MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-299A22
Chromosome	5 (Build37)
Map Location	25,038,452 - 25,197,496
singlet/doublet	doublet
Overlap gene	Xrcc2
Upstream gene	Asb10, 4931409K22Rik, Abcf2, LOC100042348, Smarcd3, 1700022A21Rik, Nub1, 2810046M22Rik, Crygn, Rheb, Prkag2, Galntl5, E130116L18Rik, Galnt11, Mll3, Gm443
Downstream gene	LOC435835, Actr3b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Asb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117590 MGI:2152836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931409K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231045 MGI:3045319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27407 MGI:1351657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 mRNAs, 339 ESTs, 5 Proteins

name	Smarcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66993 MGI:1914243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72252 MGI:1919502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 19 Proteins

name	Nub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53312 MGI:1889001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810046M22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269633 MGI:1915466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crygn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214301 MGI:2449167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rheb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19744 MGI:97912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkag2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108099 MGI:1336153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galntl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67909 MGI:1915159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130116L18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77870 MGI:1925120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Galnt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231050 MGI:2444392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mll3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231051 MGI:2444959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm443 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242891 MGI:2685289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xrcc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57434 MGI:1927345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Actr3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242894 MGI:2661120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382985 GeneID:117590 MGI:2152836
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 10 transcript_id : NM_080444.3

name	4931409K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373177 GeneID:231045 MGI:3045319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931409K22 gene transcript_id : NM_177676.3

name	Abcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956077 GeneID:27407 MGI:1351657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family F (GCN20), member 2 transcript_id : NM_013853.1

name	LOC100042348 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253630 GeneID:100042348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 mRNAs, 339 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G transcript_id : XM_001478455.1

name	Smarcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404372 GeneID:66993 MGI:1914243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 transcript_id : NM_025891.3

name	1700022A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374345 GeneID:72252 MGI:1919502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 19 Proteins product : RIKEN cDNA 1700022A21 gene transcript_id : XM_131911.3

name	Nub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360353 GeneID:53312 MGI:1889001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : negative regulator of ubiquitin-like proteins 1 transcript_id : NM_016736.2

name	2810046M22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517673 GeneID:269633 MGI:1915466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810046M22 gene transcript_id : NM_001081441.1

name	Crygn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346484 GeneID:214301 MGI:2449167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, gamma N transcript_id : NM_153076.1

name	Rheb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893211 GeneID:19744 MGI:97912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-homolog enriched in brain transcript_id : NM_053075.3

name	Prkag2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703801 GeneID:108099 MGI:1336153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 2 non-catalytic subunit transcript_id : NM_145401.1

name	Galntl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361629 GeneID:67909 MGI:1915159
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 transcript_id : NM_026449.2

name	E130116L18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374346 GeneID:77870 MGI:1925120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA E130116L18 gene transcript_id : XM_001000959.1

name	Galnt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387638 GeneID:231050 MGI:2444392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 transcript_id : NM_144908.2

name	Mll3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487062 GeneID:231051 MGI:2444959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia 3 transcript_id : NM_001081383.1

name	Gm443 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930709 GeneID:242891 MGI:2685289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 443, (NCBI) transcript_id : NM_198621.2

name	Xrcc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543968 GeneID:57434 MGI:1927345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-ray repair complementing defective repair in Chinese hamster cells 2 transcript_id : NM_020570.2

name	Actr3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345393 GeneID:242894 MGI:2661120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARP3 actin-related protein 3 homolog B (yeast) transcript_id : NM_001004365.1

name	Asb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978258 CCDS:CCDS19124.1 GeneID:117590 MGI:2152836
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 10 protein_id : NP_536692.1

name	4931409K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244104 GeneID:231045 MGI:3045319
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231045 protein_id : NP_808344.1

name	Abcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956078 CCDS:CCDS19125.1 GeneID:27407 MGI:1351657
definition	GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 note : developmentally regulated repeat element-containing transcript 3 product : ATP-binding cassette, sub-family F (GCN20), member 2 protein_id : NP_038881.1

name	LOC100042348 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253631 GeneID:100042348
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478505.1

name	Smarcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404373 CCDS:CCDS19126.1 GeneID:66993 MGI:1914243
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 protein_id : NP_080167.3

name	1700022A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20823227 GeneID:72252 MGI:1919502
definition	codon_start : 1 product : hypothetical protein LOC72252 protein_id : XP_131911.1

name	Nub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360354 GeneID:53312 MGI:1889001
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : NY-REN-18 antigen product : Nedd8 ultimate buster-1 protein_id : NP_058016.2

