MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-305D02
Chromosome	5 (Build37)
Map Location	88,896,560 - 89,029,171
singlet/doublet	doublet
Overlap gene	Ambn, Enam, Igj, Crlz1, Rufy3
Upstream gene	Ugt2a2, Ugt2a1, Sult1b1, Sult1d1, Sult1e1, Csn1s1, Csn2, Csn1s2a, Csn1s2b, 4930432K09Rik, EG654494, Odam, BC037156, Csn3, BC051076, 2310003L06Rik, 4931407G18Rik, Smr1, EG665603, Smr2, LOC100039941, LOC630942, EG665615, Muc10, Amtn, LOC100039963, EG665631
Downstream gene	Grsf1, Mobkl1a, Dck, Mkrn1-ps1, Slc4a4, Gc, LOC622870, Npffr2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ugt2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:552899 MGI:3576095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94215 MGI:2149905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56362 MGI:2136282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53315 MGI:1926341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20860 MGI:98431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12990 MGI:88540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12991 MGI:88541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn1s2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12993 MGI:88542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csn1s2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12992 MGI:105312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930432K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73779 MGI:1921029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654494 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654494 MGI:3646689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Odam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69592 MGI:1916842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC037156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:494497 MGI:3512757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Csn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12994 MGI:107461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC051076 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243090 MGI:2670982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	2310003L06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74248 MGI:1921498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	4931407G18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70977 MGI:1918227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20599 MGI:102763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665603 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665603 MGI:3646978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	Smr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20600 MGI:102762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC630942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	EG665615 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665615 MGI:3646267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	Muc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17830 MGI:107496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amtn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71421 MGI:1918671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	LOC100039963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665631 MGI:3644419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins pseudo : _no_value

name	Ambn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11698 MGI:104655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Enam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13801 MGI:1333772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igj (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16069 MGI:96493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crlz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65961 MGI:1919230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rufy3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52822 MGI:106484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231413 MGI:106479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobkl1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68473 MGI:1915723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13178 MGI:102726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mkrn1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353327 MGI:2663191
definition	note : makorin, ring finger protein 1, pseudogene 1 pseudo : _no_value

name	Slc4a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54403 MGI:1927555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14473 MGI:95669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins pseudo : _no_value

name	Npffr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104443 MGI:1860130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugt2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66571302 GeneID:552899 MGI:3576095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide A2 transcript_id : NM_001024148.1

name	Ugt2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716476 GeneID:94215 MGI:2149905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP glucuronosyltransferase 2 family, polypeptide A1 transcript_id : NM_053184.1

name	Sult1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359864 GeneID:56362 MGI:2136282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1B, member 1 transcript_id : NM_019878.3

name	Sult1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42734448 GeneID:53315 MGI:1926341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1D, member 1 transcript_id : NM_016771.2

name	Sult1e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963514 GeneID:20860 MGI:98431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1E, member 1 transcript_id : NM_023135.1

name	Csn1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982443 GeneID:12990 MGI:88540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein alpha s1 transcript_id : NM_007784.2

name	Csn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753537 GeneID:12991 MGI:88541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein beta transcript_id : NM_009972.1

name	Csn1s2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681056 GeneID:12993 MGI:88542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein alpha s2-like A transcript_id : NM_007785.1

name	Csn1s2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106272 GeneID:12992 MGI:105312
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein alpha s2-like B transcript_id : NM_009973.1

name	4930432K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358141 GeneID:73779 MGI:1921029
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432K09 gene transcript_id : NM_028648.2

name	Odam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274124 GeneID:69592 MGI:1916842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : odontogenic, ameloblast asssociated transcript_id : NM_027128.1

name	BC037156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253991 GeneID:494497 MGI:3512757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : cDNA sequence BC037156 transcript_id : XM_897089.3

name	Csn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365872 GeneID:12994 MGI:107461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kappa transcript_id : NM_007786.3

name	BC051076 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374889 GeneID:243090 MGI:2670982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : cDNA sequence BC051076 transcript_id : XM_144407.6

name	2310003L06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374890 GeneID:74248 MGI:1921498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310003L06 gene transcript_id : XM_144408.5

name	4931407G18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388868 GeneID:70977 MGI:1918227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931407G18 gene transcript_id : NM_027631.2

name	Smr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803443 GeneID:20599 MGI:102763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : submaxillary gland androgen regulated protein 1 transcript_id : NM_011422.2

name	Smr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72534646 GeneID:20600 MGI:102762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : submaxillary gland androgen regulated protein 2 transcript_id : NM_021289.2

name	EG665615 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374893 GeneID:665615 MGI:3646267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG665615 transcript_id : XM_978163.1

