MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-306M09
Chromosome	5 (Build37)
Map Location	147,726,341 - 147,727,344
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cyp3a25, LOC667098, LOC667104, LOC100041449, LOC433961, EG622306, 1700001J03Rik, LOC667121, Rnf6, Cdk8, Wasf3, LOC623198, LOC622924, 4930449I24Rik, LOC100041548, LOC100041554, LOC100041566, LOC100041578, EG667172, Gpr12, Usp12, 1700041I07Rik, Rpl21, Rasl11a, LOC100039699, LOC627218
Downstream gene	Gtf3a, Mtif3, Lnx2, Rpo1-3, Gsh1, Pdx1, Cdx2, EG231903, LOC622952, Flt3, Map1lc3-ps3, LOC384254, LOC100039805, Pan3, Flt1, LOC100039825, Pomp, Slc46a3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp3a25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56388 MGI:1930638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins

name	LOC433961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	EG622306 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins

name	1700001J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69282 MGI:1916532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Rnf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wasf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245880 MGI:2658986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC622924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins

name	4930449I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041548 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins

name	LOC100041554 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins

name	LOC100041566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 3 Proteins

name	LOC100041578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins

name	EG667172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins pseudo : _no_value

name	Gpr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14738 MGI:101909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Usp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22217 MGI:1270128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73273 MGI:1920523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rpl21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19933 MGI:1278340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasl11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68895 MGI:1916145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC627218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66596 MGI:1913846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtif3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76366 MGI:1923616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lnx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140887 MGI:2155959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gsh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14842 MGI:95842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18609 MGI:102851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12591 MGI:88361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG231903 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231903 MGI:3647519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	Flt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14255 MGI:95559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map1lc3-ps3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606519
definition	note : microtubule-associated protein 1 light chain 3 pseudogene 3 pseudo : _no_value

name	LOC384254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pan3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72587 MGI:1919837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14254 MGI:95558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pomp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66537 MGI:1913787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc46a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71706 MGI:1918956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469130 GeneID:56388 MGI:1930638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 25 transcript_id : NM_019792.1

name	LOC100041449 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254753 GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins product : similar to cytochrome P450IIIA25 transcript_id : XM_001476549.1

name	LOC433961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375847 GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : hypothetical LOC433961 transcript_id : XM_485697.4

name	EG622306 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375836 GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins product : predicted gene, EG622306 transcript_id : XM_886734.2

name	1700001J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606116 GeneID:69282 MGI:1916532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001J03 gene transcript_id : NM_001008547.1

name	Rnf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803555 GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein (C3H2C3 type) 6 transcript_id : NM_028774.2

name	Cdk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611229 GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 8 transcript_id : NM_153599.3

name	Wasf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130090 GeneID:245880 MGI:2658986
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS protein family, member 3 transcript_id : NM_145155.2

name	LOC623198 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254755 GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : hypothetical LOC623198 transcript_id : XM_001476794.1

name	LOC622924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254757 GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins product : hypothetical LOC622924 transcript_id : XM_001476811.1

name	4930449I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360372 GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930449I24 gene transcript_id : NM_026136.2

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254759 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : hypothetical protein LOC100041548, transcript variant 1 transcript_id : XM_001476853.1

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254761 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041548, transcript variant 2 transcript_id : XM_001476864.1

name	LOC100041554 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254763 GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins product : hypothetical protein LOC100041554 transcript_id : XM_001476873.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254765 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 3 Proteins product : hypothetical protein LOC100041566, transcript variant 1 transcript_id : XM_001476887.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254767 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041566, transcript variant 2 transcript_id : XM_001476901.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254769 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 3 Proteins product : hypothetical protein LOC100041578, transcript variant 1 transcript_id : XM_001476922.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254771 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : hypothetical protein LOC100041578, transcript variant 2 transcript_id : XM_001476941.1

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982768 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_001010941.2

