MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-262B03
Chromosome	5 (Build37)
Map Location	116,060,240 - 116,186,246
singlet/doublet	doublet
Overlap gene	Gcn1l1, LOC100042199, Rab35, Ccdc64
Upstream gene	BC057022, Trpv4, Gltp, Tchp, Git2, 4930515G01Rik, Ankrd13a, 1500011B03Rik, 2610524H06Rik, LOC664895, 4930519G04Rik, Oasl2, Oasl1, 2210016L21Rik, Tcf1, Sppl3, Acads, AA407659, 2410014A08Rik, Cabp1, Pop5, Rnf10, Coq5, Dynll1, Sfrs9, 2010003O18Rik, Triap1, Cox6a1, Msi1, Pla2g1b, Sirt4, LOC638021, Pxn, Arbp
Downstream gene	LOC665032, Cit, Prkab1, LOC545798, Ccdc60, 4930562A09Rik, Hspb8, 1500001A10Rik, LOC433943, Gm1684
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC057022 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433940 MGI:3605543
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63873 MGI:1926945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gltp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56356 MGI:1929253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tchp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77832 MGI:1925082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Git2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	4930515G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68420 MGI:1915670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500011B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66236 MGI:1913486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 111 ESTs

name	2610524H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330173 MGI:2447819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 194 ESTs, 7 Proteins pseudo : _no_value

name	4930519G04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67593 MGI:1914843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oasl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23962 MGI:1344390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oasl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231655 MGI:2180849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210016L21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72357 MGI:1919607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21405 MGI:98504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sppl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74585 MGI:1891433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acads (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11409 MGI:87868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA407659 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106840 MGI:2147162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410014A08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109154 MGI:1924015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29867 MGI:1352750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pop5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117109 MGI:2151221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50849 MGI:1859162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coq5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52064 MGI:1098643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dynll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56455 MGI:1861457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108014 MGI:104896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010003O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384281 MGI:1923776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Triap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69076 MGI:1916326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12861 MGI:103099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17690 MGI:107376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18778 MGI:101842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75387 MGI:1922637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs, 7 Proteins

name	LOC638021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Pxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Arbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11837 MGI:88066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcn1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231659 MGI:2444248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs

name	Rab35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77407 MGI:1924657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75665 MGI:1922915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 961 ESTs, 5 Proteins

name	Cit (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12704 MGI:105313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19079 MGI:1336167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ccdc60 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269693 MGI:2141043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930562A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75303 MGI:1922553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	Hspb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80888 MGI:2135756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500001A10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68955 MGI:1916205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 20 Proteins pseudo : _no_value

name	Gm1684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381709 MGI:2686530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	BC057022 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921354 GeneID:433940 MGI:3605543
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057022 transcript_id : NM_001004180.1

name	Trpv4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11528501 GeneID:63873 MGI:1926945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 4 transcript_id : NM_022017.1

name	Gltp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560403 GeneID:56356 MGI:1929253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycolipid transfer protein transcript_id : NM_019821.2

name	Tchp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794203 GeneID:77832 MGI:1925082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trichoplein, keratin filament binding transcript_id : NM_029992.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517289 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077359.1

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517296 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_019834.3

name	Git2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517294 GeneID:26431 MGI:1347053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 2 transcript_id : NM_001077360.1

name	Ankrd13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651674 GeneID:68420 MGI:1915670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13a transcript_id : NM_026718.2

name	1500011B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254567 GeneID:66236 MGI:1913486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 109 ESTs product : RIKEN cDNA 1500011B03 gene, transcript variant 2 transcript_id : XM_001478612.1

name	2610524H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624788 GeneID:330173 MGI:2447819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610524H06 gene transcript_id : NM_181075.3

name	4930519G04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286836 GeneID:67593 MGI:1914843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519G04 gene transcript_id : NM_026263.2

name	Oasl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053897 GeneID:23962 MGI:1344390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase-like 2 transcript_id : NM_011854.2

name	Oasl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381213 GeneID:231655 MGI:2180849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2'-5' oligoadenylate synthetase-like 1 transcript_id : NM_145209.3

name	2210016L21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930440 GeneID:72357 MGI:1919607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210016L21 gene transcript_id : NM_028211.1