name	2810046M22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517674 GeneID:269633 MGI:1915466
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC269633 protein_id : NP_001074910.1

name	Crygn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346485 CCDS:CCDS19129.1 GeneID:214301 MGI:2449167
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : crystallin, gamma N protein_id : NP_694716.1

name	Rheb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28626508 GeneID:19744 MGI:97912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-homolog enriched in brain protein_id : NP_444305.2

name	Prkag2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703802 CCDS:CCDS19130.1 GeneID:108099 MGI:1336153
definition	GO_function : GO:0004679 - AMP-activated protein kinase activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 exception : mismatches in translation note : 5-AMP-activated protein kinase, gamma-2 subunit product : AMP-activated protein kinase gamma2 subunit protein_id : NP_663376.1

name	Galntl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385946 CCDS:CCDS19132.1 GeneID:67909 MGI:1915159
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 protein_id : NP_080725.1

name	E130116L18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374347 GeneID:77870 MGI:1925120
definition	codon_start : 1 product : hypothetical protein LOC77870 protein_id : XP_001000959.1

name	Galnt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450297 CCDS:CCDS19133.1 GeneID:231050 MGI:2444392
definition	EC_number : 2.4.1.41 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 protein_id : NP_659157.1

name	Mll3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487063 GeneID:231051 MGI:2444959
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myeloid/lymphoid or mixed-lineage leukemia 3 protein_id : NP_001074852.1

name	Gm443 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348482 CCDS:CCDS19134.1 GeneID:242891 MGI:2685289
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC242891 protein_id : NP_941023.1

name	Xrcc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543969 CCDS:CCDS19135.1 GeneID:57434 MGI:1927345
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA] GO_process : GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : recA/RAD51 family protein product : X-ray repair complementing defective repair in Chinese hamster cells 2 protein_id : NP_065595.2

name	Actr3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345394 CCDS:CCDS19136.1 GeneID:242894 MGI:2661120
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : actin-related protein 3-beta product : ARP3 actin-related protein 3 homolog B protein_id : NP_001004365.1

name	LOC435835 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435835
definition	number : 1 pseudo : _no_value