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331127 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_008151.3

name	Usp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130069 GeneID:22217 MGI:1270128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 12 transcript_id : NM_011669.3

name	1700041I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254773 GeneID:73273 MGI:1920523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700041I07 gene transcript_id : XM_001477033.1

name	Rpl21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366462 GeneID:19933 MGI:1278340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L21 transcript_id : NM_019647.4

name	Rasl11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625727 GeneID:68895 MGI:1916145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 11, member A transcript_id : NM_026864.1

name	Gtf3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345515 GeneID:66596 MGI:1913846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor III A transcript_id : NM_025652.2

name	Mtif3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367401 GeneID:76366 MGI:1923616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial translational initiation factor 3 transcript_id : NM_029581.3

name	Lnx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328410 GeneID:140887 MGI:2155959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligand of numb-protein X 2 transcript_id : NM_080795.3

name	Rpo1-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677790 GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-3 transcript_id : NM_009087.1

name	Rpo1-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362039 GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-3 transcript_id : NM_181730.3

name	Gsh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130916 GeneID:14842 MGI:95842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : genomic screened homeo box 1 transcript_id : NM_008178.2

name	Pdx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560657 GeneID:18609 MGI:102851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pancreatic and duodenal homeobox 1 transcript_id : NM_008814.2

name	Cdx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560721 GeneID:12591 MGI:88361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caudal type homeo box 2 transcript_id : NM_007673.2

name	EG231903 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179305 GeneID:231903 MGI:3647519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG231903 transcript_id : NM_001039678.1

name	Flt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937352 GeneID:14255 MGI:95559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 3 transcript_id : NM_010229.2

name	LOC100039805 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254746 GeneID:100039805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039805 transcript_id : XM_001473557.1

name	Pan3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61744462 GeneID:72587 MGI:1919837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PAN3 polyA specific ribonuclease subunit homolog (S. cerevisiae) transcript_id : NM_028291.3

name	Flt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129969 GeneID:14254 MGI:95558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 1 transcript_id : NM_010228.3

name	Pomp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377568 GeneID:66537 MGI:1913787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome maturation protein transcript_id : NM_025624.2

name	Slc46a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802503 GeneID:71706 MGI:1918956
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 46, member 3 transcript_id : NM_027872.3

name	Cyp3a25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469131 CCDS:CCDS19866.1 GeneID:56388 MGI:1930638
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a25 product : cytochrome P450, family 3, subfamily a, polypeptide 25 protein_id : NP_062766.1

name	LOC100041449 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254754 GeneID:100041449
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001476599.1

name	LOC433961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82899820 GeneID:433961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485697.3

name	EG622306 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899822 GeneID:622306 MGI:3643357
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891827.1

name	1700001J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606117 GeneID:69282 MGI:1916532
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69282 protein_id : NP_001008547.1

name	Rnf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311909 CCDS:CCDS19868.1 GeneID:74132 MGI:1921382
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0030517 - negative regulation of axon extension [Evidence IGI] [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IC]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 product : ring finger protein (C3H2C3 type) 6 protein_id : NP_083050.1

name	Cdk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31652272 CCDS:CCDS19869.1 GeneID:264064 MGI:1196224
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 8 protein_id : NP_705827.2

name	Wasf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553113 CCDS:CCDS19870.1 GeneID:245880 MGI:2658986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WAS protein family, member 3 protein_id : NP_660137.1

name	LOC623198 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254756 GeneID:623198
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476844.1

name	LOC622924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254758 GeneID:622924
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476861.1

name	4930449I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385646 GeneID:67410 MGI:1914660
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67410 protein_id : NP_080412.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254760 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476903.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254762 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476914.1

name	LOC100041554 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254764 GeneID:100041554
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476923.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254766 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476937.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254768 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476951.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254770 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476972.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254772 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476991.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331129 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_001010941.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680061 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_032177.1

name	Usp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328057 GeneID:22217 MGI:1270128
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin hydrolyzing enzyme 1 product : ubiquitin specific protease 12 protein_id : NP_035799.1

name	1700041I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254774 GeneID:73273 MGI:1920523
definition	codon_start : 1 product : hypothetical protein LOC73273 protein_id : XP_001477083.1

name	Rpl21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560385 CCDS:CCDS19872.1 GeneID:19933 MGI:1278340
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L21 protein_id : NP_062621.2