name	Tcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364916 GeneID:21405 MGI:98504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 1 transcript_id : NM_009327.2

name	Sppl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62530193 GeneID:74585 MGI:1891433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal peptide peptidase 3 transcript_id : NM_029012.2

name	Acads (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982521 GeneID:11409 MGI:87868
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase, short chain transcript_id : NM_007383.2

name	AA407659 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384032 GeneID:106840 MGI:2147162
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA407659 transcript_id : NM_175352.3

name	2410014A08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341805 GeneID:109154 MGI:1924015
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410014A08 gene transcript_id : NM_175403.2

name	Cabp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948853 GeneID:29867 MGI:1352750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 1 transcript_id : NM_013879.2

name	Pop5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347939 GeneID:117109 MGI:2151221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae) transcript_id : NM_026398.3

name	Rnf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710089 GeneID:50849 MGI:1859162
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 10 transcript_id : NM_016698.1

name	Coq5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378282 GeneID:52064 MGI:1098643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q5 homolog, methyltransferase (yeast) transcript_id : NM_026504.2

name	Dynll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358000 GeneID:56455 MGI:1861457
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain LC8-type 1 transcript_id : NM_019682.3

name	Sfrs9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130304 GeneID:108014 MGI:104896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine rich 9 transcript_id : NM_025573.3

name	2010003O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388151 GeneID:384281 MGI:1923776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010003O18 gene transcript_id : NM_029645.3

name	Triap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344163 GeneID:69076 MGI:1916326
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TP53 regulated inhibitor of apoptosis 1 transcript_id : NM_026933.2

name	Cox6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131168 GeneID:12861 MGI:103099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VI a, polypeptide 1 transcript_id : NM_007748.3

name	Msi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678939 GeneID:17690 MGI:107376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Musashi homolog 1(Drosophila) transcript_id : NM_008629.1

name	Pla2g1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755089 GeneID:18778 MGI:101842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IB, pancreas transcript_id : NM_011107.1

name	Sirt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254537 GeneID:75387 MGI:1922637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 59 ESTs, 7 Proteins product : sirtuin 4 (silent mating type information regulation 2 homolog) 4 (S. cerevisiae) transcript_id : XM_485674.5

name	Pxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326501 GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paxillin transcript_id : NM_133915.2

name	Pxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326500 GeneID:19303 MGI:108295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paxillin transcript_id : NM_011223.2

name	Arbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372948 GeneID:11837 MGI:88066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acidic ribosomal phosphoprotein P0 transcript_id : NM_007475.3

name	Gcn1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807185 GeneID:231659 MGI:2444248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN1 general control of amino-acid synthesis 1-like 1 (yeast) transcript_id : NM_172719.2

name	LOC100042199 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254569 GeneID:100042199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs product : hypothetical protein LOC100042199 transcript_id : XM_001478983.1

name	Rab35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718982 GeneID:77407 MGI:1924657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB35, member RAS oncogene family transcript_id : NM_198163.1

name	Ccdc64 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248513 GeneID:75665 MGI:1922915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 64 transcript_id : NM_001080808.1

name	LOC665032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375577 GeneID:665032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 960 ESTs, 5 Proteins product : similar to ribosomal protein transcript_id : XM_974069.1

name	Cit (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487318 GeneID:12704 MGI:105313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : citron transcript_id : NM_007708.3

name	Prkab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130748 GeneID:19079 MGI:1336167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, beta 1 non-catalytic subunit transcript_id : NM_031869.2

name	LOC545798 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375579 GeneID:545798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to MGC79481 protein transcript_id : XM_620250.3

name	Ccdc60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802445 GeneID:269693 MGI:2141043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 60 transcript_id : NM_177759.3

name	Hspb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892223 GeneID:80888 MGI:2135756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 8 transcript_id : NM_030704.2

name	1500001A10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215551 GeneID:68955 MGI:1916205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500001A10 gene transcript_id : NM_026886.3

name	Gm1684 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254539 GeneID:381709 MGI:2686530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 1684, (NCBI) transcript_id : XM_001472646.1

