041578, transcript variant 1 transcript_id : XM_001476922.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254771 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : hypothetical protein LOC100041578, transcript variant 2 transcript_id : XM_001476941.1

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982768 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_001010941.2

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331127 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_008151.3

name	EG621967 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899794 GeneID:621967 MGI:3643871
definition	codon_start : 1 product : similar to ribosomal protein S29 protein_id : XP_891462.1

name	Tmem130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048368 CCDS:CCDS19851.1 GeneID:243339 MGI:3607706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243339 protein_id : NP_808403.2

name	LOC100039427 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254738 GeneID:100039427
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472914.1

name	Trrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486949 GeneID:100683 MGI:2153272
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0007093 - mitotic checkpoint [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transactivation/transformation-domain associated protein product : transformation/transcription domain-associated protein protein_id : NP_001074831.1

name	Smurf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044886 GeneID:75788 MGI:1923038
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0007398 - ectoderm development [Evidence ISS]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence ISS] [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Smad ubiquitination regulatory factor 1 product : Smad ubiquitination regulatory factor 1 isoform 2 protein_id : NP_083714.3

name	Smurf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044890 GeneID:75788 MGI:1923038
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0007398 - ectoderm development [Evidence ISS]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence ISS] [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Smad ubiquitination regulatory factor 1 product : Smad ubiquitination regulatory factor 1 isoform 1 protein_id : NP_001033716.1

name	AW146299 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446032 CCDS:CCDS19852.1 GeneID:381686 MGI:2141165
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IEA] codon_start : 1 note : nuclear transport receptor product : hypothetical protein LOC381686 protein_id : NP_001013796.2

name	EG231885 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20848821 GeneID:231885 MGI:3648713
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_124689.1

name	1700018F24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386196 GeneID:69396 MGI:1916646
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC69396 protein_id : NP_081345.1

name	Arpc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790221 CCDS:CCDS19855.1 GeneID:56443 MGI:1928896
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS] codon_start : 1 note : actin related protein 2/3 complex, subunit 1A (41 kDa) product : actin related protein 2/3 complex, subunit 1A protein_id : NP_062741.1

name	Arpc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963527 CCDS:CCDS19856.1 GeneID:11867 MGI:1343142
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS] codon_start : 1 exception : mismatches in translation note : actin related protein 2/3 complex, subunit 1B (41 kDa) product : actin related protein 2/3 complex, subunit 1B protein_id : NP_075631.1

name	Pdap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781781 GeneID:231887 MGI:2448536
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0048407 - platelet-derived growth factor binding [Evidence ISS] GO_process : GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence ISS] codon_start : 1 product : PDGFA associated protein 1 protein_id : NP_001028485.1

name	Bud31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222238 CCDS:CCDS19857.1 GeneID:231889 MGI:2141291
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : maternal G10 transcript protein_id : NP_001008705.1

name	Ptcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253682 CCDS:CCDS19858.1 GeneID:71799 MGI:1919049
definition	codon_start : 1 exception : mismatches in translation product : pentatricopeptide repeat domain 1 protein_id : NP_598496.2

name	Cpsf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30466247 CCDS:CCDS19859.1 GeneID:54188 MGI:1861602
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : musculus clipper/cleavage and polyadenylation specificity factor 30 kDa subunit; cleavage and polyadenylation specific factor 4, 30kD subunit product : cleavage and polyadenylation specific factor 4 protein_id : NP_848671.1

name	Atp5j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181184 GeneID:57423 MGI:1927558
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005753 - proton-transporting ATP synthase complex (sensu Eukaryota) [Evidence ISS]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2 protein_id : NP_065607.1

name	Zkscan14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158685 CCDS:CCDS19860.1 GeneID:67235 MGI:1914485
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 99 protein_id : NP_075811.2

name	Zkscan5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46409654 GeneID:22757 MGI:107533
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 95 protein_id : NP_057892.1

name	EG622116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899802 GeneID:622116 MGI:3643197
definition	codon_start : 1 product : hypothetical protein protein_id : XP_901958.1

