MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-272H08
Chromosome	5 (Build37)
Map Location	66,813,350 - 66,955,463
singlet/doublet	doublet
Overlap gene	Apbb2
Upstream gene	Ugdh, 1110003E01Rik, 4930589O11Rik, Hip2, 9030416H16Rik, 1700022K14Rik, LOC384261, B3bp, LOC100041809, Rhoh, LOC626641, EG666827, Chrna9, 9130230L23Rik, BC013481, LOC626714, LOC666854, LOC100042394, Nsun7
Downstream gene	Uchl1, LOC100041876, 3732412D22Rik, LOC624662, Phox2b, Tmem33, Slc30a9, EG666938, C330024D21Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ugdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22235 MGI:1306785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110003E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68552 MGI:1915802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930589O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78214 MGI:1925464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs

name	Hip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53323 MGI:1858216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030416H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71521 MGI:1918771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74234 MGI:1921484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC384261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	B3bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333789 MGI:2684414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Rhoh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74734 MGI:1921984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	EG666827 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666827 MGI:3643549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Chrna9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231252 MGI:1202403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130230L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231253 MGI:3041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC013481 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245945 MGI:2384294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC626714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100042394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Nsun7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70918 MGI:1918168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11787 MGI:108405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uchl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22223 MGI:103149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041876 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	3732412D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77569 MGI:1924819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624662 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 125 ESTs, 10 Proteins pseudo : _no_value

name	Phox2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18935 MGI:1100882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67878 MGI:1915128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc30a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109108 MGI:1923690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666938 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666938 MGI:3648414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	C330024D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320479 MGI:2444116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ugdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981926 GeneID:22235 MGI:1306785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose dehydrogenase transcript_id : NM_009466.2

name	1110003E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801855 GeneID:68552 MGI:1915802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110003E01 gene transcript_id : NM_133697.3

name	4930589O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253941 GeneID:78214 MGI:1925464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs product : RIKEN cDNA 4930589O11 gene transcript_id : XM_899432.3

name	Hip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601007 GeneID:53323 MGI:1858216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : huntingtin interacting protein 2 transcript_id : NM_016786.3

name	9030416H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486764 GeneID:71521 MGI:1918771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030416H16 gene transcript_id : NM_001081321.1

name	1700022K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253912 GeneID:74234 MGI:1921484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700022K14 gene transcript_id : XM_001477016.1

name	LOC384261 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374788 GeneID:384261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : hypothetical LOC384261 transcript_id : XM_986220.1

name	B3bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906815 GeneID:333789 MGI:2684414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl3 binding protein transcript_id : NM_001024917.1

name	LOC100041809 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253916 GeneID:100041809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041809 transcript_id : XM_001477042.1

name	Rhoh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487388 GeneID:74734 MGI:1921984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member H transcript_id : NM_001081105.1

name	EG666827 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374790 GeneID:666827 MGI:3643549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666827 transcript_id : XM_986287.1

name	Chrna9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487390 GeneID:231252 MGI:1202403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 9 transcript_id : NM_001081104.1

name	BC013481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342581 GeneID:245945 MGI:2384294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013481 transcript_id : NM_178446.2

name	BC013481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20532345 GeneID:245945 MGI:2384294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013481 transcript_id : NM_139065.1

name	LOC100042394 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253943 GeneID:100042394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042394 transcript_id : XM_001478594.1

name	Nsun7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519165 GeneID:70918 MGI:1918168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOL1/NOP2/Sun domain family, member 7 transcript_id : NM_027602.1

name	Apbb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468878 GeneID:11787 MGI:108405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 2 transcript_id : NM_009686.1

name	Uchl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755928 GeneID:22223 MGI:103149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin carboxy-terminal hydrolase L1 transcript_id : NM_011670.1

name	LOC100041876 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253920 GeneID:100041876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041876 transcript_id : XM_001477152.1

name	3732412D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053895 GeneID:77569 MGI:1924819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3732412D22 gene transcript_id : NM_001001980.2