clone name	MSMg01-530O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530D16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-154E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-299A22.b	B6Ng01-299A22.g
ACC	GA094003	GA094004
length	1,078	590
definition	B6Ng01-299A22.b	B6Ng01-299A22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(25,196,411 - 25,197,496)	(25,038,452 - 25,039,041)
sequence	gaattccaggatagccagagctacataatgaggtcctgcttcaaagagct actcaggaaacagatagctaggtaaatagatgagactagaatgttcgagt cttcctccttcctctcgcccatttttcttctttctacctgctccccttgt cccaaggatgtcctatagttcaggcaagtcttcatcacatttctgcctct gaggtagccaggtaaacaatgttgctccttggagctgagaattctgataa gttgcacttgaagatgaatgtctatgatttggggttctgtgtaatttttc acacacagggaaatgatgtactcactttcgaattcggaagttcattttgg aatgttcatctcactaattgatagatctgaagagttatactagatgcctt ggaacatctaggctgttatttccagctgtgcgctgagggagacttggcac tgctcaggaggtgtcctagtgaagattactgttgtcatgaccaagcactg tgagcaaaagactgttggagaggaaagggtttgttataaggtttacactt ctcttgtatattgtagtccatatttgaaggaagtcaggacaggaacttag gaagggcaggaactttgaggcaggtgtcaatacaaagtccatggagggtg ctgcttcctggtttgctccacgattgatcataatgcctactgcctgatct tatggagacatcttctcaactgaagctccctcctctctggtgactctagt ttgtgtcaagctgacataaaactagccggcacagagtacctgtaggaaga aggctttagaaaatccctttacatcttctgacccagggaaaggcccacat gtgagttcagactaactgctattctcaaacctgttaatgcctatgtcaca aacgatcctgtttccctttgttctgtggctttgttcactcattaccacag gtttatgagttaaaaagcatcctgttgagagctgagactaaagtcttcac tatgaggcacagcatgtaactgctgtctgtgccctacctgtgtccctggg ctgcttgtattaccccagggcctctgag	gaattcagtatgtatcctaggctggcctcaagttttagagactcctctgg cctcagacttctgtattgctgagataaaggcctatgccactaggcacagc ttatttttcttaaacgttttaatgcagtgtgtcattttaaaactggccaa tcacgtaagaaaaactacttggtgtgagcaaggaagagctgcctcccacc cccttgccagctgctgcaggagggagggcagccctcttgcctaggcagca cctcccttgagagctggtagagctggcgctggtggtgtgctggggagtca ggcctgagagatagcgttctggaaagctagccctgtcccttgaagccggc tgcaggcaagggagctgcccttccccccctcccttttttttttttttttt ttccccctgggcaaagcaggagaattggcaagctgaccaactcaactaac acccacccagatccaggggctttgggtggcgcacgcctttaataccagca ctcgggaggcagaggcaggcggatttctgagttccaggccagcctggtct acagagtaagtttccgtgacagcggggagggggggtgggg
quality values	Open. Hide. 58 33 33 32 58 58 28 15 54 49 21 35 62 62 62 47 32 62 54 62 62 62 56 62 39 62 62 62 62 62 62 62 49 62 56 56 56 49 46 56 56 47 56 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 59 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 59 59 62 62 59 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 42 62 62 62 43 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 47 41 62 62 62 62 62 62 62 62 62 58 58 58 58 52 45 41 58 58 58 58 58 58 58 58 58 54 52 58 58 45 46 54 54 58 54 58 58 58 58 58 58 58 54 46 58 58 58 58 58 52 58 37 58 58 54 58 58 58 58 52 58 42 58 58 58 58 54 58 54 49 58 58 58 49 58 54 52 52 58 48 58 31 58 47 54 53 46 58 58 58 58 58 58 58 58 58 51 52 52 53 51 58 58 51 58 58 58 58 54 46 58 58 58 58 58 58 58 58 37 58 58 58 53 53 53 53 52 58 39 41 52 51 58 58 48 48 58 58 52 39 58 58 49 31 58 54 32 52 40 58 58 40 48 58 58 58 53 46 28 51 40 50 39 58 41 58 52 52 50 50 54 50 50 41 49 58 52 53 53 53 42 41 58 58 41 32 58 58 42 58 52 51 50 49 54 50 39 58 51 51 52 39 49 50 49 32 53 45 54 35 49 53 54 32 54 49 35 37 45 42 49 38 54 50 54 40 54 37 45 53 52 54 35 54 37 49 38 37 53 45 53 39 37 54 52 53 37 37 33 35 51 51 45 47 51 53 34 26 51 40 44 52 45 53 37 53 41 41 54 54 42 33 54 29 41 52 51 37 54 51 40 41 31 26 53 34 32 31 40 41 49 52 51 32 47 32 31 31 37 42 42 53 32 36 25 30 52 31 51 52 42 31 40 34 32 41 29 20 39 26 17 35 34 22 46 25 31 29 28 45 31 51 31 31 23 38 38 37 31 36 32 31 43 22 43 51 31 31 28 45 51 51 30 32 31 41 22 30 51 31 31 31 24 35 31 26 42 30 27 28 30 25 46 30 28 23 46 40 32 47 33 24 38 10 46 40 25 31 21 30 34 31 31 35 24 31 32 27 32 21 27 24 42 26 25 20 30 35 33 31 31 30 31 30 26 31 28 39 31 23 33 30 39 21 28 22 22 31 39 16 17 28 32 34 32 23 27 31 23 22 44 29 32 26 37 31 22 30 31 36 21 48 37 28 48 31 24 44 28 32 14 17 22 28 6 11 25 30 31 36 36 24 21 14 21 31 23 30 32 32 22 26 22 32 22 28 30 32 12 26 8 25 48 23 17 25 28 34 14 21 19 25 40 48 39 34 17 24 24 34 20 15 17 25 6 19 22 32 7 17 6 23 34 24 31 8 27 21 27 16 47 21 21 34 12 10 15 20 20 28 28 28 28 12 14 3 13 20 15 14 18 5 7 5 22 27 27 10 12 12 31 19 15 28 24 13 20 18 18 6 8 19 40 21 20 28 11 13 7 7 5 8 14 9 34 10 11 15 24 5 12 5 7 8 13 7 8 4 14 22 15 4 12 18 28 21 7 4 12 17 5 5 24 12 6 6 17 20	Open. Hide. 62 47 56 47 62 47 41 62 62 62 47 56 51 38 44 56 56 28 56 27 43 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 49 49 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 49 47 49 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 43 52 52 62 62 62 62 62 62 62 62 62 62 62 54 52 52 52 47 41 33 47 43 45 54 58 58 54 52 54 52 52 54 52 54 54 54 46 52 52 54 54 44 52 54 54 54 58 58 46 58 58 58 52 58 52 51 50 34 58 54 54 45 42 54 52 54 52 47 52 52 54 45 58 58 52 58 58 46 54 54 48 48 46 50 50 50 50 47 51 54 47 50 51 54 50 37 50 46 43 47 48 39 50 47 35 29 39 34 42 26 45 25 39 49 41 41 58 50 41 50 41 39 53 51 50 52 52 54 40 52 53 53 51 49 47 48 48 51 46 39 46 42 39 39 39 37 43 43 52 39 39 29 53 37 42 43 51 50 53 51 49 51 49 40 50 49 49 35 40 37 51 41 42 41 26 35 23 34 39 39 54 54 50 41 49 37 25 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_25196411_25197496
seq2: B6Ng01-299A22.b_46_1123 (reverse)