name	Zfp655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312242 CCDS:CCDS19861.1 GeneID:72611 MGI:1919861
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 655 isoform a protein_id : NP_082574.1

name	EG666311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487459 GeneID:666311 MGI:3647079
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : predicted gene, EG666311 protein_id : NP_001074900.1

name	EG622127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254741 GeneID:622127 MGI:3646373
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001473145.1

name	Cyp3a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681117 CCDS:CCDS19862.1 GeneID:13114 MGI:106099
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a16 product : cytochrome P450, family 3, subfamily a, polypeptide 16 protein_id : NP_031846.1

name	LOC100041375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254744 GeneID:100041375
definition	codon_start : 1 product : similar to cytochrome P450 protein_id : XP_001476492.1

name	Cyp3a41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393235 CCDS:CCDS19863.1 GeneID:53973 MGI:1858451
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, steroid inducible 3a41 product : cytochrome P450, family 3, subfamily a, polypeptide 41 protein_id : NP_059092.1

name	Cyp3a44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893549 CCDS:CCDS19864.1 GeneID:337924 MGI:2449818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 3a44 product : cytochrome P450, family 3, subfamily a, polypeptide 44 protein_id : NP_796354.1

name	Cyp3a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681113 CCDS:CCDS19865.1 GeneID:13112 MGI:88609
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, steroid inducible 3a11 product : cytochrome P450, family 3, subfamily a, polypeptide 11 protein_id : NP_031844.1

name	Cyp3a25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469131 CCDS:CCDS19866.1 GeneID:56388 MGI:1930638
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a25 product : cytochrome P450, family 3, subfamily a, polypeptide 25 protein_id : NP_062766.1

name	LOC100041449 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254754 GeneID:100041449
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001476599.1

name	LOC433961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82899820 GeneID:433961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485697.3

name	EG622306 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899822 GeneID:622306 MGI:3643357
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891827.1

name	1700001J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606117 GeneID:69282 MGI:1916532
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69282 protein_id : NP_001008547.1

name	Rnf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311909 CCDS:CCDS19868.1 GeneID:74132 MGI:1921382
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0030517 - negative regulation of axon extension [Evidence IGI] [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IC]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 product : ring finger protein (C3H2C3 type) 6 protein_id : NP_083050.1

name	Cdk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31652272 CCDS:CCDS19869.1 GeneID:264064 MGI:1196224
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 8 protein_id : NP_705827.2

name	Wasf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553113 CCDS:CCDS19870.1 GeneID:245880 MGI:2658986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WAS protein family, member 3 protein_id : NP_660137.1

name	LOC623198 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254756 GeneID:623198
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476844.1

name	LOC622924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254758 GeneID:622924
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476861.1

name	4930449I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385646 GeneID:67410 MGI:1914660
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67410 protein_id : NP_080412.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254760 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476903.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254762 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476914.1

name	LOC100041554 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254764 GeneID:100041554
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476923.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254766 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476937.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254768 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476951.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254770 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476972.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254772 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476991.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331129 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_001010941.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680061 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_032177.1

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 2 pseudo : _no_value

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 2 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 15 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 14 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 13 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 12 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 11 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 10 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 9 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 8 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 7 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 6 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 5 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 4 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 2 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 1 pseudo : _no_value

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 2 pseudo : _no_value

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 1 pseudo : _no_value

name	EG666992 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254739 GeneID:666992 MGI:3647320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG666992 pseudo : _no_value transcript_id : XR_001957.2

name	EG667172 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94375848 GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins product : predicted gene, EG667172 pseudo : _no_value transcript_id : XR_001988.1