name	Phox2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036616 GeneID:18935 MGI:1100882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-like homeobox 2b transcript_id : NM_008888.2

name	Tmem33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533247 GeneID:67878 MGI:1915128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 33 transcript_id : NM_028975.3

name	Tmem33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68533250 GeneID:67878 MGI:1915128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 33 transcript_id : NM_030108.1

name	Slc30a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125660457 GeneID:109108 MGI:1923690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 30 (zinc transporter), member 9 transcript_id : NM_178651.3

name	EG666938 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253924 GeneID:666938 MGI:3648414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666938 transcript_id : XM_001477289.1

name	C330024D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253926 GeneID:320479 MGI:2444116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA C330024D21 gene transcript_id : XM_001477333.1

name	Ugdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678499 CCDS:CCDS19308.1 GeneID:22235 MGI:1306785
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0003979 - UDP-glucose 6-dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP] codon_start : 1 product : UDP-glucose dehydrogenase protein_id : NP_033492.1

name	1110003E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526868 CCDS:CCDS19309.1 GeneID:68552 MGI:1915802
definition	codon_start : 1 product : hypothetical protein LOC68552 protein_id : NP_598458.1

name	4930589O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897580 GeneID:78214 MGI:1925464
definition	codon_start : 1 product : hypothetical protein LOC78214 protein_id : XP_904525.1

name	Hip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542956 GeneID:53323 MGI:1858216
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence TAS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : huntingtin interacting protein 2 protein_id : NP_058066.2

name	9030416H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486765 GeneID:71521 MGI:1918771
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71521 protein_id : NP_001074790.1

name	1700022K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253913 GeneID:74234 MGI:1921484
definition	codon_start : 1 product : hypothetical protein LOC74234 protein_id : XP_001477066.1

name	LOC384261 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374789 GeneID:384261
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991314.1

name	B3bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906816 CCDS:CCDS19310.1 GeneID:333789 MGI:2684414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004113 - 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0046404 - ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Nedd4 binding protein 2 protein_id : NP_001020088.1

name	LOC100041809 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253917 GeneID:100041809
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477092.1

name	Rhoh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487389 GeneID:74734 MGI:1921984
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : ras homolog gene family, member H protein_id : NP_001074574.1

name	EG666827 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374791 GeneID:666827 MGI:3643549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991381.1

name	Chrna9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487391 GeneID:231252 MGI:1202403
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 product : cholinergic receptor, nicotinic, alpha 9 protein_id : NP_001074573.1

name	BC013481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20532346 CCDS:CCDS19313.1 GeneID:245945 MGI:2384294
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245945 protein_id : NP_620704.1

name	BC013481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425362 CCDS:CCDS19313.1 GeneID:245945 MGI:2384294
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245945 protein_id : NP_848541.1

name	LOC100042394 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253944 GeneID:100042394
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478644.1

name	Nsun7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519166 CCDS:CCDS19314.1 GeneID:70918 MGI:1918168
definition	codon_start : 1 product : NOL1/NOP2/Sun domain family, member 7 protein_id : NP_081878.1

name	Apbb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468879 GeneID:11787 MGI:108405
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0035035 - histone acetyltransferase binding [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IDA] GO_process : GO:0030048 - actin filament-based movement [Evidence NAS]; GO:0007411 - axon guidance [Evidence IGI]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0030308 - negative regulation of cell growth [Evidence IDA]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence IDA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0050821 - protein stabilization [Evidence NAS]; GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 note : zinc finger-like protein product : amyloid beta (A4) precursor protein-binding, family B, member 2 protein_id : NP_033816.1

