MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-248H21
Chromosome	5 (Build37)
Map Location	135,100,235 - 135,180,072
singlet/doublet	doublet
Overlap gene	Eif4h, LOC638081, Limk1, Eln
Upstream gene	LOC666038, LOC100039750, Gats, Wbscr16, Gtf2ird2, Ncf1, Gtf2i, LOC630424, Gtf2ird1, LOC100039820, Clip2, EG666071, Gm52, Rfc2, Lat2
Downstream gene	Wbscr28, Cldn13, Wbscr27, Cldn4, Cldn3, Abhd11, Stx1a, Wbscr22, Wbscr18, Vps37d, Mlxipl, Tbl2, Bcl7b, LOC100040069, Baz1b, Fzd9, Fkbp6, Trim50, Nsun5, Pom121, Hip1, Ccl26l, Ccl24, Rhbdd2, Por
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666038 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs

name	LOC100039750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Gats (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80909 MGI:1933384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94254 MGI:2137600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf2ird2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114674 MGI:2149780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17969 MGI:97283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14886 MGI:1202722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	LOC630424 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf2ird1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57080 MGI:1861942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 10 mRNAs

name	LOC100039820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 361 ESTs, 2 Proteins

name	Clip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269713 MGI:1313136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666071 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666071 MGI:3645431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gm52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214292 MGI:2684898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19718 MGI:1341868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56743 MGI:1926479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eif4h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22384 MGI:1341822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Limk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16885 MGI:104572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13717 MGI:95317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cldn13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57255 MGI:1913102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79565 MGI:1933146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12740 MGI:1313314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12739 MGI:1329044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68758 MGI:1916008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20907 MGI:109355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66138 MGI:1913388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbscr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66114 MGI:1913364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps37d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194309 MGI:2159402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlxipl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58805 MGI:1927999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27368 MGI:1351652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12054 MGI:1332238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 102 ESTs

name	Baz1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22385 MGI:1353499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fzd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14371 MGI:1313278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 48 Proteins

name	Fkbp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94244 MGI:2137612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215061 MGI:2664992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsun5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100609 MGI:2140844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pom121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107939 MGI:2137624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215114 MGI:1099804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl26l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:541307 MGI:3589281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56221 MGI:1928953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215160 MGI:1915612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Por (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18984 MGI:97744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666038 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254617 GeneID:666038
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 30 ESTs product : similar to Solute carrier family 35, member E3 transcript_id : XM_001475033.1

name	Gats (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301482 GeneID:80909 MGI:1933384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opposite strand transcription unit to Stag3 transcript_id : NM_030719.3

name	Wbscr16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809009 GeneID:94254 MGI:2137600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 16 homolog (human) transcript_id : NM_033572.1

name	Gtf2ird2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716602 GeneID:114674 MGI:2149780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTF2I repeat domain containing 2 transcript_id : NM_053266.1

name	Ncf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254579 GeneID:17969 MGI:97283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neutrophil cytosolic factor 1 transcript_id : NM_010876.2

name	Gtf2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001569 GeneID:14886 MGI:1202722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I transcript_id : NM_001080748.1

name	Gtf2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001577 GeneID:14886 MGI:1202722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I transcript_id : NM_001080749.1

name	Gtf2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001571 GeneID:14886 MGI:1202722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I transcript_id : NM_010365.2

name	Gtf2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001575 GeneID:14886 MGI:1202722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I transcript_id : NM_001080747.1

name	Gtf2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001573 GeneID:14886 MGI:1202722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I transcript_id : NM_001080746.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625338 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081466.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625342 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081468.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625346 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081470.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625334 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081464.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625344 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081469.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625328 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_020331.2