name	Muc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678961 GeneID:17830 MGI:107496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 10, submandibular gland salivary mucin transcript_id : NM_008644.1

name	Amtn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374895 GeneID:71421 MGI:1918671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : amelotin transcript_id : XM_284166.3

name	LOC100039963 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253992 GeneID:100039963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to L41541_1 collapsin/semaphorin III transcript_id : XM_001473857.1

name	Ambn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753043 GeneID:11698 MGI:104655
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ameloblastin transcript_id : NM_009664.1

name	Enam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365727 GeneID:13801 MGI:1333772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enamelin transcript_id : NM_017468.2

name	Igj (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346415 GeneID:16069 MGI:96493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin joining chain transcript_id : NM_152839.1

name	Crlz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746429 GeneID:65961 MGI:1919230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : charged amino acid rich leucine zipper 1 transcript_id : NM_023054.1

name	Rufy3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542481 GeneID:52822 MGI:106484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 3 transcript_id : NM_027530.2

name	Grsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385436 GeneID:231413 MGI:106479
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-rich RNA sequence binding factor 1 transcript_id : NM_178700.3

name	Mobkl1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118600996 GeneID:68473 MGI:1915723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 1A (yeast) transcript_id : NM_026735.2

name	Dck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286803 GeneID:13178 MGI:102726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxycytidine kinase transcript_id : NM_007832.4

name	Slc4a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922579 GeneID:54403 MGI:1927555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 4 transcript_id : NM_018760.2

name	Gc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51172611 GeneID:14473 MGI:95669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : group specific component transcript_id : NM_008096.1

name	Npffr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366674 GeneID:104443 MGI:1860130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuropeptide FF receptor 2 transcript_id : NM_133192.3

name	Ugt2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716477 GeneID:94215 MGI:2149905
definition	GO_function : GO:0015020 - glucuronosyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : olfactory UDP glucuronosyltransferase; UDP glycosyltransferase 2 family, polypeptide A1 product : UDP glucuronosyltransferase 2 family, polypeptide A1 protein_id : NP_444414.1

name	Ugt2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571303 CCDS:CCDS19390.1 GeneID:552899 MGI:3576095
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : UDP glucuronosyltransferase 2 family, polypeptide A2 protein_id : NP_001019319.1

name	Sult1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845263 CCDS:CCDS19391.1 GeneID:56362 MGI:2136282
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 product : dopa/tyrosine sulfotransferase protein_id : NP_063931.1

name	Sult1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734449 GeneID:53315 MGI:1926341
definition	GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0017067 - tyrosine-ester sulfotransferase activity [Evidence IEA] GO_process : GO:0000103 - sulfate assimilation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : amine N-sulfotransferase; tyrosine-ester sulfotransferase product : sulfotransferase family 1D, member 1 protein_id : NP_058051.2

name	Sult1e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963515 CCDS:CCDS19392.1 GeneID:20860 MGI:98431
definition	GO_function : GO:0004304 - estrone sulfotransferase activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008210 - estrogen metabolism [Evidence IMP]; GO:0007565 - pregnancy [Evidence IMP] codon_start : 1 exception : mismatches in translation note : sulfotransferase, estrogen preferring product : sulfotransferase family 1E, member 1 protein_id : NP_075624.1

name	Csn1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681055 GeneID:12990 MGI:88540
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : casein alpha protein_id : NP_031810.1

name	Csn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753538 GeneID:12991 MGI:88541
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : casein beta protein_id : NP_034102.1

name	Csn1s2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681057 GeneID:12993 MGI:88542
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma casein; milk protein product : casein gamma protein_id : NP_031811.1

name	Csn1s2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106273 GeneID:12992 MGI:105312
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : casein delta protein_id : NP_034103.1

name	4930432K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274123 GeneID:73779 MGI:1921029
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73779 protein_id : NP_082924.1

name	Odam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274125 CCDS:CCDS19394.1 GeneID:69592 MGI:1916842
definition	codon_start : 1 product : odontogenic ameloblast-associated protein protein_id : NP_081404.1

name	BC037156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897826 GeneID:494497 MGI:3512757
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902182.1

name	Csn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677412 CCDS:CCDS19396.1 GeneID:12994 MGI:107461
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] codon_start : 1 product : casein kappa protein_id : NP_031812.2

name	BC051076 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51711042 GeneID:243090 MGI:2670982
definition	codon_start : 1 product : similar to BC051076 protein protein_id : XP_144407.4

name	2310003L06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374891 GeneID:74248 MGI:1921498
definition	codon_start : 1 product : hypothetical protein LOC74248 protein_id : XP_144408.3

name	4931407G18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037225 GeneID:70977 MGI:1918227
definition	codon_start : 1 product : testis development protein NYD-SP26 protein_id : NP_081907.1