name	Rasl11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625728 GeneID:68895 MGI:1916145
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-like family 11 member A protein_id : NP_081140.1

name	Gtf3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532949 CCDS:CCDS19873.1 GeneID:66596 MGI:1913846
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : general transcription factor III A protein_id : NP_079928.1

name	Mtif3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313176 CCDS:CCDS19874.1 GeneID:76366 MGI:1923616
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2810012L14 protein_id : NP_083857.1

name	Lnx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328411 CCDS:CCDS19875.1 GeneID:140887 MGI:2155959
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0030165 - PDZ domain binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 exception : mismatches in translation product : PDZ domain containing ring finger 1 protein_id : NP_542985.3

name	Rpo1-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189421 GeneID:20018 MGI:108403
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; snoRNA MBI-50 product : RNA polymerase 1-3 isoform 2 protein_id : NP_859419.1

name	Rpo1-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677791 CCDS:CCDS19876.1 GeneID:20018 MGI:108403
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; snoRNA MBI-50 product : RNA polymerase 1-3 isoform 1 protein_id : NP_033113.1

name	Gsh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680113 CCDS:CCDS19877.1 GeneID:14842 MGI:95842
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : genomic screened homeo box 1 protein_id : NP_032204.1

name	Pdx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679269 GeneID:18609 MGI:102851
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006006 - glucose metabolism [Evidence IDA]; GO:0031016 - pancreas development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : pancreatic and duodenal homeobox gene 1 product : insulin promoter factor 1, homeodomain transcription factor protein_id : NP_032840.1

name	Cdx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560722 CCDS:CCDS19878.1 GeneID:12591 MGI:88361
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001824 - blastocyst development [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0001890 - placenta development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : caudal type homeo box 2 protein_id : NP_031699.2

name	EG231903 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179306 GeneID:231903 MGI:3647519
definition	codon_start : 1 function : catalyzes decarboxylation of 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline to S-(+)-allantoin product : OHCU decarboxylase protein_id : NP_001034767.1

name	Flt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937353 GeneID:14255 MGI:95559
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0030098 - lymphocyte differentiation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 product : FMS-like tyrosine kinase 3 protein_id : NP_034359.2

name	LOC100039805 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254747 GeneID:100039805
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473607.1

name	Pan3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61744463 GeneID:72587 MGI:1919837
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Pabp1-dependent poly A-specific ribonuclease subunit Pan3 product : PABP-dependent poly(A) nuclease 3 protein_id : NP_082567.2

name	Flt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328180 CCDS:CCDS19879.1 GeneID:14254 MGI:95558
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : vascular permeability factor receptor; vascular endothelial growth factor receptor product : FMS-like tyrosine kinase 1 protein_id : NP_034358.2

name	Pomp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385086 GeneID:66537 MGI:1913787
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : proteasome maturation protein protein_id : NP_079900.1

name	Slc46a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311835 CCDS:CCDS19880.1 GeneID:71706 MGI:1918956
definition	codon_start : 1 product : solute carrier family 46, member 3 protein_id : NP_082148.1

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 2 pseudo : _no_value

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 1 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 1 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 2 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 3 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 1 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 2 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 3 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 4 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 5 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 6 pseudo : _no_value

name	LOC384254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384254
definition	number : 1 pseudo : _no_value

name	LOC384254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384254
definition	number : 2 pseudo : _no_value

name	LOC100039825 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039825
definition	number : 1 pseudo : _no_value

name	LOC100039825 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039825
definition	number : 2 pseudo : _no_value

name	EG667172 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94375848 GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins product : predicted gene, EG667172 pseudo : _no_value transcript_id : XR_001988.1

name	LOC622952 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254775 GeneID:622952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to microsomal glutathione S-transferase 3 pseudo : _no_value transcript_id : XR_033097.1