name	Uchl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755929 CCDS:CCDS19315.1 GeneID:22223 MGI:103149
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence ISS]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0008242 - omega peptidase activity [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0043130 - ubiquitin binding [Evidence ISS] [Evidence IDA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence ISS] [Evidence IDA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP] [Evidence IGI]; GO:0007412 - axon target recognition [Evidence IMP]; GO:0019896 - axon transport of mitochondrion [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0042755 - eating behavior [Evidence IGI]; GO:0050905 - neuromuscular physiological process [Evidence IMP]; GO:0016579 - protein deubiquitination [Evidence ISS]; GO:0006950 - response to stress [Evidence IMP]; GO:0006512 - ubiquitin cycle [Evidence IMP]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gracile axonal dystrophy; protein gene product 9.5; PGP 9.5 product : ubiquitin carboxy-terminal hydrolase L1 protein_id : NP_035800.1

name	LOC100041876 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253921 GeneID:100041876
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477202.1

name	3732412D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053896 GeneID:77569 MGI:1924819
definition	GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031032 - actomyosin structure organization and biogenesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77569 protein_id : NP_001001980.2

name	Phox2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679401 CCDS:CCDS19316.1 GeneID:18935 MGI:1100882
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : paired mesoderm homeobox 2b; dilated pupils 1; GENA 269 product : paired-like homeobox 2b protein_id : NP_032914.1

name	Tmem33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68533251 GeneID:67878 MGI:1915128
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : transmembrane protein 33 isoform 2 protein_id : NP_084384.1

name	Tmem33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22267448 CCDS:CCDS19317.1 GeneID:67878 MGI:1915128
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : transmembrane protein 33 isoform 1 protein_id : NP_083251.2

name	Slc30a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125660458 GeneID:109108 MGI:1923690
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006812 - cation transport [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : HUEL-like; C4orf1-like; GRIP1-associated coactivator 1 product : solute carrier family 30 (zinc transporter), member 9 protein_id : NP_848766.2

name	EG666938 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253925 GeneID:666938 MGI:3648414
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477339.1

name	C330024D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253927 GeneID:320479 MGI:2444116
definition	codon_start : 1 product : hypothetical protein LOC320479 protein_id : XP_001477383.1

name	LOC626714 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626714
definition	number : 1 pseudo : _no_value

name	LOC666854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666854
definition	number : 2 pseudo : _no_value

name	LOC666854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666854
definition	number : 1 pseudo : _no_value

name	LOC626641 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253918 GeneID:626641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to 2410004L22Rik protein pseudo : _no_value transcript_id : XR_033040.1

name	9130230L23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253942 GeneID:231253 MGI:3041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9130230L23 gene transcript_id : XR_035361.1

name	LOC624662 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253945 GeneID:624662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 125 ESTs, 10 Proteins product : similar to MGC69457 protein pseudo : _no_value transcript_id : XR_033841.1

