MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-290E05
Chromosome	5 (Build37)
Map Location	105,430,376 - 105,431,029
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Hsd17b11, Nudt9, Sparcl1, LOC100041136, Dspp, Dmp1, LOC100041145, Ibsp, Mepe, Spp1, Pkd2, BC005561, LOC100042165, LOC100041172, D930016D06Rik, 2310012P17Rik, LOC640963, LOC100041199, LOC666726, C230055K05Rik, LOC100041216, Abcg3, LOC626471, EG545790
Downstream gene	5830443L24Rik, BC057170, Gbp4, LOC675363, LOC626578, Mpa2l, EG634650, Lrrc8b, Lrrc8c, Lrrc8d, LOC100042335, D830014E11Rik, LOC100042349, Zfp326, LOC626723
Link	Open Mouse BAC browser

Click to get alignment info.

name	Hsd17b11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114664 MGI:2149821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74167 MGI:1921417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sparcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13602 MGI:108110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041136 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Dspp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666279 MGI:109172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13406 MGI:94910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ibsp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15891 MGI:96389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mepe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94111 MGI:2137384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20750 MGI:98389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18764 MGI:1099818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC005561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243171 MGI:3040669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs

name	LOC100042165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 72 ESTs, 6 Proteins

name	LOC100041172 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	D930016D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100662 MGI:2442700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	2310012P17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69623 MGI:1916873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC640963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs pseudo : _no_value

name	LOC100041199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC666726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 10 Proteins pseudo : _no_value

name	C230055K05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626391 MGI:2441896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041216 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Abcg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27405 MGI:1351624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	EG545790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545790 MGI:3644057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 2 Proteins

name	5830443L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76074 MGI:1923324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236573 MGI:3605620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17472 MGI:97072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins pseudo : _no_value

name	LOC626578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpa2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100702 MGI:2140937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG634650 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634650 MGI:3646307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433926 MGI:2141353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc8c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100604 MGI:2140839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc8d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231549 MGI:1922368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042335 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 869 ESTs, 7 Proteins

name	D830014E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320751 MGI:2444658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042349 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 4097 ESTs, 22 Proteins

name	Zfp326 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54367 MGI:1927246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626723 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins pseudo : _no_value

name	Hsd17b11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131125 GeneID:114664 MGI:2149821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 11 transcript_id : NM_053262.3

name	Nudt9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387632 GeneID:74167 MGI:1921417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 9 transcript_id : NM_028794.3

name	Sparcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982799 GeneID:13602 MGI:108110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPARC-like 1 (mast9, hevin) transcript_id : NM_010097.2

name	Dspp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120321 GeneID:666279 MGI:109172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dentin sialophosphoprotein transcript_id : NM_010080.2

name	Dmp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900498 GeneID:13406 MGI:94910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dentin matrix protein 1 transcript_id : NM_016779.2

name	LOC100041145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254065 GeneID:100041145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041145 transcript_id : XM_001475877.1

name	Ibsp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680334 GeneID:15891 MGI:96389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin binding sialoprotein transcript_id : NM_008318.1

name	Mepe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716458 GeneID:94111 MGI:2137384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix extracellular phosphoglycoprotein with ASARM motif (bone) transcript_id : NM_053172.1

name	Spp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678112 GeneID:20750 MGI:98389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secreted phosphoprotein 1 transcript_id : NM_009263.1

name	Pkd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543486 GeneID:18764 MGI:1099818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 2 transcript_id : NM_008861.2

name	BC005561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254068 GeneID:243171 MGI:3040669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 26 ESTs product : cDNA sequence BC005561 transcript_id : XM_001475896.1

name	LOC100042165 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254138 GeneID:100042165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 72 ESTs, 6 Proteins product : similar to THO complex 2 transcript_id : XM_001478280.1

name	LOC100041172 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254071 GeneID:100041172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041172 transcript_id : XM_001475917.1

name	D930016D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254140 GeneID:100662 MGI:2442700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA D930016D06 gene transcript_id : XM_001478291.1

