MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-287P14
Chromosome	5 (Build37)
Map Location	138,318,308 - 138,319,685
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Emid2, LOC677021, Rabl5, Fis1, Cldn15, Znhit1, Plod3, LOC639992, Vgf, Ap1s1, Serpine1, Trim56, Muc3, LOC100040941, Ache, 2700038N03Rik, Ars2, Trip6, Slc12a9, Ephb4, Zan, EG665591, Epo, Pop7, EG666372, Perq1, Gnb2, Actl6b, Trfr2, Mospd3, EG640050, Pcolce, Fbxo24, Lrch4, Sap25, Irs3, Hrbl, LOC624083, 6430598A04Rik, Tsc22d4, 2010007H12Rik, Bcdin3, Zcwpw1, Pilra, Pilrb1, Pilrb2, LOC100041016
Downstream gene	LOC100041027, Cyp3a13, LOC666429, Gje1, Azgp1, EG243302, LOC100041050, Smok3a, Smok3b, Smok3c, Zkscan1, Zscan21, Zfp113, Cops6, Mcm7, Ap4m1, Taf6, 2610019P18Rik, BC038925, Gm454, BC055004, 0910001L09Rik, BC037034, Gal3st4, Gpc2, Stag3, Got2-ps1, 2610020C11Rik, LOC433955, EG666533, 1700123K08Rik, Zfp68, LOC665882, A430033K04Rik, BC004044, EG384244
Link	Open Mouse BAC browser

Click to get alignment info.

name	Emid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140709 MGI:2155345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677021 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Rabl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67286 MGI:1914536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fis1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66437 MGI:1913687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60363 MGI:1913103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znhit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70103 MGI:1917353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plod3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26433 MGI:1347008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Vgf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381677 MGI:1343180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11769 MGI:1098244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpine1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18787 MGI:97608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384309 MGI:2685298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666339 MGI:1203527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 30 ESTs, 4 Proteins

name	LOC100040941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ache (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11423 MGI:87876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700038N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70240 MGI:1917490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83701 MGI:1933527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trip6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22051 MGI:1343458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83704 MGI:1933532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ephb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13846 MGI:104757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zan (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22635 MGI:106656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665591 MGI:3643602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Epo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13856 MGI:95407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pop7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74097 MGI:1921347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666372 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666372 MGI:3646351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Perq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57330 MGI:1888677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14693 MGI:95784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actl6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83766 MGI:1933548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trfr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50765 MGI:1354956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mospd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68929 MGI:1916179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640050 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640050 MGI:3647212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 368 ESTs, 4 Proteins pseudo : _no_value

name	Pcolce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18542 MGI:105099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71176 MGI:1918426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	Lrch4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231798 MGI:1917193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sap25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:751865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16369 MGI:1194882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231801 MGI:2443267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC624083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs, 4 Proteins

name	6430598A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243300 MGI:2443880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc22d4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78829 MGI:1926079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010007H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69871 MGI:1922853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcdin3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231803 MGI:106477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcwpw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381678 MGI:2685899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231805 MGI:2450529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170741 MGI:2450532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545812 MGI:2450535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041027 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Cyp3a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13113 MGI:88610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Gje1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118446 MGI:2153041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Azgp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12007 MGI:103163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243302 MGI:3645168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 446 ESTs, 5 Proteins

name	LOC100041050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Smok3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545814 MGI:3693943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 96 Proteins

name	Smok3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622474 MGI:3615348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smok3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622486 MGI:3647925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 100 Proteins

name	Zkscan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zscan21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22697 MGI:99182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Zfp113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56314 MGI:1929116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26893 MGI:1349439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17220 MGI:1298398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap4m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11781 MGI:1337063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21343 MGI:109129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610019P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66455 MGI:1913705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038925 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330216 MGI:2679717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243303 MGI:2685300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	BC055004 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381680 MGI:3584036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0910001L09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66096 MGI:1913346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC037034 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231807 MGI:2385896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330217 MGI:1916254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71951 MGI:1919201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50878 MGI:1355311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Got2-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14720 MGI:104721
definition	note : glutamate oxaloacetate transaminase 2, mitochondrial, pseudogene 1 pseudo : _no_value

name	2610020C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72154 MGI:1919404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins pseudo : _no_value

name	EG666533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666533 MGI:3644505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	1700123K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins pseudo : _no_value

name	A430033K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243308 MGI:3583896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC004044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80752 MGI:2136853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384244 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Emid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19263337 GeneID:140709 MGI:2155345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EMI domain containing 2 transcript_id : NM_024474.2

name	Rabl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129879 GeneID:67286 MGI:1914536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 5 transcript_id : NM_026073.3

name	Fis1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384108 GeneID:66437 MGI:1913687
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fission 1 (mitochondrial outer membrane) homolog (yeast) transcript_id : NM_025562.2

name	Cldn15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384546 GeneID:60363 MGI:1913103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 15 transcript_id : NM_021719.2

name	Znhit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386060 GeneID:70103 MGI:1917353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT domain containing 1 transcript_id : NM_027318.2

name	Plod3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560515 GeneID:26433 MGI:1347008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 transcript_id : NM_011962.2

name	Vgf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476053 GeneID:381677 MGI:1343180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : VGF nerve growth factor inducible transcript_id : NM_001039385.1

name	Ap1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131012 GeneID:11769 MGI:1098244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, sigma 1 transcript_id : NM_007457.2

name	Serpine1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679372 GeneID:18787 MGI:97608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade E, member 1 transcript_id : NM_008871.1

name	Trim56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802531 GeneID:384309 MGI:2685298
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 56 transcript_id : NM_201373.2