clone name	MSMg01-117L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486J24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-185O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-534E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-240M05.b	B6Ng01-240M05.g
ACC	GA050846	GA050847
length	1,174	1,190
definition	B6Ng01-240M05.b	B6Ng01-240M05.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctcatgtttttctctcttgcccagctataggctgttgtatccttg atttgaccaatcagaagaagctggataagaatgttttccaaatactgatg caggagatgcttcatgataaggacaataccaaagtctgaaccagagctct gcactggatctttgggtacagaaaacagcaattgaatgcacagtgaacaa agccatctcccagtagtttaatgatatcacttaggctagttatggcctaa cttagttttggttatccctagatccatgagaactcagcacacatgaatag cagcaattggctaacatgcaaattcactattcacaaagctctctgggaaa tgggcaaggagggagcccagttgttgatttgtttcagtttttgatgatgg tcttgcttgtctcttctcttctatgtgtgtgtgtgtggatgcaagtgttt ccgtttcccttatagatatggaacccttacacaaggactttttaagaaac agggaattcctgggcccaaagctctgacatttttaggcactgtgctgaat tattacaaggtgagtgttgatttagctttccttttggcttctgcttgcgg ctaataatgtcttagttctattaaatgcttctactgaggaaatgctgaga tatcagatcctcatactctgttttctcttgattcctgtcaaaatccagtg gtcctctgagatattttagccatgtaaaactaattaaatatttgtatgtg tttatattttatagtatgtatatgggtatctgcacatatacgaaatgtcc atatatgtgttcagggcatatgcatgtatatgtgtgtggatgtggatgct gtgtgcctgtgtaattttatagtatgtatatgggcatttgcatgtgtgtg agtgcccatatgtgtgtgcagtgaatatgcatgtatatgtgtgcgtttga ggtcagaggttcacactgtggtgttttccttgattgctccttcagatcat cctttgagtcagaagttctcctcacctttgacctgctcctcctctgactt gatttagtttaggtcaacccagctttgctctggggctccatttcctctga ctcttggcaactgagatctataccttctcccagggattacacaagacctt cagagatcgaattcttgtttttga	gaattctcacctgaggaataccgaatggctgagaagcacctgaaaaaatg ttcagcatccttaatcaccagggaaatgcaaatcaaaataactctgagat tccatctcacaccagccagaatggataagatcaaaaattcaggtgagagc agatgctggtgaggatgtggagaaagaggaacactcctccattattggtg gaattgcaagcttgtacaaccactctggaaatcagtctggtggttcctct gaaaattggacatagtactcctggaggatcccacaatacctctcctgggc atatatccagaagatgttccaactagtaagaaagaaacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtatgtttacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctaggcaa atggttggacctggagggcatcatcctgagtgaggtaacccaatcacaaa agaactcacatgatatgtactcactgataagtggatattagcccagaaac aaagaatacccaagatacaagatacaatttgcaaaacacatgaaactcaa gaagaacaaagaccaaagtgtggacactttgccccttcttaaaattggga acaaaacacccatggaaggagttacagagacaaagattggagctgagatg aaaggatggaccatctagagactgccatatccagggatccatcccataat tagcctccaaacgctgacaccattgcacacactagcaagattttgctgaa aggaccctgatatagctgtctcttgcgaggctattgcaggggcctaacaa acacataagtggatgctcacagtcagctattggatggaacacagggcccc caatgtaggagctagagaaagtacccaaggactaagggtctgcaaccgta tagtgacacaatatgactacccagtacctccccagagctggtgtctctta gctgcattatgttatcagagatgcctaggtggccatcagtgtaaagagag agccaatgtcggtgcagacttatctggcctcagtacagtgaacgcccaag gtcagaatgcgggagtgctacatctactgcgtgttcgtat
quality values	Open. Hide. 58 36 32 35 58 58 54 31 25 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 47 37 62 62 49 56 59 59 38 37 46 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 59 54 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 47 41 62 62 58 58 58 58 58 54 58 58 58 58 58 54 58 54 52 58 54 48 58 58 52 58 54 58 58 45 54 41 54 49 58 52 58 52 54 58 52 58 54 54 58 52 58 47 52 52 54 54 53 54 58 52 54 58 54 58 58 54 54 52 52 58 58 45 34 48 58 49 35 43 58 52 58 54 54 22 42 31 52 50 53 53 23 58 35 51 58 50 51 50 51 52 50 50 51 50 58 50 58 58 51 50 52 53 53 49 58 39 36 54 49 58 50 58 50 53 32 58 58 35 49 50 50 37 42 34 58 51 31 50 37 50 40 47 49 58 33 41 28 50 53 51 58 40 49 37 44 34 34 53 53 53 40 58 58 50 37 50 49 28 33 41 