name	BC057022 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921355 CCDS:CCDS19567.1 GeneID:433940 MGI:3605543
definition	codon_start : 1 product : hypothetical protein LOC433940 protein_id : NP_001004180.1

name	Trpv4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528502 CCDS:CCDS19568.1 GeneID:63873 MGI:1926945
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] [Evidence ISS]; GO:0005034 - osmosensor activity [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0042538 - hyperosmotic salinity response [Evidence IMP]; GO:0007231 - osmosensory signaling pathway [Evidence IMP] [Evidence ISS] [Evidence IDA]; GO:0006884 - regulation of cell volume [Evidence ISS]; GO:0047484 - regulation of response to osmotic stress [Evidence IMP]; GO:0009612 - response to mechanical stimulus [Evidence ISS]; GO:0006970 - response to osmotic stress [Evidence IPI] [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0030103 - vasopressin secretion [Evidence IMP] codon_start : 1 exception : mismatches in translation note : osmosensitive transient receptor potential channel 4 product : transient receptor potential cation channel, subfamily V, member 4 protein_id : NP_071300.1

name	Gltp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560404 CCDS:CCDS19569.1 GeneID:56356 MGI:1929253
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0051861 - glycolipid binding [Evidence ISS]; GO:0017089 - glycolipid transporter activity [Evidence ISS] GO_process : GO:0046836 - glycolipid transport [Evidence ISS]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : glycolipid transfer protein protein_id : NP_062795.2

name	Tchp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794204 GeneID:77832 MGI:1925082
definition	GO_component : GO:0045179 - apical cortex [Evidence ISS]; GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence ISS] codon_start : 1 product : trichoplein, keratin filament binding protein_id : NP_084268.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517297 CCDS:CCDS19570.1 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 1 protein_id : NP_062808.3

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517295 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 3 protein_id : NP_001070828.1

name	Git2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517290 GeneID:26431 MGI:1347053
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ARF GTPase activating protein 2; Cool associated tyrosine phosphorylated-2 product : G protein-coupled receptor kinase-interactor 2 isoform 2 protein_id : NP_001070827.1

name	Ankrd13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651675 CCDS:CCDS19572.1 GeneID:68420 MGI:1915670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 13a protein_id : NP_080994.2

name	1500011B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254568 GeneID:66236 MGI:1913486
definition	codon_start : 1 product : hypothetical protein LOC66236 isoform 2 protein_id : XP_001478662.1

name	2610524H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841010 GeneID:330173 MGI:2447819
definition	codon_start : 1 product : hypothetical protein LOC330173 protein_id : NP_851420.1

name	4930519G04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735437 CCDS:CCDS19574.1 GeneID:67593 MGI:1914843
definition	codon_start : 1 product : hypothetical protein LOC67593 protein_id : NP_080539.1

name	Oasl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053898 GeneID:23962 MGI:1344390
definition	GO_function : GO:0001730 - 2'-5'-oligoadenylate synthetase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : 2'-5' oligoadenylate synthetase-like product : 2'-5' oligoadenylate synthetase-like 2 protein_id : NP_035984.2

name	Oasl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630289 CCDS:CCDS19575.1 GeneID:231655 MGI:2180849
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : 2,5-oligoadenylate synthetase-like 9 product : 2'-5' oligoadenylate synthetase-like 1 protein_id : NP_660210.1

name	2210016L21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930441 CCDS:CCDS19576.1 GeneID:72357 MGI:1919607
definition	codon_start : 1 product : hypothetical protein LOC72357 protein_id : NP_082487.1

name	Tcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678241 CCDS:CCDS19577.1 GeneID:21405 MGI:98504
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0045453 - bone resorption [Evidence IGI]; GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hepatocyte nuclear factor 1 product : transcription factor 1 protein_id : NP_033353.1

name	Sppl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62530194 CCDS:CCDS19578.1 GeneID:74585 MGI:1891433
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008717 - D-alanyl-D-alanine endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : upregulated during skeletal muscle growth 3; presenilin-like protein 4 product : signal peptide peptidase 3 protein_id : NP_083288.2

name	Acads (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982522 CCDS:CCDS19579.1 GeneID:11409 MGI:87868
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0004085 - butyryl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : acetyl-Coenzyme A dehydrogenase, short chain; short-chain acyl-CoA dehydrogenase product : acyl-Coenzyme A dehydrogenase, short chain protein_id : NP_031409.2