clone name	MSMg01-327D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-216M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302I16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-272H08.b	B6Ng01-272H08.g
ACC	GA074279	GA074280
length	1,111	1,078
definition	B6Ng01-272H08.b	B6Ng01-272H08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(66,813,350 - 66,814,465)	(66,954,383 - 66,955,463)
sequence	gaattctctccacaccctcttgtcaatacctctgggcgtccactgattag acatagctttggcatgctgctttaactggccctggatgaccttgcttctc attttgatgatcctggatttcaggaggtctgaggacagacacagcgccaa gagggaggagctgctaccttcctaggccaggccaggctgatgaggggttg aggctctcacatccctaagtaaatgtgtttcagaacacagccaaggagac ctctcccctggtttctctaaaggcttctggccttccttcagcttccctcc actggtctaattctgcctattttccgcaccacagtggctttctatgttga acagtaagtgatcactgctaacagtgtctgaccatacgtttaaatactgt cagactcttccagtagaactgtagctccttgaggctgtagccctcgtgga cgttacttctagcacagtacttggaacatggtacctgttactgatacgcg ttgtggtggtttgtatatgcttggcccagggagtggcactattgggagct atggccttgttggagcaggtgtgtcactgtgggtatgggcttgaataccc aactcctagctgtctagtatcttccactagcagccttcagatgaagatgt agaactctcagctcctcctgcaccatgagggggatgctgccatgttcctt tcttgatgataatggattgaacctctgaacctgtaagtcagccccaagta aatgttgtccttataagagttgccttgctcatagtgtctgttcacagcac taaaaccctaactaaaacaggcgtcttcagggttggcagcaacagtggtc ccaagggtgctcaacagtgctgagttataactagggaggagtaaaatact ctggtctgctgctgttcatacagtgatcacggataatccagggtagactg cagaaagctttaaaaattttgtttgaatgcttttcccatatataaatgct aatgtttaggcaaagaaaatcaaacattatgcaatgtttacatttatgac agtacgtgtgtctcataaaatattgtacagtttctatgttctatgccatc tggtaaataag	gaattcatagccactatgcctcaagatctccatgacaagatccaggtcag aaactctatctcccagtcttcaaattagggtcactggttcattccagata tagtcaagttgacaaccaagaatagccactacagtggggaaccaggtaaa tggtttgccccacattatacggctgtaaatagcaaggggagggagatact tagattctcggcctcaaactatctactctaaatgagtgtcctgtagatgt cttaaacagttgaggaaaatgaaagtggaataggaaagtggtttatcacg cctctggtgaaatgttgggtaaatggaacttaggagaaaaggaacactta aaatcctgtgtaaaataaaagttaaagagggaaggaaaaatcagaattat taccataagatggacattctgtttgctttcatatgtagggaggcagctgc cttctaagacatgtatgtgatgagagaccatttggggatgctcttaggtt aagaagaatcagcttctaacagtacagccttctgctggctcttcaaacat gtggaattttgtttgtatgtgtctcaaagctagtgtcttgttagatttaa aatcctgagaatactacagccattttagctactttaaagctaacatttaa ggcagaatgagatactgttccacttgctcaggtatctgtactctgtaggg ttttctgttgtttgagtttttccaagatacttattctagaaagtgtctga aggcacttgggtttgtgctgtctggtaggaagagagacagtggtggtctc ttaatttagaagaaaggcaacttgcaagcaaatctctcattagaaggagg ctgatttgtgccctacgtcagcttcttagcaatttgtggtcctgatcata atctataggcaaaccccacataccccctgagttcagaagtagagatggcc ctgcaaactgctcactatctctccatagaggatgaaaggctacctttcct ttatatggaatttcctctcacattcccttctttgaaacactatcgagtgt tatgggctgctgtcgactatacgagtgt
quality values	Open. Hide. 58 31 40 22 62 62 62 62 62 62 37 20 47 33 62 62 62 62 62 62 62 62 62 44 26 49 62 62 62 62 62 30 24 31 28 25 23 29 28 27 21 38 44 28 28 26 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 51 51 51 38 40 43 51 59 59 54 43 54 62 62 59 59 62 62 62 62 54 62 62 62 62 62 59 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 59 54 62 62 62 62 62 59 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 49 42 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 56 62 62 46 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 52 62 62 47 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 54 58 54 58 58 58 58 58 52 54 58 58 54 54 58 58 58 54 54 58 58 58 58 58 58 58 58 54 54 54 58 58 58 49 58 58 58 58 58 58 58 49 58 58 58 58 58 53 54 53 46 53 46 58 58 58 54 35 42 54 47 51 48 58 50 50 58 58 58 58 51 50 46 51 