name	Muc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254623 GeneID:666339 MGI:1203527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 30 ESTs, 4 Proteins product : mucin 3, intestinal transcript_id : XM_355711.6

name	LOC100040941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254625 GeneID:100040941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to mucin 3 transcript_id : XM_001475531.1

name	Ache (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252712 GeneID:11423 MGI:87876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acetylcholinesterase transcript_id : NM_009599.3

name	2700038N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360157 GeneID:70240 MGI:1917490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700038N03 gene transcript_id : NM_027356.2

name	Ars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13937394 GeneID:83701 MGI:1933527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arsenate resistance protein 2 transcript_id : NM_031405.1

name	Trip6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801771 GeneID:22051 MGI:1343458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor interactor 6 transcript_id : NM_011639.3

name	Slc12a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560017 GeneID:83704 MGI:1933532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12 (potassium/chloride transporters), member 9 transcript_id : NM_031406.2

name	Ephb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087140 GeneID:13846 MGI:104757
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Eph receptor B4 transcript_id : NM_010144.4

name	Zan (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048476 GeneID:22635 MGI:106656
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zonadhesin transcript_id : NM_011741.1

name	Epo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931667 GeneID:13856 MGI:95407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythropoietin transcript_id : NM_007942.2

name	Pop7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13899214 GeneID:74097 MGI:1921347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : processing of precursor 7, ribonuclease P family, (S. cerevisiae) transcript_id : NM_028753.1

name	EG666372 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375721 GeneID:666372 MGI:3646351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666372 transcript_id : XM_983418.1

name	Perq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13937398 GeneID:57330 MGI:1888677
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PERQ amino acid rich, with GYF domain 1 transcript_id : NM_031408.1

name	Gnb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803173 GeneID:14693 MGI:95784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, beta 2 transcript_id : NM_010312.4

name	Actl6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982571 GeneID:83766 MGI:1933548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-like 6B transcript_id : NM_031404.3

name	Trfr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113204629 GeneID:50765 MGI:1354956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transferrin receptor 2 transcript_id : NM_015799.3

name	Mospd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077072 GeneID:68929 MGI:1916179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : motile sperm domain containing 3 transcript_id : NM_030037.1

name	Pcolce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490381 GeneID:18542 MGI:105099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen C-endopeptidase enhancer protein transcript_id : NM_008788.2

name	Fbxo24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375724 GeneID:71176 MGI:1918426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : F-box protein 24 transcript_id : XM_132440.3

name	Lrch4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122700 GeneID:231798 MGI:1917193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 4 transcript_id : NM_146164.1

name	Sap25 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126506313 GeneID:751865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mSin3A-binding protein transcript_id : NM_001081962.1

name	Irs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380306 GeneID:16369 MGI:1194882
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin receptor substrate 3 transcript_id : NM_010571.2

name	Hrbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341133 GeneID:231801 MGI:2443267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIV-1 Rev binding protein-like transcript_id : NM_178162.2

name	Hrbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704137 GeneID:231801 MGI:2443267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIV-1 Rev binding protein-like transcript_id : NM_145566.1

name	LOC624083 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254636 GeneID:624083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs, 4 Proteins product : hypothetical LOC624083 transcript_id : XM_001476612.1

name	6430598A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537543 GeneID:243300 MGI:2443880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430598A04 gene transcript_id : NM_175521.3

name	Tsc22d4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75750500 GeneID:78829 MGI:1926079
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSC22 domain family 4 transcript_id : NM_023910.5

name	2010007H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802608 GeneID:69871 MGI:1922853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010007H12 gene transcript_id : NM_027242.2

name	Bcdin3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672919 GeneID:231803 MGI:106477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bin3, bicoid-interacting 3, homolog (Drosophila) transcript_id : NM_144913.3

name	Zcwpw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749215 GeneID:381678 MGI:2685899
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CW type with PWWP domain 1 transcript_id : NM_001005426.1

name	Pilra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803285 GeneID:231805 MGI:2450529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor alpha transcript_id : NM_153510.2

name	Pilrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875355 GeneID:170741 MGI:2450532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor beta 1 transcript_id : NM_133209.1

name	Pilrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364171 GeneID:545812 MGI:2450535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor beta 2 transcript_id : NM_001024932.2

name	Cyp3a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380509 GeneID:13113 MGI:88610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 13 transcript_id : NM_007819.3

name	Gje1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367828 GeneID:118446 MGI:2153041
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein epsilon 1 transcript_id : NM_080450.3

name	Azgp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304910 GeneID:12007 MGI:103163
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-2-glycoprotein 1, zinc transcript_id : NM_013478.1

name	EG243302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375725 GeneID:243302 MGI:3645168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 446 ESTs, 5 Proteins product : predicted gene, EG243302 transcript_id : XM_144599.7

name	LOC100041050 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254639 GeneID:100041050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to putative protein kinase transcript_id : XM_001475708.1

name	Smok3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375726 GeneID:545814 MGI:3693943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 96 Proteins product : sperm motility kinase 3A, transcript variant 1 transcript_id : XM_620264.3

name	Smok3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375972 GeneID:622474 MGI:3615348
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm motility kinase 3B transcript_id : NM_001039889.2

name	Smok3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375729 GeneID:622486 MGI:3647925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 100 Proteins product : sperm motility kinase 3C, transcript variant 2 transcript_id : XM_898397.2

name	Zkscan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68510030 GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 1 transcript_id : NM_133906.4

name	Zkscan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68510028 GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 1 transcript_id : NM_029869.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374185 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_011757.2