name	2310012P17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254079 GeneID:69623 MGI:1916873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 2310012P17 gene transcript_id : XM_001487796.1

name	C230055K05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778966 GeneID:626391 MGI:2441896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230055K05 gene transcript_id : NM_001039231.2

name	Abcg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66932958 GeneID:27405 MGI:1351624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family G (WHITE), member 3 transcript_id : NM_030239.2

name	EG545790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254143 GeneID:545790 MGI:3644057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 2 Proteins product : predicted gene, EG545790 transcript_id : XM_620236.4

name	5830443L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292436 GeneID:76074 MGI:1923324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830443L24 gene transcript_id : NM_029509.4

name	BC057170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129953 GeneID:236573 MGI:3605620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057170 transcript_id : NM_172777.2

name	Gbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157520 GeneID:17472 MGI:97072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate nucleotide binding protein 4 transcript_id : NM_008620.3

name	LOC626578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:116812913 GeneID:626578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage activation 2 like LOC626578 transcript_id : NM_001039646.2

name	Mpa2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996502 GeneID:100702 MGI:2140937
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage activation 2 like transcript_id : NM_194336.1

name	EG634650 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900482 GeneID:634650 MGI:3646307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG634650 transcript_id : NM_001039647.1

name	Lrrc8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446106 GeneID:433926 MGI:2141353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8 family, member B transcript_id : NM_001033550.2

name	Lrrc8c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129793 GeneID:100604 MGI:2140839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8 family, member C transcript_id : NM_133897.2

name	Lrrc8d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982310 GeneID:231549 MGI:1922368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8D transcript_id : NM_178701.2

name	LOC100042335 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254144 GeneID:100042335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 869 ESTs, 7 Proteins product : similar to hCG1994130 transcript_id : XM_001478495.1

name	D830014E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371498 GeneID:320751 MGI:2444658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830014E11 gene transcript_id : NM_177251.3

name	LOC100042349 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254146 GeneID:100042349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 4097 ESTs, 22 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001478544.1

name	Zfp326 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055385 GeneID:54367 MGI:1927246
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 326 transcript_id : NM_018759.1

name	Hsd17b11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716597 CCDS:CCDS19481.1 GeneID:114664 MGI:2149821
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : retinal short-chain dehydrogenase/reductase SDR2; retinal short-chain dehydrogenase/reductase 2 product : dehydrogenase/reductase (SDR family) member 8 protein_id : NP_444492.1

name	Nudt9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753998 CCDS:CCDS19482.1 GeneID:74167 MGI:1921417
definition	GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0047631 - ADP-ribose diphosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA] GO_process : GO:0046032 - ADP catabolism [Evidence IDA]; GO:0046709 - IDP catabolism [Evidence IDA] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 9 protein_id : NP_083070.2

name	Sparcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982800 CCDS:CCDS19483.1 GeneID:13602 MGI:108110
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : extracellular matrix protein 2 product : SPARC-like 1 (mast9, hevin) protein_id : NP_034227.2

name	Dspp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120322 GeneID:666279 MGI:109172
definition	codon_start : 1 product : dentin sialophosphoprotein protein_id : NP_034210.2

name	Dmp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900499 CCDS:CCDS19484.1 GeneID:13406 MGI:94910
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IEA]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 note : serine rich acidic phosphoprotein product : dentin matrix protein 1 protein_id : NP_058059.2

name	LOC100041145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254066 GeneID:100041145
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475927.1

name	Ibsp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680335 CCDS:CCDS19485.1 GeneID:15891 MGI:96389
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 exception : mismatches in translation function : possible involvement in mineralization and cell adhesion note : bone sialoprotein II product : integrin binding sialoprotein protein_id : NP_032344.1

name	Mepe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716459 GeneID:94111 MGI:2137384
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030502 - negative regulation of bone mineralization [Evidence IMP]; GO:0001501 - skeletal development [Evidence TAS] codon_start : 1 note : osteoregulin product : matrix extracellular phosphoglycoprotein with ASARM motif protein_id : NP_444402.1