50 58 58 58 50 58 39 58 52 58 50 58 58 48 58 54 52 54 52 40 51 54 52 58 50 48 58 51 58 50 50 42 44 50 53 58 54 31 58 58 58 51 31 22 54 51 51 53 50 54 32 53 54 58 50 54 51 50 58 39 52 33 51 51 50 35 50 53 37 44 41 43 58 41 41 31 52 49 41 45 44 46 47 53 51 50 54 32 41 50 41 51 35 31 52 45 53 42 32 32 53 54 54 44 21 52 39 53 39 54 41 42 51 38 51 46 37 40 41 31 45 39 40 35 54 33 53 22 35 39 35 35 51 47 26 41 42 42 33 26 37 40 32 45 52 31 53 32 51 38 42 32 33 40 36 32 34 40 47 45 41 52 51 34 24 40 32 41 32 52 32 45 45 52 49 32 32 18 9 38 31 31 37 37 31 42 39 32 36 51 41 14 45 28 51 25 31 28 20 9 45 31 25 30 31 33 29 32 28 46 38 24 29 30 47 33 27 32 31 31 31 31 24 31 31 26 26 31 31 42 29 42 18 42 37 33 25 27 27 31 32 32 19 46 35 27 25 27 37 16 37 32 46 32 24 17 21 21 31 35 27 27 37 26 36 31 32 31 31 31 32 32 31 32 32 32 18 34 28 36 22 28 16 31 33 36 31 29 32 26 33 28 20 25 32 22 22 26 24 21 48 44 27 28 13 26 21 30 32 21 16 6 28 43 23 27 24 8 39 8 34 39 43 48 28 15 43 39 25 37 20 37 23 18 18 19 22 29 25 21 40 24 15 14 47 23 17 21 15 20 9 9 8 48 22 19 28 27 26 21 14 7 4 9 40 27 21 15 15 20 11 40 15 12 25 19 14 10 3 6 8 40 15 28 16 27 15 24 19 20 28 10 18 5 21 20 38 25 18 6 3 7 47 27 7 7 10 7 15 5 6 2 5 3 1 2 7 3 4 6 14 12 20 11 8 6 28 27 5 5 3 4 7 8 15 8 20 16 7 5 29 16 16 5 6 6 15 10 12 21 9 19 20 20 6 16 6 7 13 5 8 6 10 5 25 7 6 6 9 3	Open. Hide. 62 35 46 31 62 39 39 62 62 62 62 21 11 24 10 11 25 22 22 25 18 14 17 13 18 38 62 62 62 62 59 59 62 59 54 62 59 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 34 30 34 43 34 34 48 40 46 28 27 33 32 48 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 59 54 62 62 59 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 38 38 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 49 62 54 62 62 62 62 62 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 52 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 54 52 45 54 54 58 58 58 58 54 54 58 58 58 58 54 45 58 58 58 58 58 58 58 58 58 54 58 54 54 39 58 53 54 58 58 54 58 58 58 58 58 58 33 58 49 52 53 51 58 51 54 49 51 58 29 40 58 58 58 47 48 40 43 45 46 58 53 58 58 58 58 58 58 58 58 50 53 50 44 48 51 35 50 54 42 58 42 50 52 58 31 29 58 58 50 52 50 46 51 58 58 52 53 53 41 34 47 58 58 58 51 41 52 40 26 58 40 37 50 49 51 58 52 50 41 58 52 52 58 49 50 20 58 54 32 58 49 41 41 53 54 34 29 42 25 54 54 46 51 31 52 54 54 54 35 37 35 21 29 41 51 32 40 42 35 35 45 33 49 52 42 42 34 54 54 54 29 45 51 41 52 51 44 54 44 31 33 24 32 37 53 32 47 49 46 45 54 42 47 44 34 35 42 47 37 45 42 51 42 16 53 10 53 33 44 29 46 32 51 45 42 27 32 37 25 40 47 31 46 40 31 41 32 32 29 17 31 53 26 52 8 17 30 41 34 18 51 51 30 31 39 23 32 25 29 24 33 30 30 20 25 31 11 7 46 7 19 30 37 39 35 33 32 38 37 36 32 42 29 18 42 30 20 32 16 30 31 27 15 47 32 31 30 38 31 46 42 31 36 35 35 38 36 32 29 42 33 28 31 26 31 36 22 41 27 31 36 46 30 38 23 37 32 19 23 25 21 29 32 31 22 23 31 34 38 24 31 26 32 35 10 19 20 22 22 36 26 31 38 41 19 10 14 16 23 26 26 41 44 41 25 18 29 37 16 25 13 31 23 19 36 30 18 21 33 16 22 11 21 25 32 26 13 37 13 10 10 14 17 33 23 19 13 28 16 16 21 20 32 23 22 15 11 10 16 20 12 34 15 15 26 7 22 8 9 32 16 31 32 39 10 23 16 17 29 25 11 9 10 40 11 19 15 17 30 13 7 5 13 5 13 21 10 16 9 40 21 13 18 5 3 5 13 6 13 12 21 14 21 29 27 7 5 7 7 21 24 7 10 28 11 24 10 20 20 13 24 15 7 27 7 6 5 11 10 14 18 6 26 11 11 13 20 23 21 23 6 17 6 16 15 18 5 2 3 11 9 21 5 5 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_66813350_66814465
seq2: B6Ng01-272H08.b_46_1156