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625336 GeneID:57080 MGI:1861942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081465.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625332 GeneID:57080 MGI:1861942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081463.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625340 GeneID:57080 MGI:1861942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081467.1

name	Gtf2ird1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625330 GeneID:57080 MGI:1861942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II I repeat domain-containing 1 transcript_id : NM_001081462.1

name	LOC100039820 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254611 GeneID:100039820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 361 ESTs, 2 Proteins product : similar to ribosomal protein S28 transcript_id : XM_001474089.1

name	Clip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662405 GeneID:269713 MGI:1313136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAP-GLY domain containing linker protein 2 transcript_id : NM_001039162.1

name	Clip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662409 GeneID:269713 MGI:1313136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAP-GLY domain containing linker protein 2 transcript_id : NM_009990.2

name	EG666071 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254619 GeneID:666071 MGI:3645431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666071 transcript_id : XM_981349.2

name	Gm52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701451 GeneID:214292 MGI:2684898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 52, (NCBI) transcript_id : NM_001013751.1

name	Rfc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50263039 GeneID:19718 MGI:1341868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication factor C (activator 1) 2 transcript_id : NM_020022.2

name	Lat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061471 GeneID:56743 MGI:1926479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : linker for activation of T cells family, member 2 transcript_id : NM_022964.3

name	Lat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061475 GeneID:56743 MGI:1926479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : linker for activation of T cells family, member 2 transcript_id : NM_020044.2

name	Eif4h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15808987 GeneID:22384 MGI:1341822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4H transcript_id : NM_033561.1

name	LOC638081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375688 GeneID:638081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical LOC638081 transcript_id : XM_978099.1

name	Limk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485824 GeneID:16885 MGI:104572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM-domain containing, protein kinase transcript_id : NM_010717.2

name	Eln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803194 GeneID:13717 MGI:95317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastin transcript_id : NM_007925.3

name	Wbscr28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352481 GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 28 (human) transcript_id : NM_194065.2

name	Wbscr28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369449 GeneID:76629 MGI:1923879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 28 (human) transcript_id : NM_029681.2

name	Cldn13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385852 GeneID:57255 MGI:1913102
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 13 transcript_id : NM_020504.3

name	Wbscr27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355998 GeneID:79565 MGI:1933146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams Beuren syndrome chromosome region 27 (human) transcript_id : NM_024479.2

name	Cldn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753439 GeneID:12740 MGI:1313314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 4 transcript_id : NM_009903.1

name	Cldn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802289 GeneID:12739 MGI:1329044
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 3 transcript_id : NM_009902.3

name	Abhd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644576 GeneID:68758 MGI:1916008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 11 transcript_id : NM_145215.1

name	Stx1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131152 GeneID:20907 MGI:109355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 1A (brain) transcript_id : NM_016801.3

name	Wbscr22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988404 GeneID:66138 MGI:1913388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams Beuren syndrome chromosome region 22 transcript_id : NM_025375.2

name	Wbscr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988406 GeneID:66114 MGI:1913364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Williams-Beuren syndrome chromosome region 18 homolog (human) transcript_id : NM_025362.3

name	Vps37d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362978 GeneID:194309 MGI:2159402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37D (yeast) transcript_id : NM_177574.2

name	Mlxipl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472008 GeneID:58805 MGI:1927999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MLX interacting protein-like transcript_id : NM_021455.3

name	Tbl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543844 GeneID:27368 MGI:1351652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 2 transcript_id : NM_013763.2

name	Bcl7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753173 GeneID:12054 MGI:1332238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 7B transcript_id : NM_009745.1

name	LOC100040069 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254613 GeneID:100040069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 102 ESTs product : hypothetical protein LOC100040069 transcript_id : XM_001474834.1

name	Baz1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755992 GeneID:22385 MGI:1353499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain adjacent to zinc finger domain, 1B transcript_id : NM_011714.1

name	Fzd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375704 GeneID:14371 MGI:1313278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 48 Proteins product : frizzled homolog 9 (Drosophila) transcript_id : XM_284144.5

name	Fkbp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892617 GeneID:94244 MGI:2137612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 6 transcript_id : NM_033571.2

name	Trim50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130549 GeneID:215061 MGI:2664992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 50 transcript_id : NM_178240.2

name	Nsun5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703825 GeneID:100609 MGI:2140844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOL1/NOP2/Sun domain family, member 5 transcript_id : NM_145414.1

name	Pom121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507336 GeneID:107939 MGI:2137624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear pore membrane protein 121 transcript_id : NM_148932.1

name	Hip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122460 GeneID:215114 MGI:1099804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : huntingtin interacting protein 1 transcript_id : NM_146001.1

name	Ccl26l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374165 GeneID:541307 MGI:3589281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 26-like transcript_id : NM_001013412.2

name	Ccl24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351670 GeneID:56221 MGI:1928953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 24 transcript_id : NM_019577.4