name	Smr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14389425 CCDS:CCDS19398.1 GeneID:20599 MGI:102763
definition	codon_start : 1 product : submaxillary gland androgen regulated protein 1 protein_id : NP_035552.1

name	Smr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72534647 GeneID:20600 MGI:102762
definition	GO_process : GO:0009636 - response to toxin [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IEA] codon_start : 1 product : submaxillary gland androgen regulated protein 2 protein_id : NP_067264.2

name	EG665615 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374894 GeneID:665615 MGI:3646267
definition	codon_start : 1 product : similar to MSG2alpha salivary protein protein_id : XP_983257.1

name	Muc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678962 GeneID:17830 MGI:107496
definition	codon_start : 1 product : mucin 10 protein_id : NP_032670.1

name	Amtn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28521902 GeneID:71421 MGI:1918671
definition	codon_start : 1 product : amelotin protein_id : XP_284166.1

name	LOC100039963 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253993 GeneID:100039963
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473907.1

name	Ambn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753044 GeneID:11698 MGI:104655
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS] GO_function : GO:0030021 - extracellular matrix structural constituent conferring compression resistance [Evidence TAS]; GO:0030345 - structural constituent of tooth enamel [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence TAS]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IEA]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 product : ameloblastin protein_id : NP_033794.1

name	Enam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567350 CCDS:CCDS19400.1 GeneID:13801 MGI:1333772
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IEA] GO_function : GO:0030345 - structural constituent of tooth enamel [Evidence ISS] GO_process : GO:0030282 - bone mineralization [Evidence ISS]; GO:0042476 - odontogenesis [Evidence ISS]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 product : enamelin protein_id : NP_059496.1

name	Igj (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346416 CCDS:CCDS19401.1 GeneID:16069 MGI:96493
definition	GO_function : GO:0003823 - antigen binding [Evidence ISS] GO_process : GO:0006959 - humoral immune response [Evidence ISS] codon_start : 1 exception : mismatches in translation note : immunoglobulin joining gene (not J region); J chain product : immunoglobulin J chain protein_id : NP_690052.1

name	Crlz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746430 CCDS:CCDS19402.1 GeneID:65961 MGI:1919230
definition	GO_component : GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007420 - brain development [Evidence IDA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : disrupter of silencing SAS10 protein_id : NP_075541.1

name	Rufy3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312036 CCDS:CCDS19403.1 GeneID:52822 MGI:106484
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : rap2 interacting protein x protein_id : NP_081806.1

name	Grsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520107 CCDS:CCDS19404.1 GeneID:231413 MGI:106479
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP] codon_start : 1 exception : mismatches in translation product : G-rich RNA sequence binding factor 1 protein_id : NP_848815.1

name	Mobkl1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62412947 GeneID:68473 MGI:1915723
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0019209 - kinase activator activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0019900 - kinase binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence ISS] codon_start : 1 product : MOB1, Mps One Binder kinase activator-like 1A protein_id : NP_081011.1

name	Dck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681141 CCDS:CCDS19405.1 GeneID:13178 MGI:102726
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004137 - deoxycytidine kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 product : deoxycytidine kinase protein_id : NP_031858.1

name	Slc4a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922580 CCDS:CCDS19406.1 GeneID:54403 MGI:1927555
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0015380 - anion exchanger activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0008510 - sodium:bicarbonate symporter activity [Evidence ISS]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015701 - bicarbonate transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence TAS]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : pancreas sodium bicarbonate cotransporter product : solute carrier family 4 (anion exchanger), member 4 protein_id : NP_061230.2

name	Gc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51172612 CCDS:CCDS19407.1 GeneID:14473 MGI:95669
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005499 - vitamin D binding [Evidence IEA]; GO:0051183 - vitamin transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0042359 - vitamin D metabolism [Evidence IDA] codon_start : 1 note : vitamin D binding protein product : group specific component protein_id : NP_032122.1

name	Npffr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981539 CCDS:CCDS19408.1 GeneID:104443 MGI:1860130
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : neuropeptide NPFF receptor product : G protein-coupled receptor 74 protein_id : NP_573455.2

name	LOC100039941 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039941
definition	number : 1 pseudo : _no_value

name	LOC100039941 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039941
definition	number : 2 pseudo : _no_value

name	LOC630942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630942
definition	number : 1 pseudo : _no_value

name	LOC630942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630942
definition	number : 2 pseudo : _no_value

name	EG654494 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253970 GeneID:654494 MGI:3646689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG654494 pseudo : _no_value transcript_id : XR_035128.1