name	Spp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678113 CCDS:CCDS19486.1 GeneID:20750 MGI:98389
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS]; GO:0005576 - extracellular region [Evidence NAS]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence NAS] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence ISS]; GO:0005178 - integrin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence NAS]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence ISS]; GO:0050930 - induction of positive chemotaxis [Evidence ISS]; GO:0030595 - leukocyte chemotaxis [Evidence ISS]; GO:0030502 - negative regulation of bone mineralization [Evidence ISS]; GO:0001503 - ossification [Evidence IEA]; GO:0042102 - positive regulation of T cell proliferation [Evidence ISS]; GO:0045637 - regulation of myeloid cell differentiation [Evidence ISS]; GO:0042088 - T-helper 1 type immune response [Evidence ISS] codon_start : 1 exception : mismatches in translation note : osteopontin; bone sialoprotein; 44 kDa bone phosphoprotein; 44kDa bone phosphoprotein product : secreted phosphoprotein 1 protein_id : NP_033289.1

name	Pkd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543487 CCDS:CCDS19487.1 GeneID:18764 MGI:1099818
definition	GO_component : GO:0005932 - basal body [Evidence ISS]; GO:0005929 - cilium [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence TAS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0050974 - detection of mechanical stimulus during sensory perception [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : polycystin-2 product : polycystin 2 protein_id : NP_032887.2

name	BC005561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254069 GeneID:243171 MGI:3040669
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475946.1

name	LOC100042165 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254139 GeneID:100042165
definition	codon_start : 1 product : similar to THO complex 2 protein_id : XP_001478330.1

name	LOC100041172 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254072 GeneID:100041172
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475967.1

name	D930016D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254141 GeneID:100662 MGI:2442700
definition	codon_start : 1 product : hypothetical protein LOC100662 protein_id : XP_001478341.1

name	2310012P17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254080 GeneID:69623 MGI:1916873
definition	codon_start : 1 product : similar to CDNA sequence BC002059 protein_id : XP_001487846.1

name	C230055K05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778967 GeneID:626391 MGI:2441896
definition	codon_start : 1 product : similar to Zinc finger protein 124 (HZF-16) protein_id : NP_001034320.2

name	Abcg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66932959 CCDS:CCDS19488.1 GeneID:27405 MGI:1351624
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP-binding cassette, subfamily G, member 3 protein_id : NP_084515.2

name	EG545790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63530558 GeneID:545790 MGI:3644057
definition	codon_start : 1 product : similar to protein translocation complex beta subunit protein_id : XP_620236.1

name	5830443L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776551 CCDS:CCDS19490.1 GeneID:76074 MGI:1923324
definition	codon_start : 1 product : guanylate binding protein 8 protein_id : NP_083785.3

name	BC057170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370144 GeneID:236573 MGI:3605620
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : guanylate binding protein family, member 6 protein_id : NP_766365.1

name	Gbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157521 GeneID:17472 MGI:97072
definition	codon_start : 1 note : guanylate-binding protein 4 homolog product : macrophage activation 2 protein_id : NP_032646.2

name	LOC626578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:116812914 GeneID:626578
definition	codon_start : 1 product : hypothetical protein LOC626578 protein_id : NP_001034735.2

name	Mpa2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996503 CCDS:CCDS19492.1 GeneID:100702 MGI:2140937
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : macrophage activation 2 like protein_id : NP_919317.1

name	EG634650 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900483 GeneID:634650 MGI:3646307
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC634650 protein_id : NP_001034736.1

name	Lrrc8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677565 GeneID:433926 MGI:2141353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : T-cell activation leucine repeat-rich protein product : leucine rich repeat containing 8 family, member B protein_id : NP_001028722.1

name	Lrrc8c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923058 CCDS:CCDS19493.1 GeneID:100604 MGI:2140839
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : factor for adipocyte differentiation 158 product : AD158 protein_id : NP_598658.1

name	LOC100042335 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254145 GeneID:100042335
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_001478545.1

name	Lrrc8d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982311 CCDS:CCDS19494.1 GeneID:231549 MGI:1922368
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : leucine-rich repeat-containing 5 product : leucine rich repeat containing 5 protein_id : NP_848816.2

name	D830014E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893313 GeneID:320751 MGI:2444658
definition	codon_start : 1 product : hypothetical protein LOC320751 protein_id : NP_796225.1

name	LOC100042349 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254147 GeneID:100042349
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001478594.1

name	Zfp326 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055386 CCDS:CCDS19496.1 GeneID:54367 MGI:1927246
definition	GO_component : GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 326 protein_id : NP_061229.1