seq1  CTCAGAAGCCCTGGGGTAAATACAAGCAGGCCCAGGGACACAGGTAGGGC  50
      |||||| |||||||||| |||||||||| |||||||||||||||||||||
seq2  CTCAGAGGCCCTGGGGT-AATACAAGCA-GCCCAGGGACACAGGTAGGGC  48

seq1  ACAGACAGCAAGTTACATGGCTGTGCCTTCATAGTGAAGAACTTTAGTCT  100
      ||||||||| |||||||| |||||||| ||||||||||| ||||||||||
seq2  ACAGACAGC-AGTTACAT-GCTGTGCC-TCATAGTGAAG-ACTTTAGTCT  94

seq1  CAGCTTCTCAACAGGATGCTTTTTAACTCATAAACCTGTGGTAATGAGTG  150
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGC-TCTCAACAGGATGCTTTTTAACTCATAAACCTGTGGTAATGAGTG  143

seq1  AACAAAGCCACAAGAACAAAGGGAAACAGGATCGTTTGTGACATAGGCAT  200
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AACAAAGCCAC-AGAACAAAGGGAAACAGGATCGTTTGTGACATAGGCAT  192

seq1  TAACAGGTTTGAGAATAGCAGTTAGTCTGAACTCACATGTGGGCCTTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAGGTTTGAGAATAGCAGTTAGTCTGAACTCACATGTGGGCCTTTCC  242

seq1  CTGGGTCAGAAGATGTAAAGGGATTTTCTAAAGCCTTCTTCCTACAGGTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTCAGAAGATGTAAAGGGATTTTCTAAAGCCTTCTTCCTACAGGTA  292

seq1  CTCTGTGCCGGCTAGTTTTATGTCAGCTTGACACAAACTAGAGTCACCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTGCCGGCTAGTTTTATGTCAGCTTGACACAAACTAGAGTCACCAG  342

seq1  AGAGGAGGGAGCTTCAGTTGAGAAGATGTCTCCATAAGATCAGGCAGTAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGAGGGAGCTTCAGTTGAGAAGATGTCTCCATAAGATCAGGCAGTAG  392

seq1  GCATTATGATCAATCGTGGAGCAAACCAGGAAGCAGCACCCTCCATGGAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTATGATCAATCGTGGAGCAAACCAGGAAGCAGCACCCTCCATGGAC  442

seq1  TTTGTATTGACACCTGCCTCAAAGTTCCTGCCCTTCCTAAGTTCCTGTCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTATTGACACCTGCCTCAAAGTTCCTGCCCTTCCTAAGTTCCTGTCC  492

seq1  TGACTTCCTTCAAATATGGACTACAATATACAAGAGAAGTGTAAACCTTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTTCCTTCAAATATGGACTACAATATACAAGAGAAGTGTAAACCTTA  542

seq1  TAACAAACCCTTTCCTCTCCAACAGTCTTTTGCTCACAGTGCTTGGTCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAAACCCTTTCCTCTCCAACAGTCTTTTGCTCACAGTGCTTGGTCAT  592

seq1  GACAACAGTAATCTTCACTAGGACACCTCCTGAGCAGTGCCAAGTCTCCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAACAGTAATCTTCACTAGGACACCTCCTGAGCAGTGCCAAGTCTCCC  642

seq1  TCAGCGCACAGCTGGAAATAACAGCCTAGATGTTCCAAGGCATCTAGTAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCGCACAGCTGGAAATAACAGCCTAGATGTTCCAAGGCATCTAGTAT  692

seq1  AACTCTTCAGATCTATCAATTAGTGAGATGAACATTCCAAAATGAACTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCTTCAGATCTATCAATTAGTGAGATGAACATTCCAAAATGAACTTC  742