name	EG665603 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94374892 GeneID:665603 MGI:3646978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG665603 pseudo : _no_value transcript_id : XR_001757.1

name	EG665631 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253994 GeneID:665631 MGI:3644419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins product : predicted gene, EG665631 pseudo : _no_value transcript_id : XR_001762.2

name	LOC622870 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253995 GeneID:622870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 2 Proteins product : similar to protein phosphatase 2A inhibitor-2 I-2PP2A pseudo : _no_value transcript_id : XR_031497.1

clone name	MSMg01-479P22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-528G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-439O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-543H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-354M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-145F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513P04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-144N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058P05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-305D02.b	B6Ng01-305D02.g
ACC	GA098545	GA098546
length	1,149	1,143
definition	B6Ng01-305D02.b	B6Ng01-305D02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,896,560 - 88,897,726)	(89,028,058 - 89,029,171)
sequence	gaattcacccaagggaggagactttactgtggaagtagattccccagtat ctgttaccaaaggccctgaaaaaggagaaggtccagaaggctctccactg caagaggccaacccaggcaaacgggaaaaccccgctctcctttcacaaat ggcacctggggcccatgcaggacttcttgctttccccaatgaccacatcc ccagtatggcaaggggtcctgcagggcaaagactccttggagtcacccct gcagctgcagacccactgatcacccctgaattagcagaagtttatgaaac ctatggtgctgatgttaccacacccctgggtgatggagaagcaaccatgg atatcaccatgtccccagacactcagcagccactgctacctggaaacaaa gtgcaccagccccaggtgcacaacgcatggcgtttccaagagccctgata accttgacatagcagctactttgtgtatgcacaagctttccagctttgtc cccatagtaccttgttgctaaaacacttactatccttccgcagtgaaggt gttaagagcactaagcatatattaataaatacaagtggctagaaatagtg taggtcccttcttgcttccattcttatcaaaataaaatgtatcaactgtc tccgtgacttagaaatactatcaatgatatcagagcaagtctaagtgtca gcacttggtggtatagcatgtagctgtcttaggcattataaaatttctct tactacatgacattattatgcccaggaaatgtgacactgcttctttctct acacaaaagcacttagtttcagaattccaaagtatttcatttaaacctta ttaaatggtgattggtggaaaaccctgactgctattactggtttcatata ttggatttaaaattcttatttatagaatattttatttaatctaggaaaag aagggcaattggcctgttttaaataagaatttttctcactgaaatgtcag aattgtatgctatattatatgtatcaatagtaagaaaagcatactcatcc ttgtttgcactcattactattttatttttatcaagttctctgagattaca taagtctaagcactaatgcaagtaataggctatggtctcgtccttcaaa	gaattcaagaacagcatggcttatatagagagttccaggccagccaaaaa tacacaataagagatgctgtttaaaaactaaaaataacaaaacaaaaaaa gaagggaaaaatgaaggagggaaggaaggagagagggaaggaggagaaag aagaaagaaggaaggaaaggaagaaaggaaggaaggacgttggagagctg gctcagacattagcacccacagggcatgtcataatcatctgtaactccaa ttccaggggatcttatgctctcttctagcttctgtgggcgctaccacaca cacagcgcacatatatgcacgcagacaaaacatacatataaaccaacaat aagtttttaaagaaagaaaaaaaaaaggaaactagctagcactaattaag gatttaaagatattacaaccttgtgcactgctgatagaaatgttaaatgc tgcaggtgctttagacaagtctgacatttctcaaaaaagctaagatctgg gctggaaacatgagtcattgtttaagagcccactcggctcttccaggaat tgagttagagtcccagcacccataatgtggctcattactgcctcataatg atttcttctggactctgggcaacaggtacacctgtggtgcaaagacagac ttttggtaaaacacccatacacataacacacacacacacacacacacaca cacacacacacacacacacacacacacacaattaaaagctgctgaattac cattctagagttcttcttcaaggtatttccccaatatgaaacaatatgga cacattctgtgtttttcacagaaacattcccttacaattagcccccaaat ggtaaacatgtcaaaatacccatcaaacattaatgtgctgagaggccatg aaacagacagacagaacatacagctcaatgacagtgtttcccatggaatg ttcagaatagggcaaatctaacagaaaacagaaaggagtctgccggcctg gccagggaacgggggagttggaacgagaccgggagttggttggtgatggg gtgaaagagtcctctgaagggaagaatgaaaaacacagggtaagacagtg ggtgacagaagcacatagctttgttgaaatgtcactaacagtc