39 58 52 49 50 50 58 44 51 38 50 52 51 51 39 29 58 39 50 50 50 32 33 36 47 49 53 49 42 37 42 35 51 38 35 39 39 39 54 38 49 40 39 39 30 52 52 45 32 41 37 53 53 41 39 45 26 39 54 6 24 54 42 53 37 27 53 53 52 53 52 54 47 54 49 36 40 6 10 28 40 31 28 34 32 40 32 37 30 33 51 32 27 33 37 32 33 31 41 53 53 34 42 45 34 32 45 32 52 34 29 23 31 31 35 37 26 46 25 45 31 33 31 51 25 30 25 34 31 22 51 51 51 51 26 32 24 21 23 18 41 26 24 27 31 31 25 46 27 30 29 31 41 29 34 26 31 33 43 31 32 25 42 30 25 37 12 31 30 9 47 30 24 34 31 18 29 16 39 31 31 26 31 25 7 10 6 23 22 34 28 26 18 30 38 10 16 38 21 30 17 16 20 27 29 16 17 24 31 31 38 48 27 26 25 20 11 12 23 15 8 26 7 36 17 8 8 9 14 16 31 16 35 7 21 5 7 21 18 39 34 11 10 29 9 6 8 19 8 12 17 7 10 7 16 9 32 27 34 10 5 26 9 11 19 11 16 16 31 23 19 14 8 23 8 5 9 34 25 8 17 7 10 15 11 9 6 4 5 5 9 30 32 26 10 8 5 3 4 3 3 3 7 10 28 11 6 6 8 24 13 28 10 6 17 8 11 10 28 21 15 5 5 28 11 7 7 6 22 5 16 19 8 13 14 11 4 3 5 19 10 7 5 4 6 9 3 15 28 7 1 4 5 6 3 12 26 23 5 5 12 5 9 6 15 4 14 6 12 8 16 4 6 4 11 4 7 7 4 3 2 7 19 5 6 6 9 7 18 7 7 9 4 7 29 18 8 5 9 9 8 10 12 3 4 5 10 4 4 7 14 4 5 6 13 8 16 5 7 4 3 3 5 4 22 8 7 17 9 5 6 14 4 10 28 28 17 4 6	Open. Hide. 62 47 56 39 62 62 62 44 42 62 62 59 43 25 24 49 29 34 47 59 59 62 62 62 62 62 62 62 62 62 62 59 33 54 62 62 62 62 59 62 62 59 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 42 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 46 58 54 58 58 54 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 54 38 58 58 58 49 58 58 54 58 54 54 54 58 54 41 58 58 54 44 54 50 58 48 58 58 51 49 58 58 58 50 58 50 58 58 58 49 58 58 58 58 58 50 58 53 58 58 51 50 51 58 58 58 52 54 58 58 52 58 58 58 45 50 51 58 58 58 58 58 48 39 53 49 53 49 46 58 58 58 41 52 58 58 47 51 50 58 58 40 58 53 52 51 44 58 51 46 58 52 46 50 52 52 51 58 51 51 39 50 44 43 51 52 58 58 54 52 54 58 58 50 50 51 50 50 58 51 58 58 46 50 51 43 50 46 53 58 51 38 58 41 39 43 34 54 40 47 33 40 38 33 44 52 53 53 45 54 44 41 34 32 49 50 54 44 49 44 27 27 33 50 50 39 39 45 34 54 54 34 39 32 49 54 40 47 35 37 13 54 54 52 39 37 31 54 46 33 42 52 54 32 35 17 51 42 19 51 46 32 38 34 37 54 37 33 37 32 54 39 37 34 24 32 40 31 47 28 42 42 32 53 23 40 34 39 53 53 45 23 53 34 31 47 40 29 18 29 31 32 45 53 37 31 34 31 32 33 31 45 29 27 25 42 30 43 29 42 26 43 51 35 14 21 24 27 21 45 25 40 31 29 31 34 35 31 31 26 31 25 33 38 34 22 14 51 30 27 31 42 32 32 27 23 29 28 33 28 42 29 31 29 31 30 30 30 31 31 31 31 21 31 28 33 28 37 18 48 48 33 27 31 30 28 37 48 37 29 33 30 13 41 29 25 31 38 24 26 32 35 31 26 31 31 32 34 36 31 29 23 29 21 20 31 31 25 18 26 17 26 32 37 21 6 10 32 39 27 22 30 31 21 16 19 25 48 31 21 22 31 24 31 19 30 21 27 26 22 18 17 30 25 24 33 18 7 14 30 32 34 31 33 33 38 15 6 25 18 9 19 23 28 33 32 21 19 18 21 19 10 34 18 13 33 31 36 29 14 16 24 23 10 7 18 7 29 10 20 32 27 14 28 14 28 43 17 18 34 24 29 37 23 11 14 17 13 16 6 21 32 7 4 29 24 11 26 27 27 28 15 13 13 18 9 19 14 16 6 13 6 3 3 6 14 9 11 10 28 24 24 8 25 14 13 20 17 40 13 16 13 24 13 13 9 11 14 31 29 18 8 8 20 6 16 19 14 17 10 7 4 5 13 11 8 20 16 24 27 27 20 21 9 11 3 3 5 8 5 7 16 23 7 6 5 11 4 9 4 16 8 12 10 15 4 4 4 11 3 2 3 13 21 18 16 10 5 3 2 3 13 23 8 5 4 5 6 6 16 18 19 5 4 18 2 2 5 6 8 7 15 8 4 6 19 6 13 3 6 8 12 16 5 8 15 8 12 5 6 3 3 5 10 7 13 3 3 3 6 4 5 9 22 12 5 5 11 17 5 5 5 4 16 5 2 2 1 5 3 3 1 9 8 24 4 2 5 7 22 8 5 6 6 7 20 8 5 4 6 10 18 4 4 11 6 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_146405927_146407087
seq2: B6Ng01-240M05.b_42_1215 (reverse)