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374181 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044703.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374183 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044704.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374189 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044705.1

name	Zfp113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328522 GeneID:56314 MGI:1929116
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 113 transcript_id : NM_019747.3

name	Cops6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377445 GeneID:26893 MGI:1349439
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 6 (Arabidopsis thaliana) transcript_id : NM_012002.2

name	Mcm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130733 GeneID:17220 MGI:1298398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 7 (S. cerevisiae) transcript_id : NM_008568.2

name	Ap4m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803389 GeneID:11781 MGI:1337063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex AP-4, mu 1 transcript_id : NM_021392.3

name	Taf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130471 GeneID:21343 MGI:109129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_009315.3

name	2610019P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301473 GeneID:66455 MGI:1913705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610019P18 gene transcript_id : NM_178612.3

name	BC038925 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368327 GeneID:330216 MGI:2679717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038925 transcript_id : NM_177878.2

name	BC055004 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625602 GeneID:381680 MGI:3584036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC055004 transcript_id : NM_001013773.2

name	0910001L09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487392 GeneID:66096 MGI:1913346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0910001L09 gene transcript_id : NM_001081108.1

name	BC037034 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346608 GeneID:231807 MGI:2385896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC037034 transcript_id : NM_153161.1

name	Gal3st4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802535 GeneID:330217 MGI:1916254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 4 transcript_id : NM_001033416.2

name	Gpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226221 GeneID:71951 MGI:1919201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 2 (cerebroglycan) transcript_id : NM_172412.2

name	Stag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394369 GeneID:50878 MGI:1355311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal antigen 3 transcript_id : NM_016964.1

name	2610020C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254176 GeneID:72154 MGI:1919404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020C11 gene transcript_id : NM_028130.2

name	1700123K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802060 GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700123K08 gene transcript_id : NM_029693.2

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680983 GeneID:24135 MGI:1344427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_001044747.1

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681056 GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_013844.2

name	A430033K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942099 GeneID:243308 MGI:3583896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430033K04 gene transcript_id : NM_183025.1

name	BC004044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842825 GeneID:80752 MGI:2136853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004044 transcript_id : NM_030565.5

name	EG384244 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254649 GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG384244 transcript_id : XM_357518.6

name	Emid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263338 CCDS:CCDS19755.1 GeneID:140709 MGI:2155345
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : Collagen XXVI; collagen, type XXVI, alpha 1; procollagen, type XXVI, alpha 1 product : Emu2 protein_id : NP_077794.2

name	Rabl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313026 CCDS:CCDS19756.1 GeneID:67286 MGI:1914536
definition	codon_start : 1 product : RAB, member of RAS oncogene family-like 5 protein_id : NP_080349.1

name	Fis1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384998 CCDS:CCDS19757.1 GeneID:66437 MGI:1913687
definition	GO_component : GO:0031307 - integral to mitochondrial outer membrane [Evidence ISS]; GO:0005779 - integral to peroxisomal membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0000266 - mitochondrial fission [Evidence ISS]; GO:0016559 - peroxisome fission [Evidence ISS] codon_start : 1 product : tetratricopeptide repeat domain 11 protein_id : NP_079838.1

name	Cldn15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149748 CCDS:CCDS19758.1 GeneID:60363 MGI:1913103
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 product : claudin 15 protein_id : NP_068365.1

name	Znhit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037197 GeneID:70103 MGI:1917353
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger protein, subfamily 4A (HIT domain containing), member 1 product : zinc finger, HIT domain containing 1 protein_id : NP_081594.1

name	Plod3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755110 CCDS:CCDS19759.1 GeneID:26433 MGI:1347008
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 note : lysyl hydroxylase 2; lysyl hydroxylase 3 product : procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3 protein_id : NP_036092.1

name	Vgf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476054 CCDS:CCDS19760.1 GeneID:381677 MGI:1343180
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence IMP] GO_process : GO:0006091 - generation of precursor metabolites and energy [Evidence IMP]; GO:0001541 - ovarian follicle development [Evidence IMP]; GO:0019953 - sexual reproduction [Evidence IMP] codon_start : 1 product : VGF nerve growth factor inducible protein_id : NP_001034474.1

name	Ap1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671559 GeneID:11769 MGI:1098244
definition	GO_component : GO:0030121 - AP-1 adaptor complex [Evidence NAS] [Evidence ISS]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] [Evidence NAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence NAS] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS] [Evidence NAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-1, sigma 1 product : adaptor protein complex AP-1, sigma 1 protein_id : NP_031483.1

name	Serpine1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679373 CCDS:CCDS19761.1 GeneID:18787 MGI:97608
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008243 - plasminogen activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IDA] GO_process : GO:0045765 - regulation of angiogenesis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : plasminogen activator inhibitor, type I; nexin, plasminogen activator inhibitor type 1 product : serine (or cysteine) proteinase inhibitor, clade E, member 1 protein_id : NP_032897.1

name	Trim56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235779 CCDS:CCDS19762.1 GeneID:384309 MGI:2685298
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 56 protein_id : NP_958761.1

name	Muc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254624 GeneID:666339 MGI:1203527
definition	codon_start : 1 product : mucin 3 protein_id : XP_355711.6

name	LOC100040941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254626 GeneID:100040941
definition	codon_start : 1 product : similar to mucin 3 protein_id : XP_001475581.1