name	AA407659 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425054 CCDS:CCDS19580.1 GeneID:106840 MGI:2147162
definition	codon_start : 1 product : hypothetical protein LOC106840 protein_id : NP_780561.1

name	2410014A08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425112 CCDS:CCDS19581.1 GeneID:109154 MGI:1924015
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC109154 protein_id : NP_780612.1

name	Cabp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304939 CCDS:CCDS19582.1 GeneID:29867 MGI:1352750
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 1 protein_id : NP_038907.1

name	Pop5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270200 CCDS:CCDS19583.1 GeneID:117109 MGI:2151221
definition	GO_component : GO:0005655 - nucleolar ribonuclease P complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0000172 - ribonuclease MRP complex [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence IEA]; GO:0000171 - ribonuclease MRP activity [Evidence ISS]; GO:0004526 - ribonuclease P activity [Evidence IDA] GO_process : GO:0006364 - rRNA processing [Evidence ISS]; GO:0008033 - tRNA processing [Evidence IDA] codon_start : 1 note : RNase MRP/RNase P protein-like product : processing of precursor 5, ribonuclease P/MRP family protein_id : NP_080674.1

name	Rnf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710090 CCDS:CCDS19584.1 GeneID:50849 MGI:1859162
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 10 protein_id : NP_057907.1

name	Coq5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385992 CCDS:CCDS19585.1 GeneID:52064 MGI:1098643
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006744 - ubiquinone biosynthesis [Evidence IEA] codon_start : 1 product : coenzyme Q5 homolog, methyltransferase protein_id : NP_080780.1

name	Dynll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981035 GeneID:56455 MGI:1861457
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence TAS]; GO:0045019 - negative regulation of nitric oxide biosynthesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : protein inhibitor of nitric oxide synthase; 8kD LC; 8kDa LC; dynein, cytoplasmic, light chain 1 product : dynein, cytoplasmic, light peptide protein_id : NP_062656.2

name	Sfrs9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385016 CCDS:CCDS19587.1 GeneID:108014 MGI:104896
definition	GO_component : GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA] codon_start : 1 note : splicing factor, arginine/serine rich 9 (25 kDa) product : splicing factor, arginine/serine rich 9 protein_id : NP_079849.1

name	2010003O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059159 CCDS:CCDS19588.1 GeneID:384281 MGI:1923776
definition	GO_function : GO:0017068 - glutamyl-tRNA(Gln) amidotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006450 - regulation of translational fidelity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC384281 protein_id : NP_083921.1

name	Triap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312202 GeneID:69076 MGI:1916326
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0006977 - DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest [Evidence ISS] codon_start : 1 product : p53-inducible cell-survival factor protein_id : NP_081209.1

name	Cox6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680988 CCDS:CCDS19590.1 GeneID:12861 MGI:103099
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : subunit VIaL (liver-type) product : cytochrome c oxidase, subunit VI a, polypeptide 1 protein_id : NP_031774.1

name	Msi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678940 CCDS:CCDS19591.1 GeneID:17690 MGI:107376
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005844 - polysome [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008266 - poly(U) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] codon_start : 1 product : Musashi homolog 1 protein_id : NP_032655.1

name	Pla2g1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755090 CCDS:CCDS19592.1 GeneID:18778 MGI:101842
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IDA]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0009395 - phospholipid catabolism [Evidence TAS]; GO:0006644 - phospholipid metabolism [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 product : phospholipase A2, group IB, pancreas protein_id : NP_035237.1

name	Sirt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254538 GeneID:75387 MGI:1922637
definition	codon_start : 1 product : sirtuin 4 (silent mating type information regulation 2 homolog) 4 protein_id : XP_485674.5

name	Pxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326502 GeneID:19303 MGI:108295
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] [Evidence TAS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048754 - branching morphogenesis of a tube [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS] [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform beta is encoded by transcript variant beta product : paxillin isoform beta protein_id : NP_598676.2