seq1  GAATTCTCTCCACACCCTCTTGTCAATACCTCTGGGCGTCCACTGATTAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCCACACCCTCTTGTCAATACCTCTGGGCGTCCACTGATTAG  50

seq1  ACATAGCTTTGGCATGCTGCTTTAACTGGCCCTGGATGACCTTGCTTCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATAGCTTTGGCATGCTGCTTTAACTGGCCCTGGATGACCTTGCTTCTC  100

seq1  ATTTTGATGATCCTGGATTTCAGGAGGTCTGAGGACAGACACAGCGCCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTGATGATCCTGGATTTCAGGAGGTCTGAGGACAGACACAGCGCCAA  150

seq1  GAGGGAGGAGCTGCTACCTTCCTAGGCCAGGCCAGGCTGATGAGGGGTTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGAGGAGCTGCTACCTTCCTAGGCCAGGCCAGGCTGATGAGGGGTTG  200

seq1  AGGCTCTCACATCCCTAAGTAAATGTGTTTCAGAACACAGCCAAGGAGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTCTCACATCCCTAAGTAAATGTGTTTCAGAACACAGCCAAGGAGAC  250

seq1  CTCTCCCCTGGTTTCTCTAAAGGCTTCTGGCCTTCCTTCAGCTTCCCTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCCCCTGGTTTCTCTAAAGGCTTCTGGCCTTCCTTCAGCTTCCCTCC  300

seq1  ACTGGTCTAATTCTGCCTATTTTCCGCACCACAGTGGCTTTCTATGTTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGTCTAATTCTGCCTATTTTCCGCACCACAGTGGCTTTCTATGTTGA  350

seq1  ACAGTAAGTGATCACTGCTAACAGTGTCTGACCATACGTTTAAATACTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTAAGTGATCACTGCTAACAGTGTCTGACCATACGTTTAAATACTGT  400

seq1  CAGACTCTTCCAGTAGAACTGTAGCTCCTTGAGGCTGTAGCCCTCGTGGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTCTTCCAGTAGAACTGTAGCTCCTTGAGGCTGTAGCCCTCGTGGA  450

seq1  CGTTACTTCTAGCACAGTACTTGGAACATGGTACCTGTTACTGATACGCG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTACTTCTAGCACAGTACTTGGAACATGGTACCTGTTACTGATACGCG  500

seq1  TTGTGGTGGTTTGTATATGCTTGGCCCAGGGAGTGGCACTATTGGGAGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGGTGGTTTGTATATGCTTGGCCCAGGGAGTGGCACTATTGGGAGCT  550

seq1  ATGGCCTTGTTGGAGCAGGTGTGTCACTGTGGGTATGGGCTTGAATACCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCTTGTTGGAGCAGGTGTGTCACTGTGGGTATGGGCTTGAATACCC  600

seq1  AACTCCTAGCTGTCTAGTATCTTCCACTAGCAGCCTTCAGATGAAGATGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCTAGCTGTCTAGTATCTTCCACTAGCAGCCTTCAGATGAAGATGT  650

seq1  AGAACTCTCAGCTCCTCCTGCACCATGAGGGGGATGCTGCCATGTTCCTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTCTCAGCTCCTCCTGCACCATGAGGGGGATGCTGCCATGTTCCTT  700