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 11 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 10 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 9 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 8 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 7 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 6 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 5 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 4 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 3 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 2 pseudo : _no_value

name	LOC100041136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041136
definition	number : 1 pseudo : _no_value

name	LOC100041199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041199
definition	number : 1 pseudo : _no_value

name	LOC100041216 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041216
definition	number : 4 pseudo : _no_value

name	LOC100041216 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041216
definition	number : 3 pseudo : _no_value

name	LOC100041216 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041216
definition	number : 2 pseudo : _no_value

name	LOC100041216 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041216
definition	number : 1 pseudo : _no_value

name	LOC626471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626471
definition	number : 2 pseudo : _no_value

name	LOC626471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626471
definition	number : 1 pseudo : _no_value

name	LOC640963 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254142 GeneID:640963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs product : similar to STAT3-interacting protein as a repressor pseudo : _no_value transcript_id : XR_033637.1

name	LOC666726 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254081 GeneID:666726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 10 Proteins product : similar to 4932441K18Rik protein pseudo : _no_value transcript_id : XR_032503.1

name	LOC675363 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254090 GeneID:675363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : similar to CDNA sequence BC057170 pseudo : _no_value transcript_id : XR_032536.1

name	LOC626723 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254101 GeneID:626723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_032604.1

clone name	MSMg01-075L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-131D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-204E02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-270L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368L20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-106F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-531K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064L02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515I15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-089M16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-496G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-290O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-055N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-066H01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-235O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-455A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-290E05.b	B6Ng01-290E05.g
ACC	GA087446	GA087447
length	654	1,054
definition	B6Ng01-290E05.b	B6Ng01-290E05.