name	Ache (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928664 CCDS:CCDS19763.1 GeneID:11423 MGI:87876
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003990 - acetylcholinesterase activity [Evidence IDA]; GO:0004104 - cholinesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0043236 - laminin binding [Evidence IPI]; GO:0043621 - protein self-association [Evidence IPI]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006581 - acetylcholine catabolism [Evidence IDA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA]; GO:0045212 - neurotransmitter receptor biosynthesis [Evidence IMP]; GO:0051262 - protein tetramerization [Evidence IDA]; GO:0031623 - receptor internalization [Evidence IMP]; GO:0001919 - regulation of receptor recycling [Evidence IMP]; GO:0002073 - retina development (sensu Mammalia) [Evidence IMP] codon_start : 1 note : acetylcholinesterase (MGD\|MGI:87876 GB\|NM_009599, evidence: BLASTN, 99%, match=1845); putative product : acetylcholinesterase protein_id : NP_033729.1

name	2700038N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13899211 CCDS:CCDS19764.1 GeneID:70240 MGI:1917490
definition	codon_start : 1 product : Ufm1-specific protease 1 protein_id : NP_081632.1

name	Ars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937395 GeneID:83701 MGI:1933527
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0046685 - response to arsenic [Evidence TAS] codon_start : 1 product : arsenate resistance protein 2 protein_id : NP_113582.1

name	Trip6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755879 CCDS:CCDS19765.1 GeneID:22051 MGI:1343458
definition	GO_component : GO:0005925 - focal adhesion [Evidence ISS]; GO:0045323 - interleukin-1 receptor complex [Evidence ISS] GO_function : GO:0005149 - interleukin-1 receptor binding [Evidence ISS]; GO:0019900 - kinase binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048041 - focal adhesion formation [Evidence ISS]; GO:0030335 - positive regulation of cell migration [Evidence ISS]; GO:0008588 - release of cytoplasmic sequestered NF-kappaB [Evidence ISS] codon_start : 1 product : thyroid receptor-interacting protein 6 protein_id : NP_035769.1

name	Slc12a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937397 CCDS:CCDS19766.1 GeneID:83704 MGI:1933532
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] codon_start : 1 exception : mismatches in translation note : cation-chloride cotransporter-interacting protein 1 product : solute carrier family 12 (potassium/chloride transporters), member 9 protein_id : NP_113583.1

name	Ephb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059093 CCDS:CCDS19767.1 GeneID:13846 MGI:104757
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005003 - ephrin receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Eph receptor B4 protein_id : NP_034274.3

name	Zan (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048477 GeneID:22635 MGI:106656
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : zonadhesin protein_id : NP_035871.1

name	Epo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21389309 GeneID:13856 MGI:95407
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005128 - erythropoietin receptor binding [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence IDA]; GO:0043249 - erythrocyte maturation [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence IDA] codon_start : 1 product : erythropoietin protein_id : NP_031968.1

name	Pop7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13899215 CCDS:CCDS19768.1 GeneID:74097 MGI:1921347
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : Pop7 homolog product : RPP20 protein protein_id : NP_083029.1

name	EG666372 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94375722 GeneID:666372 MGI:3646351
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988512.1

name	Perq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937399 GeneID:57330 MGI:1888677
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0048009 - insulin-like growth factor receptor signaling pathway [Evidence IPI] codon_start : 1 exception : mismatches in translation product : PERQ amino acid rich, with GYF domain 1 protein_id : NP_113596.1

name	Gnb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937391 CCDS:CCDS19769.1 GeneID:14693 MGI:95784
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide-binding protein, beta-2 subunit protein_id : NP_034442.1

name	Actl6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937393 CCDS:CCDS19770.1 GeneID:83766 MGI:1933548
definition	GO_component : GO:0005884 - actin filament [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016514 - SWI/SNF complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IDA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IC] codon_start : 1 note : actin-like 6 product : actin-like 6B protein_id : NP_113581.1

name	Trfr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113204630 GeneID:50765 MGI:1354956
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004325 - ferrochelatase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004998 - transferrin receptor activity [Evidence TAS] GO_process : GO:0006783 - heme biosynthesis [Evidence IEA]; GO:0006879 - iron ion homeostasis [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : transferrin receptor 2 protein_id : NP_056614.3

name	Mospd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077073 CCDS:CCDS19771.1 GeneID:68929 MGI:1916179
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP] codon_start : 1 product : motile sperm domain containing 3 protein_id : NP_084313.1

name	Pcolce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490382 GeneID:18542 MGI:105099
definition	GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 product : procollagen C-proteinase enhancer protein protein_id : NP_032814.2

name	Fbxo24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20846641 GeneID:71176 MGI:1918426
definition	codon_start : 1 product : F-box only protein 24 protein_id : XP_132440.1

name	Lrch4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122701 CCDS:CCDS19772.1 GeneID:231798 MGI:1917193
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016605 - PML body [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IMP] codon_start : 1 product : leucine rich repeat protein 4, neuronal protein_id : NP_666276.1

name	Sap25 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126506314 GeneID:751865
definition	codon_start : 1 function : mSin3A-binding protein product : mSin3A-binding protein protein_id : NP_001075431.1

name	Irs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468905 CCDS:CCDS19773.1 GeneID:16369 MGI:1194882
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : insulin receptor substrate 3 protein_id : NP_034701.1

name	Hrbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039690 CCDS:CCDS19774.1 GeneID:231801 MGI:2443267
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : HIV-1 Rev-binding protein-like protein isoform 2 protein_id : NP_835456.1

name	Hrbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704138 GeneID:231801 MGI:2443267
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : HIV-1 Rev-binding protein-like protein isoform 1 protein_id : NP_663541.1

name	LOC624083 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254637 GeneID:624083
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476662.1

name	6430598A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537544 CCDS:CCDS19775.1 GeneID:243300 MGI:2443880
definition	codon_start : 1 product : RIKEN cDNA 6430598A04 gene protein_id : NP_780730.2