clone name	MSMg01-518L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064L01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-306M09.b	B6Ng01-306M09.g
ACC	GA099718	GA099719
length	955	996
definition	B6Ng01-306M09.b	B6Ng01-306M09.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcatattggttccctgaactgtagagtgagggctattatggttg gaaaggccaaatggaagcctttagagttgcctctgccaaagaaaatagtg aatcaaaaacagtatcgtattcctggaggaattgcagaaattactgccac tatcaaggacttgaaagatgcaggggtggtggttcccaccacatctccat ttaactctcctatctggccagtgcagaaaacagatggatcatggagaatg acagttgattaccgaaaactaaatcaggtagtaactccaattgcagctgc tgtaccagatgtagtttccttacttgagcaaattaacacatctcctggca cctggtatgcggctattgatctggcaaatgccttcttctcagtacctgtc cataaggaccaccagaagcaatttgctttcagttggcaaggccaacagta taccttcacagttttgcctcaaggatatattaactctcctgccctgtgtc ataatttagttagaagggatcttgatcgtttggatcttccacaaaatatc acattggtgcactatattgatgacattatgctgattggaccaagtgagca ggaaagtagcaaccactttggactcattggtaacacatatgcgtatcaga ggatgggaaataaatccaaccaaaattcaaggaccatctacctcagtgaa attctttaggagtccagtgggtgtggggcatgcagagatattccttctaa ggtgaaagataagttattgcacctggcccctcctacaaccaagaagaagc acaacgtttagtgggtctatttggattctggagacaacaatccctcactg gggtgtgttactaaggcctattaccaagtgactcgaaaagctgctagctt tgtggtgggggcttgaacaggagaatgctctcttcaactaggtcatggct ggctg	gaattcagaagaagtgaaaatagtattaaatatatagtatatattctaaa ggattgctgggcggtggtggctcagatctttaatcccagcactcaggaag ccaaggcagagagagctctgagtttgaggccagcctggtctagagagaga gagttctaggacagtcaggactacgtaaaacaaaaaacaaaaacaacaac aaaaatctaaagagttaataaacttttattttcttttttattcatttttt aaaattggttattttatttatttacagttcaaatgttatccctctcccca gtttcccctccacaaatacaattttattttcaaaaagaatatacttcttg aaaaaaaaaaaacaaacaaaaaagaatatactaatgagagattatttttt aaaaaacagaatagtttcctatacataaaaacaattaaatttttatgttc tgagctcgtttgaggggaaataagccatggtttaaactaacttggggaaa tgccttgtggagagttggtggcagtatcacttagcaacttgatccaaatc aatgcaaccaattgtcacatcagtatcaaaggagtgctattgatcgtttc tattagagtagatagaactgaaggtgttgccctgcctgtggaaatggtat tgaccgaactttcatgacagtgtgctgctgtctgaggaagagtcaggtca agtcaggatttagcatcacctctttgagggtgtctgcccggaaacatgtt cccatgggttccaaatctgtgtcatccaagctcaaaaaaaaaaaaaaaaa aagaggggccagagagaaaggttagcagcactggctactcttgcagtgat cccaggttcaatttcccagcacctcatggtactcacaaccatctgtaaac ctataccctcccttttggttttgtttttgttttggttttttttttcaaga cagggtttctcttgtgtagccctgctgtctcaacaagcaagcaaac
quality values	Open. Hide. 41 22 29 23 58 50 53 34 28 54 54 45 58 49 23 58 58 58 58 49 62 62 25 62 52 62 62 62 62 62 62 13 12 13 10 9 16 18 13 18 38 21 21 31 31 38 35 43 62 62 62 62 62 62 62 49 51 54 51 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 34 39 39 36 38 36 50 44 43 49 46 43 45 38 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 46 49 62 62 59 43 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 56 25 38 28 29 45 50 43 43 56 51 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 56 62 62 62 62 56 47 44 62 62 56 46 56 56 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 47 33 54 62 