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccagtaacattgcacctttcattgtgcttgaactgccaaaaaact ctccctctgtgttaaaaatttatctatgttctgccaagtctgataatgtg acctgtttgggacttatgatgggaagagagaggtaaattctgcatgaatt gtaattctactctgaactgcatagcacacctacacacaccacctggccca gaacgaatagaaacctgtataaagtttttacttactgaatgtacagttag agagctactcaaacacaagcagggttaggagcactgagattgaactctcc tataaccagctttggacctcctatctctaatattaaggaagggtttgaat gcctcctgctcccacatgtctgtttagaatttgaaataccatgagaactg agggaaagtatcacagtttttcccccataagaacatcaaacaccagggca gggagggaaggagcatcatgattaaccttacatatgatgaaattatctta ggaaagggaggcatgtggaagggacgtgtggaggaggcaggtctggagtt ggcaggtttgaaggaggcaggtgtggaagtggcaggtgtggaagtggcag gtgtggaggaaacaggtatggagaagacaggtgtggaggtggtaggtgtg ggga	gaattcaatgtcacaggagacacccttctgaacagaatactaatagtgca gaaactaagataaattcataaattggacctcatggaacagtgaggttttt ctaaggtcaaagcccagacaattggacaaatagacagtctaaggaatgag aaaagtatttgtacaatttaaacatacctgataaacttgtaatatacaaa aatatatacagacctcacaaaactagatgatctaaaatcaaaaactccag ataaaaaatagggtagagatttaaaccatgaattctcaacagacaatctg ttgataatggctgagaaactcttaaagaaatgttcaccatccttacccat tatggaattgcaaatgaaaactactttgtgagtccatgttacatgtcaca atggtgaagataactaacacaaatgattttcatattagtgagaatataaa gcaagtgtgacaccttctactgcttataggagtgcagacaaatatggcca ataagggaaccagtatcatgattcctcaggaaactgggaatgcatccacc tcaggaccaagctatatcagtcttcggcataaatgaaaaaggtactccat ccagcaacccaggacacatgctcacctatgtttataacagcttcatttgt attagacagaaggtaaaaacacatagatgttccacagctgaaaactggag aaacaaatgtggtatgtctgtacaatggagtatcactcagctgctaaaaa tatgacaacatgaaatgactgcagcacaacaggctgatgactgcagctag agtaaaatcaccctacctgaggtaacccagacttagaatgatgtaatgtt atacattcccccataagtggatattagctcttaggtaaattttaatgaag ctatcccccacaggcccagagaggttatgtaaagagagagatggagaggt gacacagacatcttttctgcaagcagaaaatagaatagactctctgggta gactgaggtaaatggggaaagaagtggtagggtcattatggggagggggg aatg
quality values	Open. Hide. 62 47 19 31 62 62 25 17 62 62 62 56 56 42 49 62 62 47 56 62 62 62 62 62 43 43 59 62 62 62 62 62 62 62 49 33 43 59 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 54 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 59 62 62 62 62 59 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 41 45 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 48 58 58 58 58 54 54 58 58 58 54 47 58 54 58 58 58 58 58 42 58 58 58 58 48 58 58 51 42 58 58 47 58 58 58 58 58 58 58 40 58 58 46 38 54 58 58 58 58 58 39 37 58 49 32 58 51 58 39 58 58 51 58 58 58 58 50 58 58 58 58 52 53 49 58 49 58 58 58 58 58 33 58 58 39 58 42 54 33 58 51 54 54 58 58 58 58 38 58 58 58 44 51 46 58 51 54 54 54 50 54 54 37 54 54 54 44 47 41 54 51 51 54 54 54 46 31 54 54 54 54 42 51 49 54 52 42 46 54 54 54 33 54 54 29 35 32 51 46 54 51 54 54 54 33 42 30 30 25 54 51 47 51 42 54 41 40 40 40 46 46 40 17	Open. Hide. 62 47 33 47 62 47 42 62 62 62 62 47 51 62 47 56 62 32 32 41 42 62 47 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 54 54 62 62 54 54 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 54 58 58 58 54 58 58 58 58 45 58 58 58 58 58 54 58 58 58 54 54 58 58 54 58 54 58 58 58 58 58 54 54 58 58 41 58 58 54 42 58 58 58 58 48 58 58 58 58 58 58 47 58 52 54 58 58 58 52 58 58 58 54 48 37 58 45 25 44 48 58 51 58 58 58 54 51 58 51 51 58 58 53 58 58 58 51 49 49 50 54 52 58 54 46 58 58 58 58 58 51 37 49 31 51 47 58 54 44 48 58 53 51 49 52 51 51 50 51 58 44 49 36 58 44 46 49 49 50 58 58 58 58 51 46 49 58 51 53 51 58 54 58 43 50 52 52 50 51 53 52 52 58 53 49 37 51 58 54 54 50 50 49 39 53 41 54 34 53 52 58 50 20 58 29 53 58 58 58 50 50 43 49 50 51 50 47 28 37 54 52 52 52 54 42 49 44 34 54 49 54 54 52 51 40 30 44 54 44 51 34 54 54 35 40 19 49 51 40 51 53 54 54 33 54 34 54 37 54 51 46 37 40 52 25 51 38 54 42 30 24 45 33 37 45 53 37 54 42 52 30 52 41 39 45 47 31 54 49 49 31 45 32 35 52 36 28 31 33 46 29 52 45 53 51 45 36 52 32 32 32 53 37 34 39 53 32 33 32 32 52 32 20 46 30 42 31 31 30 33 31 31 31 42 31 31 31 42 36 30 30 35 31 36 31 51 46 31 36 39 32 30 40 33 31 30 22 46 31 33 29 13 43 30 30 31 32 41 41 32 26 35 20 32 41 30 33 38 36 31 42 33 26 42 34 36 34 31 46 20 33 17 31 28 32 29 32 26 31 46 46 46 32 25 31 31 31 32 32 39 30 27 24 25 26 32 36 21 31 41 31 31 30 23 22 18 18 31 44 29 24 48 48 33 7 26 34 31 18 30 16 25 34 33 38 32 41 41 41 44 31 36 19 25 25 33 36 44 23 31 32 17 37 19 26 25 29 19 21 30 29 24 37 25 21 25 10 43 7 28 13 21 20 22 19 37 19 25 11 17 13 23 24 15 11 30 21 24 30 27 13 21 13 19 48 34 6 8 23 22 31 8 12 7 19 16 7 8 40 34 11 19 13 13 21 9 22 19 9 20 16 28 24 27 24 27 23 34 19 5 9 9 17 13 13 10 12 9 15 27 25 38 14 19 21 32 34 19 11 40 16 16 16 31 16 26 10 22 6 5 12 32 20 17 27 20 9 2 3 6 6 19 22 10 18 15 27 28 28 28 14 4 9 7 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_105430376_105431029
seq2: B6Ng01-290E05.b_44_697 (reverse)