name	Tsc22d4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75750501 CCDS:CCDS19776.1 GeneID:78829 MGI:1926079
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TSC22-related inducible leucine zipper 2 protein_id : NP_076399.4

name	2010007H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076939 CCDS:CCDS19777.1 GeneID:69871 MGI:1922853
definition	codon_start : 1 product : hypothetical protein LOC69871 protein_id : NP_081518.1

name	Bcdin3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119672920 GeneID:231803 MGI:106477
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : bin3, bicoid-interacting 3, homolog protein_id : NP_659162.3

name	Zcwpw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749216 CCDS:CCDS19779.1 GeneID:381678 MGI:2685899
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, CW type with PWWP domain 1 protein_id : NP_001005426.1

name	Pilra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943820 CCDS:CCDS19780.1 GeneID:231805 MGI:2450529
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : cell surface receptor FDF03 product : paired immunoglobin-like type 2 receptor alpha protein_id : NP_705730.1

name	Pilrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875356 GeneID:170741 MGI:2450532
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : immunoglobulin-like cell surface receptor FDFACT, activating counterpart product : paired immunoglobin-like type 2 receptor beta protein_id : NP_573472.1

name	Pilrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701576 GeneID:545812 MGI:2450535
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : paired immunoglobin-like type 2 receptor beta 2 protein_id : NP_001020103.1

name	Cyp3a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681115 CCDS:CCDS19781.1 GeneID:13113 MGI:88610
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence ISS] codon_start : 1 note : cytochrome P450, steroid inducible 3a13 product : cytochrome P450, family 3, subfamily a, polypeptide 13 protein_id : NP_031845.1

name	Gje1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575910 CCDS:CCDS19782.1 GeneID:118446 MGI:2153041
definition	GO_component : GO:0005921 - gap junction [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005243 - gap-junction forming channel activity [Evidence ISS] GO_process : GO:0007267 - cell-cell signaling [Evidence ISS] codon_start : 1 note : connexin 29 product : gap junction membrane channel protein epsilon 1 protein_id : NP_536698.2

name	Azgp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304911 CCDS:CCDS19783.1 GeneID:12007 MGI:103163
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0005504 - fatty acid binding [Evidence ISS]; GO:0030106 - MHC class I receptor activity [Evidence IEA]; GO:0008320 - protein carrier activity [Evidence ISS]; GO:0004540 - ribonuclease activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0016042 - lipid catabolism [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0040014 - regulation of body size [Evidence NAS] codon_start : 1 exception : mismatches in translation note : zinc-alpha2-glycoprotein; major histocompatibility complex class I-like protein product : alpha-2-glycoprotein 1, zinc protein_id : NP_038506.1

name	EG243302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20846986 GeneID:243302 MGI:3645168
definition	codon_start : 1 product : similar to ribosomal protein S25 protein_id : XP_144599.1

name	LOC100041050 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254640 GeneID:100041050
definition	codon_start : 1 product : similar to putative protein kinase protein_id : XP_001475758.1

name	Smok3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63531706 GeneID:545814 MGI:3693943
definition	codon_start : 1 product : similar to putative protein kinase isoform 1 protein_id : XP_620264.1

name	Smok3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89941468 GeneID:622474 MGI:3615348
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : sperm motility kinase 2B protein_id : NP_001034978.1

name	Smok3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899729 GeneID:622486 MGI:3647925
definition	codon_start : 1 product : similar to putative protein kinase isoform 2 protein_id : XP_903490.1

name	Zkscan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27804319 CCDS:CCDS19789.1 GeneID:74570 MGI:1921820
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; zinc finger protein 36 (KOX 18) product : zinc finger protein 36 isoform 1 protein_id : NP_598667.2

name	Zkscan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68510029 CCDS:CCDS19788.1 GeneID:74570 MGI:1921820
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; zinc finger protein 36 (KOX 18) product : zinc finger protein 36 isoform 2 protein_id : NP_084145.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374182 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038168.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374184 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038169.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374190 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038170.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374186 CCDS:CCDS19790.1 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_035887.2

name	Zfp113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504487 CCDS:CCDS19791.1 GeneID:56314 MGI:1929116
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045321 - leukocyte activation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 113 protein_id : NP_062721.2

name	Cops6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563284 CCDS:CCDS19792.1 GeneID:26893 MGI:1349439
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : COP9 complex S6; COP9 (constitutive photomorphogenic), subunit 6 product : COP9 signalosome subunit 6 protein_id : NP_036132.1

name	Mcm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10242373 CCDS:CCDS19793.1 GeneID:17220 MGI:1298398
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IPI]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003697 - single-stranded DNA binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mini chromosome maintenance deficient 7 product : minichromosome maintenance complex component 7 protein_id : NP_032594.1

name	Ap4m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981143 CCDS:CCDS19794.1 GeneID:11781 MGI:1337063
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : adaptor-related protein complex AP-4 mu4 subunit; adaptor-related protein complex AP-4 mu 1 product : adaptor-related protein complex AP-4, mu 1 protein_id : NP_067367.2

name	Taf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678215 CCDS:CCDS19795.1 GeneID:21343 MGI:109129
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0016986 - transcription initiation factor activity [Evidence IEA] GO_process : GO:0051090 - regulation of transcription factor activity [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : TATA box binding protein (Tbp)-associated factor, RNA polymerase II, E; TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kDa product : TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_033341.1

name	2610019P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519939 GeneID:66455 MGI:1913705
definition	codon_start : 1 product : hypothetical protein LOC66455 protein_id : NP_848727.1

name	BC038925 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244490 CCDS:CCDS19796.1 GeneID:330216 MGI:2679717
definition	codon_start : 1 product : hypothetical protein LOC330216 protein_id : NP_808546.1