quality values	Open. Hide. 58 31 33 41 62 27 20 62 62 41 20 62 62 62 62 35 54 62 49 47 41 31 62 62 54 62 59 62 62 62 59 23 34 25 18 25 23 13 22 27 28 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 59 56 54 56 56 35 40 38 62 62 62 62 62 54 54 62 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 54 58 49 58 58 54 58 58 58 58 58 58 54 58 58 58 58 52 58 58 58 54 58 54 58 58 58 58 58 58 58 49 58 58 58 53 58 53 58 58 58 54 58 58 53 58 58 58 49 54 51 58 58 51 58 51 51 52 50 41 41 50 58 58 58 58 58 58 58 51 51 48 52 54 58 51 51 37 50 58 50 46 58 58 54 51 49 58 58 49 47 58 52 51 49 51 49 50 58 58 58 58 54 54 42 58 53 53 51 44 37 58 53 52 37 49 58 43 50 50 54 49 51 58 53 50 49 51 58 53 42 53 53 53 53 53 58 24 52 42 54 52 53 54 53 52 54 41 54 51 38 49 37 42 53 53 51 54 45 53 53 53 51 54 32 53 53 51 50 49 37 39 54 39 51 37 50 47 51 40 52 38 32 36 33 35 27 23 35 45 42 52 40 54 54 47 35 54 51 45 42 34 36 46 37 37 45 34 45 30 53 42 46 32 30 53 45 32 45 40 41 40 47 52 46 40 33 40 53 51 49 22 29 51 53 52 33 33 30 35 41 45 37 35 44 34 34 52 35 37 34 31 31 31 31 27 40 28 51 46 45 31 32 24 30 33 35 31 36 51 51 45 30 31 29 51 30 31 38 30 30 28 51 33 28 34 26 31 47 31 38 25 22 47 42 26 42 26 28 36 30 42 36 31 31 31 46 30 30 43 42 27 32 32 15 30 36 41 31 43 31 36 48 43 39 24 41 31 36 37 31 34 34 37 32 34 30 32 31 31 31 31 39 37 26 47 31 25 24 31 27 31 31 31 25 24 31 16 17 48 38 22 48 48 33 16 26 27 24 19 29 23 47 26 24 29 24 24 33 13 11 28 32 48 48 31 31 29 48 30 21 20 35 33 33 23 10 21 31 48 44 33 17 24 16 7 37 24 14 14 14 26 15 20 16 4 8 32 27 32 48 39 24 23 40 24 19 20 25 12 24 16 22 47 47 40 21 30 32 32 24 31 26 17 31 43 32 20 29 27 27 6 7 3 18 9 18 18 6 12 14 16 17 21 6 13 5 3 6 11 19 20 26 14 6 6 20 5 30 21 20 27 14 12 20 23 7 5 47 34 27 13 28 18 11 18 20 19 27 17 22 28 27 15 17 15 5 29 13 18 20 6 10 10 20 10 14 13 15 5 8 7 7 28 25 8 16 9 25 28 28 15 20 19 8 3 3 15 18 15 6 8 17 16 12 18 6 17 15 15 4 3 4 15 5 11 5 10 22 11 9 14 4 4 6 7 7 8 4 2 4 18 5 13 3 1 2 3 4 4 3 4 4 4 5 4 9 3 1 3 8 6 10 5 8 16 5 7 14 8 12 13	Open. Hide. 49 44 51 47 56 47 43 43 51 59 51 56 43 28 33 28 45 34 28 27 50 59 62 62 62 62 59 56 62 62 62 54 54 62 62 59 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 48 54 34 33 54 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 54 54 62 59 59 62 62 62 54 54 54 62 62 62 62 59 59 62 54 54 54 54 54 62 62 62 54 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 54 52 62 62 62 62 62 62 62 62 62 62 62 47 49 62 62 62 41 45 62 62 62 62 62 54 45 62 62 62 62 62 62 62 41 62 62 43 47 58 52 43 58 49 58 58 58 52 58 58 54 58 58 54 58 58 52 58 58 58 58 58 58 58 54 52 58 54 58 58 54 38 58 58 58 54 58 58 54 58 54 54 41 58 58 54 58 58 54 54 52 58 54 48 49 58 50 52 52 47 45 58 58 58 46 54 54 52 58 42 54 58 58 47 54 39 50 47 45 43 50 58 49 38 47 54 43 35 58 58 50 50 39 54 58 58 46 58 39 58 32 58 39 58 35 58 51 58 51 54 58 58 58 51 50 42 47 41 24 12 25 48 58 42 41 40 42 42 42 39 43 42 48 29 41 42 50 10 18 14 14 11 13 24 40 50 49 50 51 40 58 52 58 53 58 52 58 32 44 28 33 51 58 17 50 40 43 31 39 50 42 50 40 28 50 11 8 20 25 32 52 27 50 51 39 26 31 36 38 17 31 26 39 52 49 40 38 49 21 9 15 28 49 22 30 52 49 28 41 51 50 31 11 40 32 32 37 27 29 37 39 33 20 26 37 27 35 13 10 44 30 27 41 25 53 42 28 32 47 25 38 29 45 40 44 8 29 21 37 40 13 42 44 26 22 12 21 13 6 40 25 31 27 31 33 15 16 32 35 32 30 34 40 40 51 42 32 52 11 12 21 25 9 6 40 14 25 18 29 34 24 27 15 45 34 25 16 32 28 32 36 25 29 30 19 46 11 15 10 6 15 31 18 20 39 24 31 33 37 23 40 24 43 17 51 15 40 17 21 25 17 48 13 13 27 17 22 22 21 13 23 19 32 31 19 20 31 23 43 14 17 21 38 31 32 9 9 11 11 25 27 19 16 30 16 27 27 39 28 9 39 19 21 18 14 10 23 32 10 16 7 30 29 26 6 30 30 12 19 10 31 28 17 21 44 29 27 32 32 15 9 11 23 6 36 44 32 33 21 8 6 18 36 17 19 31 17 10 17 13 9 9 11 13 21 31 14 31 24 17 21 12 10 6 14 29 6 5 9 7 7 18 19 20 6 11 6 5 4 6 15 6 6 5 7 30 5 4 15 31 11 31 10 10 14 12 10 22 19 31 13 23 21 19 19 21 19 16 27 14 8 9 7 11 34 20 7 15 3 3 5 6 16 4 8 16 15 14 7 28 26 9 9 6 14 7 5 7 11 28 29 28 12 10 5 8 6 6 26 17 7 6 6 6 7 6 18 20 16 20 29 10 6 6 6 3 12 5 17 7 3 3 3 4 6 5 7 5 3 5 18 9 4 6 4 6 10 26 9 6 14 4 8 5 16 6 4 22 13 14 10 12 23