seq1  TCCCCACACCTACCACCTCCACACCTGTCTTCTCCATACCTGTTTCCTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCACACCTACCACCTCCACACCTGTCTTCTCCATACCTGTTTCCTCC  50

seq1  ACACCTGCCACTTCCACACCTGCCACTTCCACACCTGCCTCCTTCAAACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTGCCACTTCCACACCTGCCACTTCCACACCTGCCTCCTTCAAACC  100

seq1  TGCCAACTCCAGACCTGCCTCCTCCACACGTCCCTTCCACATGCCTCCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAACTCCAGACCTGCCTCCTCCACACGTCCCTTCCACATGCCTCCCT  150

seq1  TTCCTAAGATAATTTCATCATATGTAAGGTTAATCATGATGCTCCTTCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTAAGATAATTTCATCATATGTAAGGTTAATCATGATGCTCCTTCCC  200

seq1  TCCCTGCCCTGGTGTTTGATGTTCTTATGGGGGAAAAACTGTGATACTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTGCCCTGGTGTTTGATGTTCTTATGGGGGAAAAACTGTGATACTTT  250

seq1  CCCTCAGTTCTCATGGTATTTCAAATTCTAAACAGACATGTGGGAGCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCAGTTCTCATGGTATTTCAAATTCTAAACAGACATGTGGGAGCAGG  300

seq1  AGGCATTCAAACCCTTCCTTAATATTAGAGATAGGAGGTCCAAAGCTGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATTCAAACCCTTCCTTAATATTAGAGATAGGAGGTCCAAAGCTGGT  350

seq1  TATAGGAGAGTTCAATCTCAGTGCTCCTAACCCTGCTTGTGTTTGAGTAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGGAGAGTTCAATCTCAGTGCTCCTAACCCTGCTTGTGTTTGAGTAG  400

seq1  CTCTCTAACTGTACATTCAGTAAGTAAAAACTTTATACAGGTTTCTATTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTAACTGTACATTCAGTAAGTAAAAACTTTATACAGGTTTCTATTC  450

seq1  GTTCTGGGCCAGGTGGTGTGTGTAGGTGTGCTATGCAGTTCAGAGTAGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGGGCCAGGTGGTGTGTGTAGGTGTGCTATGCAGTTCAGAGTAGAA  500

seq1  TTACAATTCATGCAGAATTTACCTCTCTCTTCCCATCATAAGTCCCAAAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAATTCATGCAGAATTTACCTCTCTCTTCCCATCATAAGTCCCAAAC  550

seq1  AGGTCACATTATCAGACTTGGCAGAACATAGATAAATTTTTAACACAGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCACATTATCAGACTTGGCAGAACATAGATAAATTTTTAACACAGAG  600

seq1  GGAGAGTTTTTTGGCAGTTCAAGCACAATGAAAGGTGCAATGTTACTGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGTTTTTTGGCAGTTCAAGCACAATGAAAGGTGCAATGTTACTGGA  650

seq1  ATTC  654
      ||||
seq2  ATTC  654

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information