name	Rhbdd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872209 GeneID:215160 MGI:1915612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid domain containing 2 transcript_id : NM_146002.2

name	Por (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679420 GeneID:18984 MGI:97744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : P450 (cytochrome) oxidoreductase transcript_id : NM_008898.1

name	LOC666038 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254618 GeneID:666038
definition	codon_start : 1 product : similar to Solute carrier family 35, member E3 protein_id : XP_001475083.1

name	Gats (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674263 CCDS:CCDS19717.1 GeneID:80909 MGI:1933384
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : opposite strand transcription unit to Stag3 protein_id : NP_109644.2

name	Wbscr16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809010 CCDS:CCDS19718.1 GeneID:94254 MGI:2137600
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence NAS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : RCC1-like G exchanging factor-like protein product : Williams-Beuren syndrome chromosome region 16 homolog protein_id : NP_291050.1

name	Gtf2ird2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716603 CCDS:CCDS19719.1 GeneID:114674 MGI:2149780
definition	codon_start : 1 product : gtf2ird2 protein_id : NP_444496.1

name	Ncf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254580 GeneID:17969 MGI:97283
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence TAS] [Evidence ISS] GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016175 - superoxide-generating NADPH oxidase activity [Evidence IDA] [Evidence ISS] [Evidence IMP] GO_process : GO:0008283 - cell proliferation [Evidence IMP]; GO:0006968 - cellular defense response [Evidence IMP]; GO:0006118 - electron transport [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IMP]; GO:0006742 - NADP catabolism [Evidence ISS]; GO:0009617 - response to bacterium [Evidence IMP] codon_start : 1 exception : mismatches in translation note : NADPH oxidase subunit (47 kD); NADPH oxidase subunit (47kDa) product : neutrophil cytosolic factor 1 protein_id : NP_035006.2

name	Gtf2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001570 GeneID:14886 MGI:1202722
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; Bruton tyrosine kinase-associated protein 135; BTK-associated protein 135 product : general transcription factor II I isoform 4 protein_id : NP_001074217.1

name	Gtf2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001578 GeneID:14886 MGI:1202722
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; Bruton tyrosine kinase-associated protein 135; BTK-associated protein 135 product : general transcription factor II I isoform 5 protein_id : NP_001074218.1

name	Gtf2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001572 GeneID:14886 MGI:1202722
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Bruton tyrosine kinase-associated protein 135; BTK-associated protein 135 product : general transcription factor II I isoform 2 protein_id : NP_034495.2

name	Gtf2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001576 GeneID:14886 MGI:1202722
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; Bruton tyrosine kinase-associated protein 135; BTK-associated protein 135 product : general transcription factor II I isoform 3 protein_id : NP_001074216.1

name	Gtf2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001574 GeneID:14886 MGI:1202722
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Bruton tyrosine kinase-associated protein 135; BTK-associated protein 135 product : general transcription factor II I isoform 1 protein_id : NP_001074215.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625339 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform e is encoded by transcript variant 6; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform e protein_id : NP_001074935.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625343 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform g is encoded by transcript variant 8; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform g protein_id : NP_001074937.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625347 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform i is encoded by transcript variant 10; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform i protein_id : NP_001074939.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625335 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 4; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform d protein_id : NP_001074933.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625337 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 5; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform d protein_id : NP_001074934.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625345 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform h is encoded by transcript variant 9; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform h protein_id : NP_001074938.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625329 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform a protein_id : NP_065064.2

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625333 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform c protein_id : NP_001074932.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625341 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform f is encoded by transcript variant 7; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform f protein_id : NP_001074936.1

name	Gtf2ird1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625331 GeneID:57080 MGI:1861942
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; general transcription factor 3; binding factor for early enhancer; Williams-Beuren syndrome chromosome region 11; muscle TFII-I repeat domain-containing protein 1; general transcription factor II I -like; GTF2I repeat domain-containing 1; transcription factor GTF3 alpha 2; transcription factor GTF3 gamma 2 product : general transcription factor II I repeat domain-containing 1 isoform b protein_id : NP_001074931.1

name	LOC100039820 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254612 GeneID:100039820
definition	codon_start : 1 product : similar to ribosomal protein S28 protein_id : XP_001474139.1