name	Pxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21281693 CCDS:CCDS19593.1 GeneID:19303 MGI:108295
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] [Evidence TAS]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence IDA]; GO:0048754 - branching morphogenesis of a tube [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0006928 - cell motility [Evidence IMP]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0048041 - focal adhesion formation [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence TAS] [Evidence IMP]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform alpha is encoded by transcript variant alpha product : paxillin isoform alpha protein_id : NP_035353.1

name	Arbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671569 CCDS:CCDS19594.1 GeneID:11837 MGI:88066
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0042254 - ribosome biogenesis and assembly [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 product : acidic ribosomal phosphoprotein P0 protein_id : NP_031501.1

name	Gcn1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807186 CCDS:CCDS19595.1 GeneID:231659 MGI:2444248
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : GCN1 general control of amino-acid synthesis 1-like 1 protein_id : NP_766307.2

name	LOC100042199 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254570 GeneID:100042199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479033.1

name	Rab35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718983 CCDS:CCDS19596.1 GeneID:77407 MGI:1924657
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB35, member RAS oncogene family protein_id : NP_937806.1

name	Ccdc64 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248514 GeneID:75665 MGI:1922915
definition	codon_start : 1 product : coiled-coil domain containing 64 protein_id : NP_001074277.1

name	LOC665032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94375578 GeneID:665032
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_979163.1

name	Cit (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487319 CCDS:CCDS19597.1 GeneID:12704 MGI:105313
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IDA] [Evidence IEA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0048699 - generation of neurons [Evidence IMP] [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007091 - mitotic metaphase/anaphase transition [Evidence IMP]; GO:0000070 - mitotic sister chromatid segregation [Evidence IMP]; GO:0050774 - negative regulation of dendrite morphogenesis [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : citron kinase; citron-N product : citron protein_id : NP_031734.3

name	Prkab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956234 CCDS:CCDS19598.1 GeneID:19079 MGI:1336167
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004679 - AMP-activated protein kinase activity [Evidence TAS]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 product : AMP-activated protein kinase beta 1 non-catalytic subunit protein_id : NP_114075.1

name	LOC545798 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63533863 GeneID:545798
definition	codon_start : 1 product : similar to MGC79481 protein protein_id : XP_620250.1

name	Ccdc60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244264 CCDS:CCDS19599.1 GeneID:269693 MGI:2141043
definition	codon_start : 1 product : coiled-coil domain containing 60 protein_id : NP_808427.1

name	Hspb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507646 CCDS:CCDS19600.1 GeneID:80888 MGI:2135756
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : crystallin, alpha C; heat shock 27kDa protein 8 product : heat shock protein 20-like protein protein_id : NP_109629.1

name	1500001A10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794434 CCDS:CCDS19601.1 GeneID:68955 MGI:1916205
definition	codon_start : 1 product : hypothetical protein LOC68955 protein_id : NP_081162.1

name	Gm1684 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254540 GeneID:381709 MGI:2686530
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472696.1

name	LOC638021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638021
definition	number : 1 pseudo : _no_value

name	4930515G01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254529 GeneID:67642 MGI:1914892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930515G01 gene transcript_id : XR_035133.1

name	LOC664895 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254536 GeneID:664895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 194 ESTs, 7 Proteins product : similar to Ywhaq protein pseudo : _no_value transcript_id : XR_030651.1

name	4930562A09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254571 GeneID:75303 MGI:1922553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : RIKEN cDNA 4930562A09 gene transcript_id : XR_035352.1

name	LOC433943 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254572 GeneID:433943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 134 ESTs, 20 Proteins product : similar to Glutathione S-transferase Mu 1 (GST class-mu 1) (Glutathione S-transferase GT8.7) (pmGT10) (GST 1-1) pseudo : _no_value transcript_id : XR_034042.1