seq1  TCAAAAAC-AGAATTTGA-CTCTGAAGGTC-TGTGTAAATACCTGGGAGG  47
      |||||||| |||||| || ||||||||||| ||||| ||| |||||||| 
seq2  TCAAAAACAAGAATTCGATCTCTGAAGGTCTTGTGT-AATCCCTGGGAGA  49

seq1  AGGTAATAGAACACATGTG-CAAGAGTCAGAGAAAAGAGACCCCAAGAGC  96
      |||| ||||| | ||  || |||||||||||| |||  || ||| |||||
seq2  AGGT-ATAGATCTCAGTTGCCAAGAGTCAGAGGAAATGGAGCCCCAGAGC  98

seq1  -AAGCTGG--TTAACTAAACT-AATCAAGTCAGA-GAGAGCCAGGTCAAA  141
       |||||||  | | ||||||| |||||||||||| |||   |||||||||
seq2  AAAGCTGGGTTGACCTAAACTAAATCAAGTCAGAGGAGGAGCAGGTCAAA  148

seq1  -GTGA-GAGA--CTCTGACTCAAAGGATGAACTGAA-GAGCAATC-AGGA  185
       |||| ||||   ||||||||||||||||| ||||| |||||||| ||||
seq2  GGTGAGGAGAACTTCTGACTCAAAGGATGATCTGAAGGAGCAATCAAGGA  198

seq1  AAACA-CACAGTGTGAACCTCTGACCTCAAACGCACACATATACATGCAT  234
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACACCACAGTGTGAACCTCTGACCTCAAACGCACACATATACATGCAT  248

seq1  ATTCACCTGCACACACATATGGGCACTCACACACATGCAAATGCCCATAT  284
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCA-CTGCACACACATATGGGCACTCACACACATGCAAATGCCCATAT  297

seq1  ACATACTATAAAATTACACAGGCACACAGCATCCACATCCACACACATAT  334
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACTATAAAATTACACAGGCACACAGCATCCACATCCACACACATAT  347