name	Clip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662406 GeneID:269713 MGI:1313136
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2; cytoplasmic linker protein 1, 115 kDa; cytoplasmic linker 2 product : cytoplasmic linker 2 isoform b protein_id : NP_001034251.1

name	Clip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662410 GeneID:269713 MGI:1313136
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1; cytoplasmic linker protein 1, 115 kDa; cytoplasmic linker 2 product : cytoplasmic linker 2 isoform a protein_id : NP_034120.2

name	EG666071 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254620 GeneID:666071 MGI:3645431
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986443.2

name	Gm52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701452 CCDS:CCDS19721.1 GeneID:214292 MGI:2684898
definition	codon_start : 1 product : envelope glycoprotein syncytin-A protein_id : NP_001013773.1

name	Rfc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11177922 CCDS:CCDS19722.1 GeneID:19718 MGI:1341868
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 note : replication factor C, 40 kDa product : replication factor C (activator 1) 2 protein_id : NP_064406.1

name	Lat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45496830 GeneID:56743 MGI:1926479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0043303 - mast cell degranulation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Williams-Beuren syndrome chromosome region 5 homolog; Williams-Beuren syndrome chromosome region 15 homolog product : linker for activation of T cells family, member 2 isoform b protein_id : NP_075253.2

name	Lat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910604 GeneID:56743 MGI:1926479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0043303 - mast cell degranulation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Williams-Beuren syndrome chromosome region 5 homolog; Williams-Beuren syndrome chromosome region 15 homolog product : linker for activation of T cells family, member 2 isoform a protein_id : NP_064428.1

name	Eif4h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15808988 CCDS:CCDS19723.1 GeneID:22384 MGI:1341822
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : Williams-Beuren syndrome chromosome region 1 homolog protein_id : NP_291039.1

name	LOC638081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375689 GeneID:638081
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983193.1

name	Limk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754548 CCDS:CCDS19724.1 GeneID:16885 MGI:104572
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045773 - positive regulation of axon extension [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : LIM-domain containing, protein kinase protein_id : NP_034847.1

name	Eln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542606 CCDS:CCDS19725.1 GeneID:13717 MGI:95317
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0030833 - regulation of actin filament polymerization [Evidence IMP]; GO:0043149 - stress fiber formation [Evidence IMP]; GO:0007519 - striated muscle development [Evidence IMP] codon_start : 1 note : tropoelastin product : elastin protein_id : NP_031951.2

name	Wbscr28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732713 GeneID:76629 MGI:1923879
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; Williams-Beuren syndrome critical region 28 product : hypothetical protein LOC76629 isoform a protein_id : NP_919041.1

name	Wbscr28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732715 GeneID:76629 MGI:1923879
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; Williams-Beuren syndrome critical region 28 product : hypothetical protein LOC76629 isoform b protein_id : NP_083957.1

name	Cldn13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048432 GeneID:57255 MGI:1913102
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : claudin-13 product : claudin 13 protein_id : NP_065250.1

name	Wbscr27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355999 CCDS:CCDS19727.1 GeneID:79565 MGI:1933146
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : Williams-Beuren syndrome chromosome region 27 homolog product : Williams-Beuren syndrome critical region protein 27 protein_id : NP_077799.2

name	Cldn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753440 CCDS:CCDS19728.1 GeneID:12740 MGI:1313314
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 4 protein_id : NP_034033.1

name	Cldn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753438 CCDS:CCDS19729.1 GeneID:12739 MGI:1329044
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence IDA] codon_start : 1 product : claudin 3 protein_id : NP_034032.1

name	Abhd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644577 CCDS:CCDS19730.1 GeneID:68758 MGI:1916008
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 note : Williams-Beuren syndrome critical region 21; Williams Beuren syndrome chromosome region 21 product : abhydrolase domain containing 11 protein_id : NP_660250.1

name	Stx1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011853 CCDS:CCDS19731.1 GeneID:20907 MGI:109355
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0000149 - SNARE binding [Evidence IDA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin 1 a product : syntaxin 1A (brain) protein_id : NP_058081.2

name	Wbscr22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988405 CCDS:CCDS19732.1 GeneID:66138 MGI:1913388
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : Williams-Beuren syndrome critical region protein 22 protein_id : NP_079651.2

name	Wbscr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644569 GeneID:66114 MGI:1913364
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : Williams-Beuren syndrome critical region 18 protein_id : NP_079638.2