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_88896560_88897726
seq2: B6Ng01-305D02.b_44_1192

seq1  GAATTCACCCAAGGGAGGAGACTTTACTGTGGAAGTAGATTCCCCAGTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCCAAGGGAGGAGACTTTACTGTGGAAGTAGATTCCCCAGTAT  50

seq1  CTGTTACCAAAGGCCCTGAAAAAGGAGAAGGTCCAGAAGGCTCTCCACTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTACCAAAGGCCCTGAAAAAGGAGAAGGTCCAGAAGGCTCTCCACTG  100

seq1  CAAGAGGCCAACCCAGGCAAACGGGAAAACCCCGCTCTCCTTTCACAAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGGCCAACCCAGGCAAACGGGAAAACCCCGCTCTCCTTTCACAAAT  150

seq1  GGCACCTGGGGCCCATGCAGGACTTCTTGCTTTCCCCAATGACCACATCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACCTGGGGCCCATGCAGGACTTCTTGCTTTCCCCAATGACCACATCC  200

seq1  CCAGTATGGCAAGGGGTCCTGCAGGGCAAAGACTCCTTGGAGTCACCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTATGGCAAGGGGTCCTGCAGGGCAAAGACTCCTTGGAGTCACCCCT  250

seq1  GCAGCTGCAGACCCACTGATCACCCCTGAATTAGCAGAAGTTTATGAAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTGCAGACCCACTGATCACCCCTGAATTAGCAGAAGTTTATGAAAC  300

seq1  CTATGGTGCTGATGTTACCACACCCCTGGGTGATGGAGAAGCAACCATGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGGTGCTGATGTTACCACACCCCTGGGTGATGGAGAAGCAACCATGG  350

seq1  ATATCACCATGTCCCCAGACACTCAGCAGCCACTGCTACCTGGAAACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCACCATGTCCCCAGACACTCAGCAGCCACTGCTACCTGGAAACAAA  400

seq1  GTGCACCAGCCCCAGGTGCACAACGCATGGCGTTTCCAAGAGCCCTGATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCACCAGCCCCAGGTGCACAACGCATGGCGTTTCCAAGAGCCCTGATA  450

seq1  ACCTTGACATAGCAGCTACTTTGTGTATGCACAAGCTTTCCAGCTTTGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGACATAGCAGCTACTTTGTGTATGCACAAGCTTTCCAGCTTTGTC  500

seq1  CCCATAGTACCTTGTTGCTAAAACACTTACTATCCTTCCGCAGTGAAGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATAGTACCTTGTTGCTAAAACACTTACTATCCTTCCGCAGTGAAGGT  550

seq1  GTTAAGAGCACTAAGCATATATTAATAAATACAAGTGGCTAGAAATAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAGAGCACTAAGCATATATTAATAAATACAAGTGGCTAGAAATAGTG  600