name	BC055004 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625603 GeneID:381680 MGI:3584036
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC381680 protein_id : NP_001013795.2

name	0910001L09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487393 GeneID:66096 MGI:1913346
definition	codon_start : 1 product : hypothetical protein LOC66096 protein_id : NP_001074577.1

name	BC037034 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346609 GeneID:231807 MGI:2385896
definition	codon_start : 1 product : hypothetical protein LOC231807 protein_id : NP_694801.1

name	Gal3st4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370027 CCDS:CCDS19798.1 GeneID:330217 MGI:1916254
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0050694 - galactose 3-O-sulfotransferase activity [Evidence ISS]; GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0009101 - glycoprotein biosynthesis [Evidence ISS] codon_start : 1 product : galactose-3-O-sulfotransferase 4 protein_id : NP_001028588.1

name	Gpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369537 CCDS:CCDS19799.1 GeneID:71951 MGI:1919201
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : glypican 2 (cerebroglycan) protein_id : NP_766000.1

name	Stag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394370 GeneID:50878 MGI:1355311
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000795 - synaptonemal complex [Evidence IDA]; GO:0000802 - transverse filament [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence IEA]; GO:0007066 - female meiosis sister chromatid cohesion [Evidence ISS]; GO:0007065 - male meiosis sister chromatid cohesion [Evidence ISS]; GO:0007126 - meiosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : stromalin 3 product : stromal antigen 3 protein_id : NP_058660.1

name	2610020C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254177 GeneID:72154 MGI:1919404
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72154 protein_id : NP_082406.2

name	1700123K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386432 GeneID:76658 MGI:1923908
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76658 protein_id : NP_083969.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305647 CCDS:CCDS19801.1 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 68 isoform a protein_id : NP_038872.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680984 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : zinc finger protein 68 isoform b protein_id : NP_001038212.1

name	A430033K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942100 GeneID:243308 MGI:3583896
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243308 protein_id : NP_898846.1

name	BC004044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385516 GeneID:80752 MGI:2136853
definition	codon_start : 1 note : dentin matrix protein 4 product : cDNA sequence BC004044 protein_id : NP_085042.1

name	EG384244 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254650 GeneID:384244 MGI:3646467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357518.6

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 1 pseudo : _no_value

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 2 pseudo : _no_value

name	LOC677021 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677021
definition	number : 3 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 1 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 2 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 3 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 4 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 5 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 6 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 7 pseudo : _no_value

name	LOC639992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639992
definition	number : 8 pseudo : _no_value

name	LOC100041016 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041016
definition	number : 1 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 1 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 2 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 3 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 4 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 1 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 2 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 3 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 4 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 5 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 6 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 7 pseudo : _no_value

name	EG665591 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254634 GeneID:665591 MGI:3643602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : predicted gene, EG665591 pseudo : _no_value transcript_id : XR_001861.2

name	EG640050 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254635 GeneID:640050 MGI:3647212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 368 ESTs, 4 Proteins product : predicted gene, EG640050 pseudo : _no_value transcript_id : XR_001865.2

name	LOC666429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254638 GeneID:666429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Zwint protein pseudo : _no_value transcript_id : XR_032379.1

name	Gm454 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254641 GeneID:243303 MGI:2685300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : gene model 454, (NCBI) transcript_id : XR_032409.1

name	LOC433955 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254642 GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins product : similar to HSPC008 pseudo : _no_value transcript_id : XR_033167.1

name	LOC665882 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254643 GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to Ribosomal protein L17 pseudo : _no_value transcript_id : XR_033203.1