name	Vps37d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243920 CCDS:CCDS19733.1 GeneID:194309 MGI:2159402
definition	codon_start : 1 note : Williams-Beuren syndrome critical region protein 24; Williams-Beuren syndrome chromosome region 24 homolog product : vacuolar protein sorting 37D protein_id : NP_808242.1

name	Mlxipl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328263 GeneID:58805 MGI:1927999
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : putative hepatic transcription factor; Williams-Beuren syndrome chromosome region 14 homolog product : WBSCR14 protein protein_id : NP_067430.2

name	Tbl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543845 CCDS:CCDS19735.1 GeneID:27368 MGI:1351652
definition	codon_start : 1 product : transducin (beta)-like 2 protein_id : NP_038791.2

name	Bcl7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753174 GeneID:12054 MGI:1332238
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B-cell CLL/lymphoma 7B protein_id : NP_033875.1

name	LOC100040069 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254614 GeneID:100040069
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474884.1

name	Baz1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755993 CCDS:CCDS19736.1 GeneID:22385 MGI:1353499
definition	GO_component : GO:0005721 - centric heterochromatin [Evidence IDA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IDA]; GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Williams-Beuren syndrome chromosome region 9 homolog product : bromodomain adjacent to zinc finger domain, 1B protein_id : NP_035844.1

name	Fzd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38081080 GeneID:14371 MGI:1313278
definition	codon_start : 1 product : frizzled 9 protein_id : XP_284144.2

name	Fkbp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809008 CCDS:CCDS19738.1 GeneID:94244 MGI:2137612
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005528 - FK506 binding [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IDA] GO_process : GO:0018208 - peptidyl-proline modification [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506-binding protein 6 (36kD); FK506 binding protein 6 (36kD) product : FK506 binding protein 6 protein_id : NP_291049.1

name	Trim50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142677 CCDS:CCDS19739.1 GeneID:215061 MGI:2664992
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 50 protein_id : NP_839971.1

name	Nsun5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703826 CCDS:CCDS19740.1 GeneID:100609 MGI:2140844
definition	codon_start : 1 exception : mismatches in translation note : Williams-Beuren syndrome critical region protein 20; Williams Beuren syndrome chromosome region 20A homolog product : NOL1R protein protein_id : NP_663389.1

name	Pom121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507337 GeneID:107939 MGI:2137624
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear pore membrane protein 121 protein_id : NP_683734.1

name	Hip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122461 GeneID:215114 MGI:1099804
definition	GO_component : GO:0030136 - clathrin-coated vesicle [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS]; GO:0005543 - phospholipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0006919 - caspase activation [Evidence ISS]; GO:0048268 - clathrin cage assembly [Evidence ISS]; GO:0006897 - endocytosis [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS] codon_start : 1 product : huntingtin interacting protein 1 protein_id : NP_666113.1

name	Ccl26l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374166 CCDS:CCDS19741.1 GeneID:541307 MGI:3589281
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : eotaxin 3-like product : chemokine (C-C motif) ligand 26-like protein_id : NP_001013430.2

name	Ccl24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625035 CCDS:CCDS19742.1 GeneID:56221 MGI:1928953
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : eotaxin-2; CC chemokine CCL24; small inducible cytokine A24 product : chemokine (C-C motif) ligand 24 protein_id : NP_062523.1

name	Rhbdd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122463 CCDS:CCDS19743.1 GeneID:215160 MGI:1915612
definition	codon_start : 1 note : rhomboid, veinlet-like 7; upregulated during skeletal muscle growth 1 product : rhomboid domain containing 2 protein_id : NP_666114.1

name	LOC100039750 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039750
definition	number : 1 pseudo : _no_value

name	LOC630424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630424
definition	number : 1 pseudo : _no_value

name	LOC630424 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630424
definition	number : 2 pseudo : _no_value