seq1  TAGGTCCCTTCTTGCTTCCATTCTTATCAAAATAAAATGTATCAACTGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTCCCTTCTTGCTTCCATTCTTATCAAAATAAAATGTATCAACTGTC  650

seq1  TCCGTGACTTAGAAATACTATCAATGATATCAGAGCAAGTCTAAGTGTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTGACTTAGAAATACTATCAATGATATCAGAGCAAGTCTAAGTGTCA  700

seq1  GCACTTGGTGGTATAGCATGTAGCTGTCTTAGGCATTATAAAATTTCTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTGGTGGTATAGCATGTAGCTGTCTTAGGCATTATAAAATTTCTCT  750

seq1  TACTACATGACATTATTATGCCCAGGAAATGTGACACTGCTTCTTTCTCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTACATGACATTATTATGCCCAGGAAATGTGACACTGCTTCTTTCTCT  800

seq1  ACACAAAAGCACTTAGTTTCAGAATTCCAAAGTATTTCATTTAAACCTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAAAAGCACTTAGTTTCAGAATTCCAAAGTATTTCATTTAAACCTTA  850

seq1  TTAAATGGTGATTGGTGGAAAACCCTGACTGCTATTACTGGTTTCATATA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATGGTGATTGGTGGAAAACCCTGACTGCTATTACTGGTTTCATATA  900

seq1  TTGGATTTAAAATTCTTATTTATAGAATATTTTATTTAATCTAGGAAAAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGATTTAAAATTCTTATTTATAGAATATTTTATTTAATCTAGGAAAAG  950

seq1  AAAGGGCAATTGGCCTGTTTTAAATAAAGAATTTTTCTCACTGAAAATGT  1000
       |||||||||||||||||||||||| ||||||||||||||||| ||||||
seq2  -AAGGGCAATTGGCCTGTTTTAAAT-AAGAATTTTTCTCACTG-AAATGT  997

seq1  CAGGAATTGTATGCTTATTATTTATATGTATTTAAATAGTAAAGAAAAGC  1050
      || ||||||||||| |||   |||||||||  | |||||| |||||||||
seq2  CA-GAATTGTATGC-TAT--ATTATATGTA--TCAATAGT-AAGAAAAGC  1040

seq1  ATACTCATCCCTTGTTTGCCACTCATTAACTTATTTA-TTTTATCCAAAG  1099
      |||||||| ||||||||| |||||||| |||  |||| |||||||  |||
seq2  ATACTCAT-CCTTGTTTG-CACTCATT-ACTATTTTATTTTTATC--AAG  1085

seq1  TTCTCTGAAGATTTACATAAGTCCTAAGCACT-ATGCAAGGTATAAGGTT  1148
      ||||||| ||| |||||||||| ||||||||| |||||||  |||  |  
seq2  TTCTCTG-AGA-TTACATAAGT-CTAAGCACTAATGCAAGTAATA--GGC  1130

seq1  TATGGTCTCGTCCTTCAAA  1167
      |||||||||||||||||||
seq2  TATGGTCTCGTCCTTCAAA  1149

seq1: chr5_89028058_89029171
seq2: B6Ng01-305D02.g_66_1208 (reverse)

seq1  GACTGTTAGTG-CATT--CACAAAGCTGTGTGC-TCTGTCA-CCACTGTC  45
      ||||||||||| ||||   |||||||| ||||| ||||||| ||||||||
seq2  GACTGTTAGTGACATTTCAACAAAGCTATGTGCTTCTGTCACCCACTGTC  50

seq1  TAACCCTGTG-TTTTCA-TCT--CCCTCAGAAGGACTC-TTCA-CCCATC  89
      | |||||||| |||||| |||  || |||| ||||||| |||| ||||||
seq2  TTACCCTGTGTTTTTCATTCTTCCCTTCAG-AGGACTCTTTCACCCCATC  99

seq1  ACCAACC-ACTCCCGGTCTCG-TCCAACTCCCC--GTCCCT-GCCAGGCC  134
      ||||||| ||||||||||||| |||||||||||   ||||| ||||||||
seq2  ACCAACCAACTCCCGGTCTCGTTCCAACTCCCCCGTTCCCTGGCCAGGCC  149

seq1  -GCAGACTCC-TTCTG-TTTCTGTTAGATTTG-CCTATTCTGAACATTCC  180
       ||||||||| ||||| ||||||||||||||| |||||||||||||||||
seq2  GGCAGACTCCTTTCTGTTTTCTGTTAGATTTGCCCTATTCTGAACATTCC  199