clone name	MSMg01-299J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-262B03.b	B6Ng01-262B03.g
ACC	GA066582	GA066583
length	1,004	188
definition	B6Ng01-262B03.b	B6Ng01-262B03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(116,185,651 - 116,186,246)	(116,060,240 - 116,060,427)
sequence	gaattcatgcttcttactacatggttagtaaacagaacagactagggccc tatgctttcctttgagataaaccgtaatacctaaggactcactaggttcc acctcttaaaggctccaccatctcccaacagcagaatgctggagaccacg actttagcaatatggactttggtggggggcattaagacccaaatgatagc aggcttcagggtacactggtaggcattctatttattcttcccttacatgt tttcatgtaaagaaaaaaaaaagctctaatttcaagaatatctctggcga gaccttttatattaaatgtagacccctcctaagtacctctccttttgata ttttttagtaataaaatgagaagtgtaaacaaagcatttctgcggcatac tggggctaaatggtcgtcctgaaatcagatacatcatcatttgagtcctg aattaagccagctgcgtgtttttcaggaaacactgtttctccttgaactg aaagggtgatgctgtatagcattcagattttgtcaagaattaacaaaaca gttaagaaaaacagttggtaatgataactcatacctcctcatttattgca gatgtaagcctttttggaaaattcatatctatctcaaggtgctgacagtg agctaatggtgcctcaatacttaaagactttaataatgagcactgatata gtagtttttgagacagaatctcacacagtagcccagcgtgaccctgaatt tactacatagctcagctggcctcaaaactgcagcaaccttcctgcttttg cctcctgagttcccgtagttgccatctgagaaataaatattattcttttg attctgtattcaatgacacgtgacaatatttggaaggtctgtataactca atgaactaactttttccaaatgatcaaagcatgtgattatagaattggtc atacactgatcacggtccatttcatgggatcatctcaatattagtaggca ctct	ctgttgctgagggccctcagctctctccacactgtcgcctctcggccgtt ttatcatccttgtttcctgtagtagacgtggttccatcccctctgtgtgt gtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtggtggc gatgcggttttcctcaatcttttcttcttgttgggcaa
quality values	Open. Hide. 58 31 30 31 62 31 14 47 62 62 62 62 62 62 54 56 62 54 47 47 31 62 62 62 62 59 44 62 62 59 43 43 51 39 27 34 32 48 28 48 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 56 54 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 54 43 49 62 54 49 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 48 62 62 62 62 62 62 54 62 62 58 45 45 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 52 49 58 58 58 58 58 58 58 58 58 58 58 52 58 58 54 58 58 54 58 58 54 58 58 52 58 58 58 58 58 58 58 54 58 54 54 58 54 52 46 58 58 58 50 42 58 50 58 52 49 58 48 58 47 58 58 58 58 58 58 58 51 58 58 47 41 58 50 50 54 53 58 58 51 51 58 58 58 51 49 46 49 58 53 58 58 58 58 51 54 45 53 53 58 58 50 51 51 52 58 50 58 35 47 51 50 54 47 49 46 54 51 50 51 58 53 50 58 54 53 49 40 50 58 40 40 54 52 51 39 41 54 58 52 54 39 46 51 46 38 53 42 53 50 38 39 47 33 44 49 49 49 54 54 54 52 42 44 44 40 54 34 33 52 53 43 42 50 49 54 49 53 53 52 40 54 54 34 38 45 53 33 32 31 19 28 54 49 41 42 54 45 37 54 45 26 42 45 42 45 24 53 53 40 42 52 38 7 7 14 32 52 28 25 33 32 27 35 47 49 46 37 31 41 32 32 35 32 31 32 34 47 46 45 42 53 32 45 42 32 49 51 45 31 26 46 37 31 33 30 33 36 21 45 32 31 51 51 31 36 41 20 42 33 31 31 43 26 36 31 31 30 51 24 48 51 42 31 37 48 33 27 32 31 31 32 21 31 37 37 47 47 33 26 27 19 29 34 34 46 24 31 35 34 35 24 31 30 31 38 31 25 31 28 31 30 31 31 25 22 27 31 43 48 32 30 21 30 39 17 39 17 31 31 38 31 28 32 29 33 35 31 29 31 24 34 33 24 22 23 31 31 35 31 31 48 48 48 31 18 26 21 41 15 27 42 32 32 31 24 47 26 32 36 28 32 31 26 32 36 31 25 26 29 29 24 30 24 18 22 18 29 20 23 22 29 20 25 22 30 27 34 32 34 10 17 14 11 18 9 22 22 27 33 40 27 15 22 22 37 48 24 17 27 27 27 32 26 30 11 16 22 31 8 5 19 9 12 18 23 14 32 13 15 20 28 27 27	Open. Hide. 62 59 62 62 62 62 62 62 56 54 30 49 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 49 49 49 49 49 49 49 43 48 23 25 10 10 13 25 18 23 18 35 24 41 24 39 18 10 12 14 13 15 19 10 20 13 13 13 10 13 5 9 12 13 12 12 27 10 8 10 9 13 12 13 10 11 11 7 10 11 19 12 22 21 24 19 10 10 18