clone name	MSMg01-274G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-248H21.b	B6Ng01-248H21.g
ACC	GA056556	GA056557
length	247	1,109
definition	B6Ng01-248H21.b	B6Ng01-248H21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(135,179,826 - 135,180,072)	(135,100,235 - 135,101,351)
sequence	agcaggctgtggcagaagcattggccagcctgaactctataggaaacagt gtcaacaacaaccccaaccagagagagagagagagagagagagagagaga gagagagagagagagagagagaatgaatgagagcgagcaagcaatgagaa tatagctctaggtttcatccctagcatagtataaaaccaagcaaggtggt gtatgcctataatctcaggatggaaggaagggagggagggaggaagg	gaattcaaagcctgtctaggttgaacatcctgagaaacaagggacgaggg aagagtggaatgttaaatactgataccagagttgaagtcatcccgggaat cccatccacctctagattctcgagagccacccattcctgaggatacacac acacaaagagatcaagttgagggctgtgctcattactctgttttcatgac acaagcgtaataatttaacaagagggaaccttgattgagaacctggcctg actaatgtgtcccctgtgagcacatctaagggaacattctcttgagggcc caggaaacagtgtgtaagtaatgccacctgagggcaggcgagcctgggct gtctaaggaagcggactgagcatgtcggccagggagcagcattccccggt cagtgtcctctgcctcagatcctgccttagcctccttccctagatgatgg actgtagctctcttcctcaagatgcctttcctcacacacagcaagagacc cctatctaggacgaggccatgttgttgtctgtgctggacactttcatgtc aacaagtcagagtcacgagaggagggaacctcaactacaaaaatgccccc ataagactgggctatagggcattctcttcattagcaattaatgtggatgg ggccatccctgggctagtggtttgtggttcaatcagaaagcaggctgagc gcaagccatgggaagcaagtcagtaagcagcaccctccatggcctctgca tcagctcctgcctccaggttcctgcccagacgtccttcaatggtgagcag tgcagtgaagtttaagccaaataagccttttcctctgagctgcttgtagt cacggtgtttcatcacaatagaaaccccaagtcacttcagaacaggacaa aacccaagctctcaggaccaatgctcagtaaatgatgcacaggggtggca agcagtgtgcacacagcaagttccgttcagtgttagaacaagctaatcac ctctgtcatcagtccaccttttcctgaatcaagcactttatcttgtttct gcctctgccatgtccacacgagtgacccggttcacccagagctgagacca gtaaaagac
quality values	Open. Hide. 30 54 62 62 62 62 62 62 62 62 54 47 56 56 62 62 62 62 62 59 59 62 62 59 62 59 43 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 42 54 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 49 59 62 62 62 59 59 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 59 59 59 59 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 50 56 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 59 59 59 62 62 59 59 59 56 45 62 59 59 62 62 62 62 56 62 43 56 44 62 56 56 56 56 56 37 43 56 56 62 51 62 56 38 10 9	Open. Hide. 46 35 31 47 62 47 33 62 62 62 46 56 56 49 25 46 47 44 56 62 56 62 62 59 62 62 62 62 62 62 62 62 59 59 49 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 54 54 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 49 41 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 54 58 58 54 54 49 58 58 58 58 58 43 58 58 54 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 54 41 47 41 58 58 58 58 58 58 52 58 58 58 50 58 58 41 58 58 58 52 54 58 58 54 58 58 58 58 51 49 58 58 54 58 58 58 58 58 58 40 52 51 58 58 58 53 53 51 58 58 52 50 58 51 52 58 58 58 52 53 42 58 37 58 54 47 39 51 58 41 49 41 58 51 24 58 58 51 48 28 58 58 53 50 44 51 51 49 54 50 49 58 58 41 53 58 50 44 43 41 44 32 51 50 50 50 51 29 51 58 58 58 51 51 50 50 52 53 54 54 32 45 41 54 45 54 49 54 41 52 45 53 52 50 39 53 54 50 38 51 51 49 38 54 40 54 52 35 33 54 25 30 28 37 50 32 52 41 32 32 35 51 54 54 42 37 45 31 31 54 35 21 54 46 54 37 54 53 37 41 33 20 51 45 43 37 29 51 54 52 42 39 31 6 25 30 45 41 33 13 40 41 52 42 41 32 32 32 31 32 47 49 51 52 37 31 34 40 38 34 34 37 35 32 40 43 53 31 52 45 31 45 34 26 47 53 37 31 32 32 33 42 51 23 46 33 31 34 45 30 31 32 31 32 23 41 35 31 41 29 42 30 33 31 31 33 33 22 45 29 45 36 43 25 43 31 46 31 31 30 27 24 29 31 30 43 38 36 34 25 30 29 31 43 30 37 41 31 36 31 21 28 42 32 34 19 20 31 31 37 26 33 48 22 19 37 23 31 32 22 46 28 30 36 29 17 26 31 36 48 48 39 21 32 29 27 25 24 31 18 31 29 31 25 29 32 30 19 31 21 31 31 16 16 18 32 24 31 18 47 31 32 32 31 31 31 31 23 30 28 32 31 38 36 18 29 38 36 38 18 22 31 32 27 29 31 27 32 20 31 25 31 11 11 16 6 36 22 23 13 41 36 30 9 33 25 23 25 32 31 32 21 21 14 4 4 16 13 10 14 13 14 20 31 20 19 32 32 24 21 27 48 32 27 30 23 21 23 16 12 19 11 26 48 39 22 21 30 32 18 19 20 27 21 27 15 24 32 16 28 24 16 19 10 14 11 19 28 22 17 25 10 24 18 27 19 21 15 13 13 7 6 8 5 10 10 3 15 13 7 7 5 6 19 22 15 9 12 11 8 14 15 28 10 9 14 7 27 9 12 20 7 16 6 27 27 16 14 19 14 34 28 10 15 15 5 11 13 11 11 4 4 3 6 24 6 3 2 26 20 15 14 15 13 17 21 7 17 10 3 10 21 7 9 3 3 9 23 6 5 22 5 11 5 22 7 5 5 7 17 10 18 6 4 7 6 8 14 7 12 17 6 8 11 5 4 11 12 3 2 6 4 11 6 6 9 8 2 5 4 5 5 1 3 27 28 7 21 4 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_135179826_135180072
seq2: B6Ng01-248H21.b_54_300 (reverse)