seq1  CGAATTCGAAAGTGAGTACATCATTTCCCTGTGTGTGAAAAATTACACAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAATTCGAAAGTGAGTACATCATTTCCCTGTGTGTGAAAAATTACACAG  792

seq1  AACCCCAAATCATAGACATTCATCTTCAAGTGCAACTTATCAGAATTCTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCCAAATCATAGACATTCATCTTCAAGTGCAACTTATCAGAATTCTC  842

seq1  AGCTCCAAGGAGCAACATTGTTTACCTGGCTACCTCAGAGGCAGAAATGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCCAAGGAGCAACATTGTTTACCTGGCTACCTCAGAGGCAGAAATGT  892

seq1  GATGAAGACTTGCCTGAACTATAGGACATCCTTGGGACAAGGGGAGCAGG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAAGACTTGCCTGAACTATAGGACATCCTTGGGACAAGGGGAGCAGG  942

seq1  TAGAAAGAAGAAAAATGGGCGAGAGGAAGGAGGAAGACTCGAACATTCTA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAGAAGAAAAATGGGCGAGAGGAAGGAGGAAGACTCGAACATTCTA  992

seq1  GTCTCATCTATTTACCTAGCTATCTGTTTCCTGAGTAGCTCTTTGAAGCA  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCATCTATTTACCTAGCTATCTGTTTCCTGAGTAGCTCTTTGAAGCA  1042

seq1  GGACCTCATTATGTAGCTCTGGCTATCCTGGAATTC  1086
      ||||||||||||||||||||||||||||||||||||
seq2  GGACCTCATTATGTAGCTCTGGCTATCCTGGAATTC  1078

seq1: chr5_25038452_25039041
seq2: B6Ng01-299A22.g_67_656

seq1  GAATTCAGTATGTATCCTAGGCTGGCCTCAAGTTTTAGAGACTCCTCTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTATGTATCCTAGGCTGGCCTCAAGTTTTAGAGACTCCTCTGG  50

seq1  CCTCAGACTTCTGTATTGCTGAGATAAAGGCCTATGCCACTAGGCACAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAGACTTCTGTATTGCTGAGATAAAGGCCTATGCCACTAGGCACAGC  100

seq1  TTATTTTTCTTAAACGTTTTAATGCAGTGTGTCATTTTAAAACTGGCCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTTTTCTTAAACGTTTTAATGCAGTGTGTCATTTTAAAACTGGCCAA  150

seq1  TCACGTAAGAAAAACTACTTGGTGTGAGCAAGGAAGAGCTGCCTCCCACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGTAAGAAAAACTACTTGGTGTGAGCAAGGAAGAGCTGCCTCCCACC  200

seq1  CCCTTGCCAGCTGCTGCAGGAGGGAGGGCAGCCCTCTTGCCTAGGCAGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTGCCAGCTGCTGCAGGAGGGAGGGCAGCCCTCTTGCCTAGGCAGCA  250

seq1  CCTCCCTTGAGAGCTGGTAGAGCTGGCGCTGGTGGTGTGCTGGGGAGTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCTTGAGAGCTGGTAGAGCTGGCGCTGGTGGTGTGCTGGGGAGTCA  300

seq1  GGCCTGAGAGATAGCGTTCTGGAAAGCTAGCCCTGTCCCTTGAAGCCGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGAGAGATAGCGTTCTGGAAAGCTAGCCCTGTCCCTTGAAGCCGGC  350

seq1  TGCAGGCAAGGGAGCTGCCCTTCCCCCCCTCCCTTTTTTTTTTTTTTTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGGCAAGGGAGCTGCCCTTCCCCCCCTCCCTTTTTTTTTTTTTTTTT  400

seq1  TTCCCCCTGGGCAAAGCAGGAGAATTGGCAAGCTGACCAACTCAACTAAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCCTGGGCAAAGCAGGAGAATTGGCAAGCTGACCAACTCAACTAAC  450

seq1  ACCCACCCAGATCCAGGGGCTTTGGGTGGCGCACGCCTTTAATACCAGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCACCCAGATCCAGGGGCTTTGGGTGGCGCACGCCTTTAATACCAGCA  500

seq1  CTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCCAGGCCAGCCTGGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCCAGGCCAGCCTGGTCT  550

seq1  ACAGAGTAAGTTTCCGTGACAGCGGGGAGGGGGGGTGGGG  590
      ||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAGTAAGTTTCCGTGACAGCGGGGAGGGGGGGTGGGG  590

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information