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_116185651_116186246
seq2: B6Ng01-262B03.b_43_638 (reverse)

seq1  ATAAATGAGGAGGTATGAGTTATCATTACCAACTGTTTTTCTTAACTGTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATGAGGAGGTATGAGTTATCATTACCAACTGTTTTTCTTAACTGTT  50

seq1  TTGTTAATTCTTGACAAAATCTGAATGCTATACAGCATCACCCTTTCAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTAATTCTTGACAAAATCTGAATGCTATACAGCATCACCCTTTCAGT  100

seq1  TCAAGGAGAAACAGTGTTTCCTGAAAAACACGCAGCTGGCTTAATTCAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGAGAAACAGTGTTTCCTGAAAAACACGCAGCTGGCTTAATTCAGG  150

seq1  ACTCAAATGATGATGTATCTGATTTCAGGACGACCATTTAGCCCCAGTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAAATGATGATGTATCTGATTTCAGGACGACCATTTAGCCCCAGTAT  200

seq1  GCCGCAGAAATGCTTTGTTTACACTTCTCATTTTATTACTAAAAAATATC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGCAGAAATGCTTTGTTTACACTTCTCATTTTATTACTAAAAAATATC  250

seq1  AAAAGGAGAGGTACTTAGGAGGGGTCTACATTTAATATAAAAGGTCTCGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGAGAGGTACTTAGGAGGGGTCTACATTTAATATAAAAGGTCTCGC  300

seq1  CAGAGATATTCTTGAAATTAGAGCTTTTTTTTTTCTTTACATGAAAACAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGATATTCTTGAAATTAGAGCTTTTTTTTTTCTTTACATGAAAACAT  350

seq1  GTAAGGGAAGAATAAATAGAATGCCTACCAGTGTACCCTGAAGCCTGCTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGGGAAGAATAAATAGAATGCCTACCAGTGTACCCTGAAGCCTGCTA  400

seq1  TCATTTGGGTCTTAATGCCCCCCACCAAAGTCCATATTGCTAAAGTCGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTGGGTCTTAATGCCCCCCACCAAAGTCCATATTGCTAAAGTCGTG  450

seq1  GTCTCCAGCATTCTGCTGTTGGGAGATGGTGGAGCCTTTAAGAGGTGGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCCAGCATTCTGCTGTTGGGAGATGGTGGAGCCTTTAAGAGGTGGAA  500

seq1  CCTAGTGAGTCCTTAGGTATTACGGTTTATCTCAAAGGAAAGCATAGGGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTGAGTCCTTAGGTATTACGGTTTATCTCAAAGGAAAGCATAGGGC  550

seq1  CCTAGTCTGTTCTGTTTACTAACCATGTAGTAAGAAGCATGAATTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTCTGTTCTGTTTACTAACCATGTAGTAAGAAGCATGAATTC  596

seq1: chr5_116060240_116060427
seq2: B6Ng01-262B03.g_70_257

seq1  CTGTTGCTGAGGGCCCTCAGCTCTCTCCACACTGTCGCCTCTCGGCCGTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTGCTGAGGGCCCTCAGCTCTCTCCACACTGTCGCCTCTCGGCCGTT  50

seq1  TTATCATCCTTGTTTCCTGTAGTAGACGTGGTTCCATCCCCTCTGTGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCATCCTTGTTTCCTGTAGTAGACGTGGTTCCATCCCCTCTGTGTGT  100

seq1  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||  
seq2  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTGGC  150

seq1  CAGGCGGTTGAACTCAAGCTGTTGTGCATGTTGGGCAA  188
       | ||||||   ||||| || || | | ||||||||||
seq2  GATGCGGTTTTCCTCAATCTTTTCTTCTTGTTGGGCAA  188

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information