clone name	MSMg01-175O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349M10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-415N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293E01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-287P14.b	B6Ng01-287P14.g
ACC	GA085758	GA085759
length	1,185	256
definition	B6Ng01-287P14.b	B6Ng01-287P14.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagaggtgggcatggtcaaggctgtggtggcctcagtgctggttc tgtaagaaggtcatcttgtttttacccatgacaaggtgccataggcttcc tgaagacatgattgtacaagaggaagtggcatcaatctccctgagtgaca tgtgcagaggcatcttcccatttccttagctttcctggcattgattgtct tgttcatgattccctgcaactggctatgcagctttccctctctcatgtct gcttgtctgccttcctcacagagcctgtgttactaagatcccttgacctg agccagacacaaattgtcatggactcactgccagctacacccagacagac ttctgtatccatagtacccttggagacagggaggctcagaaactttggga taagttggctcctgttggaaggtcaatcaggacatggattagggatctaa aacttgtcagaatgagccttctgtttgtttgcttgtgtctgtgtgtgatt gtgtgtatgtgtgcttaaaatcatctcaagtatccctggctggtccttga acttgttatgtagccaaggatgaccatgaactactacagatcctccagca tggtcctcccatgagctgggattacaggtgcgaaccattgtgtcccttta tctattgttggacataaaacctttggttctttgcatgtcagaaagtacga actccaccacatgaaccacattcttagctgcagggaggtctgcaaggatg tcctggccatgagttctcacctccagatttcttctgcctttcgcttactc tctggggtttctgggtaaatggtgactcaactgctaactcacctgagaag gggctggaactgacaagactgccatatgtaatgtgttggacccaagcatt tttacacaacagcctctgggtgggtttttacagggccccttgtgccctgt tccactggtgcacctgctggctccttatctcgggtgatgagctcttgtgt ttcatgtctgggattcagctgatcctggtggagaccctgctgtgggggtg tgattcctgtcaaggatgctgtcaatcaggttccttgggaggtcatctgc attccaaatacagtgactaaatgcatgacaatcaactgccttccaaggga aggtatcttgaatgaccttcgagctttttgggtgg	acagcagctgtggcctccagcatgaaatctgcccaaaatcaagcattgca ccctgactaacccatcccgggaacattgacagttgatgacatccagaaaa gacagtcattcctccttaaggatgtggctcctggtagatcaaccacactc cagtggatgcccccacactcatgaacatatgacagcaggttagtaaacaa gtacatgaattttgtgggttgtgggagtgactgtggggagggatctggga tgagtg
quality values	Open. Hide. 58 33 25 37 58 26 20 43 58 54 36 38 62 62 54 54 52 47 62 62 62 47 56 54 62 62 62 62 62 62 42 42 31 34 22 21 41 50 51 41 51 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 59 59 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 54 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 44 47 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 49 58 58 58 58 58 58 53 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 54 49 58 58 54 52 58 54 58 58 58 58 58 54 58 54 58 54 58 58 54 58 58 58 58 52 58 58 58 54 58 48 54 58 58 58 52 58 54 46 58 49 58 32 36 51 58 41 42 40 58 58 58 53 58 53 58 58 58 58 54 49 54 58 58 58 51 49 51 42 35 53 58 51 52 58 58 50 58 58 51 41 58 58 46 58 49 49 33 54 58 58 58 58 36 41 51 50 52 52 36 49 39 51 58 32 38 50 39 41 37 54 54 54 49 58 52 58 41 49 51 58 47 41 39 51 42 49 30 49 51 22 51 33 44 46 23 50 46 17 58 58 47 32 50 58 58 50 50 41 50 51 52 51 58 32 37 50 39 49 53 42 52 35 23 54 54 54 41 42 42 32 30 54 49 41 45 53 52 24 35 35 26 45 38 49 31 33 35 31 37 32 49 40 51 49 41 54 25 40 31 47 47 27 41 24 42 54 28 21 18 37 33 40 37 37 40 35 19 12 20 30 25 39 38 45 39 35 30 37 39 42 34 38 37 53 19 51 37 33 20 33 31 31 53 34 31 32 31 28 33 17 51 40 42 26 52 45 31 32 30 53 40 52 34 32 23 52 53 32 34 31 32 39 34 45 25 33 51 51 32 24 36 31 41 33 42 51 45 21 26 51 37 31 32 36 29 31 37 31 39 39 34 32 31 28 33 35 32 31 33 33 39 32 33 38 14 31 41 31 9 44 31 9 48 46 26 21 33 31 46 33 31 31 43 32 30 26 23 31 26 31 21 31 42 21 31 26 34 32 33 33 31 34 31 31 30 21 29 24 44 32 30 37 10 36 37 7 21 20 30 34 43 48 48 48 31 24 33 18 10 18 7 31 26 18 32 23 25 19 29 17 36 13 18 19 44 21 25 41 44 28 6 7 10 14 21 44 29 29 43 41 38 19 36 33 18 20 21 44 22 20 26 15 18 24 8 25 24 27 26 26 18 20 23 5 7 8 6 16 34 32 18 22 12 7 6 48 32 10 25 10 15 9 29 9 39 28 12 18 22 10 10 29 14 32 14 18 9 6 4 8 20 22 36 17 15 28 17 37 22 10 31 6 30 7 28 24 24 20 19 13 22 13 5 16 3 12 24 6 12 6 6 12 9 28 12 28 24 47 28 20 14 16 6 7 7 14 28 27 30 11 4 8 7 7 23 13 5 5 6 6 6 8 6 8 7 15 8 27 13 19 27 15 27 24 13 8 9 16 15 15 7 4 20 6 6 21 8 8 26 16 6 11 7 4 1 2 8 3 3 3 7 5 2 2 6 5 21 6 28 18 4 1 2 5 7 6 10 12 7 16 9 10 8 4 3 1 1 1 2 1 2 7 9 10 3 5 1 2 6 17 4 7 18 3 2 11 6 13 20 9 17 7 21 4 3 2 2 3 4 1 5 2 5 3 4 6 4 1 3 7 4 3 1 10 5 6 4 17 8 17 16 10 9 5 15 5 13	Open. Hide. 42 56 44 56 54 51 22 38 32 34 28 29 29 28 50 62 62 44 43 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 54 59 59 62 54 62 62 62 59 62 62 49 54 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 24

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_138318308_138319685
seq2: B6Ng01-287P14.b_45_1229

seq1  GAATTCAGAGGTGGGCATGGTCAAGGCTGTGGTGGCCTCAGTGCTGGTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGAGGTGGGCATGGTCAAGGCTGTGGTGGCCTCAGTGCTGGTTC  50

seq1  TGTAAGAAGGTCATCTTGTTTTTACCCATGACAAGGTGCCATAGGCTTCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAGAAGGTCATCTTGTTTTTACCCATGACAAGGTGCCATAGGCTTCC  100

seq1  TGAAGACATGATTGTACAAGAGGAAGTGGCATCAATCTCCCTGAGTGACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGACATGATTGTACAAGAGGAAGTGGCATCAATCTCCCTGAGTGACA  150

seq1  TGTGCAGAGGCATCTTCCCATTTCCTTAGCTTTCCTGGCATTGATTGTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCAGAGGCATCTTCCCATTTCCTTAGCTTTCCTGGCATTGATTGTCT  200

seq1  TGTTCATGATTCCCTGCAACTGGCTATGCAGCTTTCCCTCTCTCATGTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCATGATTCCCTGCAACTGGCTATGCAGCTTTCCCTCTCTCATGTCT  250