seq1  CCTTCCTCCCTCCCTCCCTTCCTTCCATCCTGAGATTATAGGCATACACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCTCCCTCCCTCCCTTCCTTCCATCCTGAGATTATAGGCATACACC  50

seq1  ACCTTGCTTGGTTTTATACTATGCTAGGGATGAAACCTAGAGCTATATTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGCTTGGTTTTATACTATGCTAGGGATGAAACCTAGAGCTATATTC  100

seq1  TCATTGCTTGCTCGCTCTCATTCATTCTCTCTCTCTCTCTCTCTCTCTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGCTTGCTCGCTCTCATTCATTCTCTCTCTCTCTCTCTCTCTCTCT  150

seq1  CTCTCTCTCTCTCTCTCTCTCTCTCTCTGGTTGGGGTTGTTGTTGACACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTCTCTCTCTCTCTCTCTCTCTCTGGTTGGGGTTGTTGTTGACACT  200

seq1  GTTTCCTATAGAGTTCAGGCTGGCCAATGCTTCTGCCACAGCCTGCT  247
      |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCTATAGAGTTCAGGCTGGCCAATGCTTCTGCCACAGCCTGCT  247

seq1: chr5_135100235_135101351
seq2: B6Ng01-248H21.g_63_1171

seq1  GAATTCAAAGCCTGTCTAGGTTGAACATCCTGAGAAACAAGGGACGAGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAGCCTGTCTAGGTTGAACATCCTGAGAAACAAGGGACGAGGG  50

seq1  AAGAGTGGAATGTTAAATACTGATACCAGAGTTGAAGTCATCCCGGGAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGTGGAATGTTAAATACTGATACCAGAGTTGAAGTCATCCCGGGAAT  100

seq1  CCCATCCACCTCTAGATTCTCGAGAGCCACCCATTCCTGAGGATACACAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATCCACCTCTAGATTCTCGAGAGCCACCCATTCCTGAGGATACACAC  150

seq1  ACACAAAGAGATCAAGTTGAGGGCTGTGCTCATTACTCTGTTTTCATGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAAAGAGATCAAGTTGAGGGCTGTGCTCATTACTCTGTTTTCATGAC  200

seq1  ACAAGCGTAATAATTTAACAAGAGGGAACCTTGATTGAGAACCTGGCCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGCGTAATAATTTAACAAGAGGGAACCTTGATTGAGAACCTGGCCTG  250

seq1  ACTAATGTGTCCCCTGTGAGCACATCTAAGGGAACATTCTCTTGAGGGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAATGTGTCCCCTGTGAGCACATCTAAGGGAACATTCTCTTGAGGGCC  300