seq1  AT-GGAAACACTGTCA-TGAGCTGTATG-TCTGTCTGTCTG-TTCATGGC  226
      || ||||||||||||| ||||||||||| |||||||||||| ||||||||
seq2  ATGGGAAACACTGTCATTGAGCTGTATGTTCTGTCTGTCTGTTTCATGGC  249

seq1  CTCTCAGCACATT-ATG-TTGATGGGTA-TTTGACATG-TTACCATTTGG  272
      ||||||||||||| ||| |||||||||| ||||||||| |||||||||||
seq2  CTCTCAGCACATTAATGTTTGATGGGTATTTTGACATGTTTACCATTTGG  299

seq1  GGGCTAATTGTAA-GGAATGTTTCTGTG-AAAACACAGAATGTGTCCATA  320
      ||||||||||||| |||||||||||||| |||||||||||||||||||||
seq2  GGGCTAATTGTAAGGGAATGTTTCTGTGAAAAACACAGAATGTGTCCATA  349

seq1  TTGTTTCATATTGGGGAAATACCTTGAAGAAGAACTCTAGAATGGTAATT  370
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTCATATTGGGGAAATACCTTGAAGAAGAACTCTAGAATGGTAATT  399

seq1  CAGCAGCTTTTAATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG  420
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGCTTTTAATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG  449

seq1  TGTGTGTGTGTGTGTGTGTTATGTGTATGGGTGTTTTACCAAAAGTCTGT  470
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGTGTGTGTGTGTTATGTGTATGGGTGTTTTACCAAAAGTCTGT  499

seq1  CTTTGCACCACAGGTGTACCTGTTGCCCAGAGTCCAGAAGAAATCATTAT  520
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGCACCACAGGTGTACCTGTTGCCCAGAGTCCAGAAGAAATCATTAT  549

seq1  GAGGCAGTAATGAGCCACATTATGGGTGCTGGGACTCTAACTCAATTCCT  570
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCAGTAATGAGCCACATTATGGGTGCTGGGACTCTAACTCAATTCCT  599

seq1  GGAAGAGCCGAGTGGGCTCTTAAACAATGACTCATGTTTCCAGCCCAGAT  620
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAGCCGAGTGGGCTCTTAAACAATGACTCATGTTTCCAGCCCAGAT  649

seq1  CTTAGCTTTTTTGAGAAATGTCAGACTTGTCTAAAGCACCTGCAGCATTT  670
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGCTTTTTTGAGAAATGTCAGACTTGTCTAAAGCACCTGCAGCATTT  699

seq1  AACATTTCTATCAGCAGTGCACAAGGTTGTAATATCTTTAAATCCTTAAT  720
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTTCTATCAGCAGTGCACAAGGTTGTAATATCTTTAAATCCTTAAT  749

seq1  TAGTGCTAGCTAGTTTCCTTTTTTTTTTCTTTCTTTAAAAACTTATTGTT  770
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGCTAGCTAGTTTCCTTTTTTTTTTCTTTCTTTAAAAACTTATTGTT  799

seq1  GGTTTATATGTATGTTTTGTCTGCGTGCATATATGTGCGCTGTGTGTGTG  820
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTATATGTATGTTTTGTCTGCGTGCATATATGTGCGCTGTGTGTGTG  849

seq1  GTAGCGCCCACAGAAGCTAGAAGAGAGCATAAGATCCCCTGGAATTGGAG  870
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCGCCCACAGAAGCTAGAAGAGAGCATAAGATCCCCTGGAATTGGAG  899

seq1  TTACAGATGATTATGACATGCCCTGTGGGTGCTAATGTCTGAGCCAGCTC  920
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAGATGATTATGACATGCCCTGTGGGTGCTAATGTCTGAGCCAGCTC  949

seq1  TCCAACGTCCTTCCTTCCTTTCTTCCTTTCCTTCCTTCTTTCTTCTTTCT  970
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACGTCCTTCCTTCCTTTCTTCCTTTCCTTCCTTCTTTCTTCTTTCT  999

seq1  CCTCCTTCCCTCTCTCCTTCCTTCCCTCCTTCATTTTTCCCTTCTTTTTT  1020
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTTCCCTCTCTCCTTCCTTCCCTCCTTCATTTTTCCCTTCTTTTTT  1049

seq1  TGTTTTGTTATTTTTAGTTTTTAAACAGCATCTCTTATTGTGTATTTTTG  1070
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTGTTATTTTTAGTTTTTAAACAGCATCTCTTATTGTGTATTTTTG  1099

seq1  GCTGGCCTGGAACTCTCTATATAAGCCATGCTGTTCTTGAATTC  1114
      ||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCCTGGAACTCTCTATATAAGCCATGCTGTTCTTGAATTC  1143

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information