seq1  GCTTGTCTGCCTTCCTCACAGAGCCTGTGTTACTAAGATCCCTTGACCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGTCTGCCTTCCTCACAGAGCCTGTGTTACTAAGATCCCTTGACCTG  300

seq1  AGCCAGACACAAATTGTCATGGACTCACTGCCAGCTACACCCAGACAGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGACACAAATTGTCATGGACTCACTGCCAGCTACACCCAGACAGAC  350

seq1  TTCTGTATCCATAGTACCCTTGGAGACAGGGAGGCTCAGAAACTTTGGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGTATCCATAGTACCCTTGGAGACAGGGAGGCTCAGAAACTTTGGGA  400

seq1  TAAGTTGGCTCCTGTTGGAAGGTCAATCAGGACATGGATTAGGGATCTAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTTGGCTCCTGTTGGAAGGTCAATCAGGACATGGATTAGGGATCTAA  450

seq1  AACTTGTCAGAATGAGCCTTCTGTTTGTTTGCTTGTGTCTGTGTGTGATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGTCAGAATGAGCCTTCTGTTTGTTTGCTTGTGTCTGTGTGTGATT  500

seq1  GTGTGTATGTGTGCTTAAAATCATCTCAAGTATCCCTGGCTGGTCCTTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTATGTGTGCTTAAAATCATCTCAAGTATCCCTGGCTGGTCCTTGA  550

seq1  ACTTGTTATGTAGCCAAGGATGACCATGAACTACTACAGATCCTCCAGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGTTATGTAGCCAAGGATGACCATGAACTACTACAGATCCTCCAGCA  600

seq1  TGGTCCTCCCATGAGCTGGGATTACAGGTGCGAACCATTGTGTCCCTTTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCCTCCCATGAGCTGGGATTACAGGTGCGAACCATTGTGTCCCTTTA  650

seq1  TCTATTGTTGGACATAAAACCTTTGGTTCTTTGCATGTCAGAAAGTACGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATTGTTGGACATAAAACCTTTGGTTCTTTGCATGTCAGAAAGTACGA  700

seq1  ACTCCACCACATGAACCACATTCTTAGCTGCAGGGAGGTCTGCAAGGATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCACCACATGAACCACATTCTTAGCTGCAGGGAGGTCTGCAAGGATG  750

seq1  TCCTGGCCATGAGTTCTCACCTCCAGATTTCTTCTGCCTTTCGCTTACTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGCCATGAGTTCTCACCTCCAGATTTCTTCTGCCTTTCGCTTACTC  800

seq1  TCTGGGGTTTCTGGGTAAATGGTGACTCAACTGCTAACTCACCTGAGAAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGGTTTCTGGGTAAATGGTGACTCAACTGCTAACTCACCTGAGAAG  850

seq1  GGGCTGGAACTGACAAGACTGCCATATGTAATGTGTTGGACCCAAGCATT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGGAACTGACAAGACTGCCATATGTAATGTGTTGGACCCAAGCATT  900

seq1  TTTACACAACAGCCTCT-GGTGGG-TTTTACAGGGCCCCTTGTGCCCTGT  948
      ||||||||||||||||| |||||| |||||||||||||||||||||||||
seq2  TTTACACAACAGCCTCTGGGTGGGTTTTTACAGGGCCCCTTGTGCCCTGT  950

seq1  TCCACTGGTGCCACCTGCTGGCTCCTTAATCTCGGGTGATGAGCTCTGTT  998
      |||||||||| |||||||||||||||| |||||||||||||||||||  |
seq2  TCCACTGGTG-CACCTGCTGGCTCCTT-ATCTCGGGTGATGAGCTCTTGT  998

seq1  GTTTCATGTCTTGGATTCAGCTGAATCCCTGTGGAGACCCTGCTGT-GGG  1047
      ||||||||||| ||||||||||| ||||  |||||||||||||||| |||
seq2  GTTTCATGTCTGGGATTCAGCTG-ATCCTGGTGGAGACCCTGCTGTGGGG  1047

seq1  GTGTGATT-CTGTTCAGGATGCTGTC-ATCAGTTTCCT--GGAGTGTCAT  1093
      |||||||| ||||  ||||||||||| ||||| |||||  |||| |||||
seq2  GTGTGATTCCTGTCAAGGATGCTGTCAATCAGGTTCCTTGGGAG-GTCAT  1096

seq1  CCTGCTTTCCCAATACCAGTGACT--ATGCCCTGCCATCATACTGCTTTC  1141
       |||| |||| |||| ||||||||  ||||    | |||| ||||| |||
seq2  -CTGCATTCCAAATA-CAGTGACTAAATGCATGACAATCA-ACTGCCTTC  1143

seq1  CCAGGGGAGGGGCACTCCCTGGAAATGAGCATTCTGAGCTTTTGGTGTGG  1191
      | |||| |||     |  || | ||||| | ||| |||||||| | ||||
seq2  CAAGGGAAGG-----TATCTTG-AATGA-CCTTC-GAGCTTTTTGGGTGG  1185

seq1  ACACTAGGAGCTTCTGCACACCCTGGGATCATGCAGGTTGTCAGAATGCA  1241
                                                        
seq2  --------------------------------------------------  1185

seq1  ATGTTAGAACATAGTATGGTTTAGTCAGTAGTGCATGTGCGCCCTGCCTC  1291
                                                        
seq2  --------------------------------------------------  1185

seq1  CTACAATATAAATAATTAAGTGTATTAAAAAAAAAAGCCCAAGATGGGTA  1341
                                                        
seq2  --------------------------------------------------  1185

seq1  TGGTAATCTATGTCTTTAATTCAAGCTTTTTGGGTGG  1378
                                           
seq2  -------------------------------------  1185

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information