seq1  TCTTGATGATAATGGATTGAACCTCTGAACCTGTAAGTCAGCCCCAAGTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGATGATAATGGATTGAACCTCTGAACCTGTAAGTCAGCCCCAAGTA  750

seq1  AATGTTGTCCTTATAAGAGTTGCCTTGCTCATAGTGTCTGTTCACAGCAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTTGTCCTTATAAGAGTTGCCTTGCTCATAGTGTCTGTTCACAGCAC  800

seq1  TAAAACCCTAACTAAAACAGGCGTCTTCAGGGTTGGCAGCAACAGTGGTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACCCTAACTAAAACAGGCGTCTTCAGGGTTGGCAGCAACAGTGGTC  850

seq1  CCAAGGGTGCTCAACAGTGCTGAGTTATAACTAGGGAGGAGTAAAATACT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGGTGCTCAACAGTGCTGAGTTATAACTAGGGAGGAGTAAAATACT  900

seq1  CTGGTCTGCTGCTGTTCATACAGTGATCACGGATAATCCAGGGTAGACTG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTCTGCTGCTGTTCATACAGTGATCACGGATAATCCAGGGTAGACTG  950

seq1  CAGAAAGC-TTAAAAATTTTGTTTGAATGCTTTTCCCCATATATAAATGC  999
      |||||||| ||||||||||||||||||||||||| |||||||||||||||
seq2  CAGAAAGCTTTAAAAATTTTGTTTGAATGCTTTT-CCCATATATAAATGC  999

seq1  TAATTGTTTTAGGCAAAGAAAAATTCAAACATTATGCAATGTTTACATTT  1049
      ||||   |||||||||||||||  ||||||||||||||||||||||||||
seq2  TAAT--GTTTAGGCAAAGAAAA--TCAAACATTATGCAATGTTTACATTT  1045

seq1  ATTGACAGGTTACCTTGTGTCTCAT-AAATA-TGTACAGTTTCTATGTTC  1097
      | ||||||  || | |||||||||| ||||| ||||||||||||||||||
seq2  A-TGACAG--TA-CGTGTGTCTCATAAAATATTGTACAGTTTCTATGTTC  1091

seq1  TATG-CATCTGTTAAATAAG  1116
      |||| |||||| ||||||||
seq2  TATGCCATCTGGTAAATAAG  1111

seq1: chr5_66954383_66955463
seq2: B6Ng01-272H08.g_66_1143 (reverse)

seq1  ACACTTCGTATTAAGTCGACAGCAGCCATAAACACTCGATAGTGTTTCAA  50
      |||| ||||||  ||||||||||||||   ||||||||||||||||||||
seq2  ACAC-TCGTAT--AGTCGACAGCAGCCCATAACACTCGATAGTGTTTCAA  47

seq1  AG-AGGGAATGTGGAGGAAGGAAATCCATTATAAAGGAAGGTTAGCCTTT  99
      || ||||||||| |||  ||||||| |  |||||||||| | ||||||||
seq2  AGAAGGGAATGT-GAG--AGGAAATTCCATATAAAGGAAAGGTAGCCTTT  94

seq1  CATCTCTTATGGAGAGATAGTGAGCAGTTTGCAGGGCCATCTCTACTTCT  149
      ||||   |||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCTCTATGGAGAGATAGTGAGCAGTTTGCAGGGCCATCTCTACTTCT  144

seq1  GAACTCAGGGGGTATGTGGGGTTTGCCTATAGATTATGATCAGGACCACA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCAGGGGGTATGTGGGGTTTGCCTATAGATTATGATCAGGACCACA  194

seq1  AATTGCTAAGAAGCTGACGTAGGGCACAAATCAGCCTCCTTCTAATGAGA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCTAAGAAGCTGACGTAGGGCACAAATCAGCCTCCTTCTAATGAGA  244