seq1  CAGGAAACAGTGTGTAAGTAATGCCACCTGAGGGCAGGCGAGCCTGGGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAACAGTGTGTAAGTAATGCCACCTGAGGGCAGGCGAGCCTGGGCT  350

seq1  GTCTAAGGAAGCGGACTGAGCATGTCGGCCAGGGAGCAGCATTCCCCGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTAAGGAAGCGGACTGAGCATGTCGGCCAGGGAGCAGCATTCCCCGGT  400

seq1  CAGTGTCCTCTGCCTCAGATCCTGCCTTAGCCTCCTTCCCTAGATGATGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTCCTCTGCCTCAGATCCTGCCTTAGCCTCCTTCCCTAGATGATGG  450

seq1  ACTGTAGCTCTCTTCCTCAAGATGCCTTTCCTCACACACAGCAAGAGACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTAGCTCTCTTCCTCAAGATGCCTTTCCTCACACACAGCAAGAGACC  500

seq1  CCTATCTAGGACGAGGCCATGTTGTTGTCTGTGCTGGACACTTTCATGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATCTAGGACGAGGCCATGTTGTTGTCTGTGCTGGACACTTTCATGTC  550

seq1  AACAAGTCAGAGTCACGAGAGGAGGGAACCTCAACTACAAAAATGCCCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAGTCAGAGTCACGAGAGGAGGGAACCTCAACTACAAAAATGCCCCC  600

seq1  ATAAGACTGGGCTATAGGGCATTCTCTTCATTAGCAATTAATGTGGATGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGACTGGGCTATAGGGCATTCTCTTCATTAGCAATTAATGTGGATGG  650

seq1  GGCCATCCCTGGGCTAGTGGTTTGTGGTTCAATCAGAAAGCAGGCTGAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCATCCCTGGGCTAGTGGTTTGTGGTTCAATCAGAAAGCAGGCTGAGC  700

seq1  GCAAGCCATGGGAAGCAAGTCAGTAAGCAGCACCCTCCATGGCCTCTGCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCCATGGGAAGCAAGTCAGTAAGCAGCACCCTCCATGGCCTCTGCA  750

seq1  TCAGCTCCTGCCTCCAGGTTCCTGCCCAGACGTCCTTCAATGGTGAGCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTCCTGCCTCCAGGTTCCTGCCCAGACGTCCTTCAATGGTGAGCAG  800

seq1  TGCAGTGAAGTTTAAGCCAAATAAGCCTTTTCCTCTGAGCTGCTTGTAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGTGAAGTTTAAGCCAAATAAGCCTTTTCCTCTGAGCTGCTTGTAGT  850

seq1  CACGGTGTTTCATCACAATAGAAACCCCAAGTCACTTCAGAAACAGGACA  900
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  CACGGTGTTTCATCACAATAGAAACCCCAAGTCACTTCAG-AACAGGACA  899

seq1  AAACCCAAGCTCTCAGGGACCAATGCTCAGTAAATGATGCACAGGGGTGG  950
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  AAACCCAAGCTCTCA-GGACCAATGCTCAGTAAATGATGCACAGGGGTGG  948

seq1  CAAGCAGTGTGCACACAGCAAGTTCCGTTCAGTGTTAAGAC-AGCTAATC  999
      |||||||||||||||||||||||||||||||||||||  || ||||||||
seq2  CAAGCAGTGTGCACACAGCAAGTTCCGTTCAGTGTTAGAACAAGCTAATC  998

seq1  ACCTCTGTCATCAGGTCCACC-TTTCCTGAATCCAAAGCCACCTTTATCT  1048
      ||||||||||||| ||||||| |||||||||||  ||||   ||||||||
seq2  ACCTCTGTCATCA-GTCCACCTTTTCCTGAATC--AAGC--ACTTTATCT  1043

seq1  TGTTTTCTGCCTTCTGCAATGTCCACACGAAGTGACC--GGTCACCCAAG  1096
      || |||||||| ||||| ||||||||||| |||||||  | |||||| ||
seq2  TG-TTTCTGCC-TCTGCCATGTCCACACG-AGTGACCCGGTTCACCC-AG  1089

seq1  AGCTGAGGACAAGGAAAAGAC  1117
      |||||| ||| || |||||||
seq2  AGCTGA-GACCAGTAAAAGAC  1109

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information