seq1  ACATGCATATGCCCCTGAACACATATATGGACA-TTCGTATATGTGCAGA  383
      ||||||||||| ||||||||||||||||||||| ||||||||||||||||
seq2  ACATGCATATG-CCCTGAACACATATATGGACATTTCGTATATGTGCAGA  396

seq1  TACCCATATACATACTATAAAATATAAACACATACAAATATTTAATTAGT  433
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCATATACATACTATAAAATATAAACACATACAAATATTTAATTAGT  446

seq1  TTTACATGGCTAAAATATCTCAGAGGACCACTGGATTTTGACAGGAATCA  483
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACATGGCTAAAATATCTCAGAGGACCACTGGATTTTGACAGGAATCA  496

seq1  AGAGAAAACAGAGTATGAGGATCTGATATCTCAGCATTTCCTCAGTAGAA  533
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAAACAGAGTATGAGGATCTGATATCTCAGCATTTCCTCAGTAGAA  546

seq1  GCATTTAATAGAACTAAGACATTATTAGCCGCAAGCAGAAGCCAAAAGGA  583
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTTAATAGAACTAAGACATTATTAGCCGCAAGCAGAAGCCAAAAGGA  596

seq1  AAGCTAAATCAACACTCACCTTGTAATAATTCAGCACAGTGCCTAAAAAT  633
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTAAATCAACACTCACCTTGTAATAATTCAGCACAGTGCCTAAAAAT  646

seq1  GTCAGAGCTTTGGGCCCAGGAATTCCCTGTTTCTTAAAAAGTCCTTGTGT  683
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGAGCTTTGGGCCCAGGAATTCCCTGTTTCTTAAAAAGTCCTTGTGT  696

seq1  AAGGGTTCCATATCTATAAGGGAAACGGAAACACTTGCATCCACACACAC  733
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGTTCCATATCTATAAGGGAAACGGAAACACTTGCATCCACACACAC  746

seq1  ACACATAGAAGAGAAGAGACAAGCAAGACCATCATCAAAAACTGAAACAA  783
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACATAGAAGAGAAGAGACAAGCAAGACCATCATCAAAAACTGAAACAA  796

seq1  ATCAACAACTGGGCTCCCTCCTTGCCCATTTCCCAGAGAGCTTTGTGAAT  833
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAACAACTGGGCTCCCTCCTTGCCCATTTCCCAGAGAGCTTTGTGAAT  846

seq1  AGTGAATTTGCATGTTAGCCAATTGCTGCTATTCATGTGTGCTGAGTTCT  883
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAATTTGCATGTTAGCCAATTGCTGCTATTCATGTGTGCTGAGTTCT  896

seq1  CATGGATCTAGGGATAACCAAAACTAAGTTAGGCCATAACTAGCCTAAGT  933
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGATCTAGGGATAACCAAAACTAAGTTAGGCCATAACTAGCCTAAGT  946

seq1  GATATCATTAAACTACTGGGAGATGGCTTTGTTCACTGTGCATTCAATTG  983
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATCATTAAACTACTGGGAGATGGCTTTGTTCACTGTGCATTCAATTG  996

seq1  CTGTTTTCTGTACCCAAAGATCCAGTGCAGAGCTCTGGTTCAGACTTTGG  1033
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTTCTGTACCCAAAGATCCAGTGCAGAGCTCTGGTTCAGACTTTGG  1046

seq1  TATTGTCCTTATCATGAAGCATCTCCTGCATCAGTATTTGGAAAACATTC  1083
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGTCCTTATCATGAAGCATCTCCTGCATCAGTATTTGGAAAACATTC  1096

seq1  TTATCCAGCTTCTTCTGATTGGTCAAATCAAGGATACAACAGCCTATAGC  1133
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCCAGCTTCTTCTGATTGGTCAAATCAAGGATACAACAGCCTATAGC  1146

seq1  TGGGCAAGAGAGAAAAACATGAGAATTC  1161
      ||||||||||||||||||||||||||||
seq2  TGGGCAAGAGAGAAAAACATGAGAATTC  1174

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information