seq1  GA-TTGCTTGCAAGTTGCCTTTCTTCT-AATTAAGAGACCACCACTGTCT  297
      || |||||||||||||||||||||||| ||||||||||||||||||||||
seq2  GATTTGCTTGCAAGTTGCCTTTCTTCTAAATTAAGAGACCACCACTGTCT  294

seq1  CTCTTCCTACCAGACAGCACAAACCCAAGTGCCTTCAGACACTTTCTAGA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCCTACCAGACAGCACAAACCCAAGTGCCTTCAGACACTTTCTAGA  344

seq1  ATAAGTATCTTGGAAAAACTCAAACAACAGAAAACCCTACAGAGTACAGA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGTATCTTGGAAAAACTCAAACAACAGAAAACCCTACAGAGTACAGA  394

seq1  TACCTGAGCAAGTGGAACAGTATCTCATTCTGCCTTAAATGTTAGCTTTA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTGAGCAAGTGGAACAGTATCTCATTCTGCCTTAAATGTTAGCTTTA  444

seq1  AAGTAGCTAAAATGGCTGTAGTATTCTCAGGATTTTAAATCTAACAAGAC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAGCTAAAATGGCTGTAGTATTCTCAGGATTTTAAATCTAACAAGAC  494

seq1  ACTAGCTTTGAGACACATACAAACAAAATTCCACATGTTTGAAGAGCCAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAGCTTTGAGACACATACAAACAAAATTCCACATGTTTGAAGAGCCAG  544

seq1  CAGAAGGCTGTACTGTTAGAAGCTGATTCTTCTTAACCTAAGAGCATCCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGGCTGTACTGTTAGAAGCTGATTCTTCTTAACCTAAGAGCATCCC  594

seq1  CAAATGGTCTCTCATCACATACATGTCTTAGAAGGCAGCTGCCTCCCTAC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATGGTCTCTCATCACATACATGTCTTAGAAGGCAGCTGCCTCCCTAC  644

seq1  ATATGAAAGCAAACAGAATGTCCATCTTATGGTAATAATTCTGATTTTTC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGAAAGCAAACAGAATGTCCATCTTATGGTAATAATTCTGATTTTTC  694

seq1  CTTCCCTCTTTAACTTTTATTTTACACAGGATTTTAAGTGTTCCTTTTCT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCTCTTTAACTTTTATTTTACACAGGATTTTAAGTGTTCCTTTTCT  744

seq1  CCTAAGTTCCATTTACCCAACATTTCACCAGAGGCGTGATAAACCACTTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAGTTCCATTTACCCAACATTTCACCAGAGGCGTGATAAACCACTTT  794

seq1  CCTATTCCACTTTCATTTTCCTCAACTGTTTAAGACATCTACAGGACACT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATTCCACTTTCATTTTCCTCAACTGTTTAAGACATCTACAGGACACT  844

seq1  CATTTAGAGTAGATAGTTTGAGGCCGAGAATCTAAGTATCTCCCTCCCCT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTAGAGTAGATAGTTTGAGGCCGAGAATCTAAGTATCTCCCTCCCCT  894

seq1  TGCTATTTACAGCCGTATAATGTGGGGCAAACCATTTACCTGGTTCCCCA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATTTACAGCCGTATAATGTGGGGCAAACCATTTACCTGGTTCCCCA  944

seq1  CTGTAGTGGCTATTCTTGGTTGTCAACTTGACTATATCTGGAATGAACCA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAGTGGCTATTCTTGGTTGTCAACTTGACTATATCTGGAATGAACCA  994

seq1  GTGACCCTAATTTGAAGACTGGGAGATAGAGTTTCTGACCTGGATCTTGT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACCCTAATTTGAAGACTGGGAGATAGAGTTTCTGACCTGGATCTTGT  1044

seq1  CATGGAGATCTTGAGGCATAGTGGCTATGAATTC  1081
      ||||||||||||||||||||||||||||||||||
seq2  CATGGAGATCTTGAGGCATAGTGGCTATGAATTC  1078

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information