56 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 62 56 62 62 62 56 62 62 56 62 62 41 38 62 62 62 62 62 56 62 56 62 62 62 62 47 62 62 56 62 62 62 62 43 62 50 62 54 52 52 52 62 62 62 62 62 42 62 54 47 62 62 62 43 47 52 52 52 52 54 45 62 54 62 62 42 46 40 54 54 52 54 52 54 48 54 39 34 58 54 52 58 47 54 34 37 48 54 52 58 52 52 30 12 24 32 52 9 22 41 43 12 52 40 35 25 22 43 52 52 52 52 50 39 54 28 54 52 31 32 41 54 47 29 31 49 49 41 46 36 54 52 52 52 58 46 54 54 46 52 25 29 29 8 45 52 22 50 50 50 51 47 52 37 28 58 42 49 39 34 26 47 47 43 29 47 48 15 17 33 36 32 37 34 51 50 27 30 35 49 49 42 39 40 49 53 40 50 31 50 46 37 58 46 35 48 34 13 50 8 34 33 22 39 21 39 41 39 29 21 24 33 39 12 6 16 35 33 58 58 58 33 32 39 50 53 39 30 58 21 34 28 39 41 33 32 47 17 49 53 24 19 18 24 32 27 40 53 50 47 38 35 26 30 40 16 17 29 39 15 21 39 24 31 29 24 32 30 41 29 39 40 25 11 11 32 9 9 33 27 21 28 18 12 27 6 18 12 12 32 29 26 31 29 28 38 10 12 39 34 32 13 14 19 23 24 40 30 29 31 28 26 28 19 52 40 17 42 26 26 39 34 46 40 30 8 14 17 40 7 9 8 5 9 6 30 30 28 35 29 22 31 7 16 22 19 29 51 24 31 24 39 19 14 21 9 9 9 36 21 18 18 52 20 30 6 7 21 25 9 9 33 28 15 11 21 20 7 5 41 31 31 9 11 31 34 28 32 31 28 33 32 31 15 8 12 26 8 30 31 28 15 21 11 14 6 9 11 13 28 24 26 13 16 19 8 25 16 6 18 7 8 25 8 23 12 33 31 31 12 24 9 13 11 27 9 6 5 8 18 8 9 12 11 6 14 18 12	Open. Hide. 62 47 42 47 62 47 41 47 62 62 43 10 10 11 8 11 9 18 18 22 13 19 22 13 13 13 15 30 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 54 62 62 18 18 28 27 23 18 23 32 18 38 36 18 28 34 46 54 62 62 54 54 62 62 54 62 59 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 28 46 27 44 47 51 50 56 56 62 62 62 54 62 62 62 62 62 62 62 62 56 62 54 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 52 52 52 52 62 62 42 62 62 62 62 62 39 62 62 62 62 62 62 62 62 62 62 62 62 43 54 62 62 62 58 58 47 58 58 46 58 52 54 52 58 58 31 14 49 31 47 52 54 58 54 58 40 58 52 58 54 54 54 58 58 52 58 58 52 58 54 54 54 58 54 52 52 58 37 42 40 47 48 54 54 58 54 58 40 54 58 45 34 58 54 58 54 58 49 58 58 50 54 54 51 44 50 58 58 58 51 48 50 41 50 47 58 58 51 51 50 50 50 51 58 58 48 49 58 58 50 50 58 40 58 49 51 54 58 37 51 51 37 49 58 51 53 53 39 48 48 40 31 58 40 32 47 34 53 39 53 53 54 50 40 58 44 58 40 17 33 29 49 32 51 37 41 51 58 49 49 49 49 50 54 41 32 24 41 58 44 33 54 53 32 42 39 51 49 35 29 54 40 51 33 32 52 54 38 34 32 53 53 51 37 29 52 42 53 42 47 46 38 40 35 53 41 39 53 52 47 51 18 43 53 33 23 39 29 39 42 32 24 54 32 40 29 49 45 39 40 35 26 52 42 32 52 45 37 26 32 35 45 53 31 53 52 45 40 45 53 46 32 53 18 52 30 30 51 35 43 36 28 21 51 30 16 30 31 51 32 29 26 31 42 34 37 31 51 30 28 29 42 48 33 29 39 31 30 31 46 33 32 30 31 42 34 38 33 32 25 31 33 42 16 27 31 31 32 32 30 48 48 48 48 48 46 46 46 47 48 48 48 46 46 46 46 44 35 18 39 18 46 46 32 22 39 31 19 38 8 20 10 31 44 16 18 38 21 33 37 24 31 32 21 32 32 31 25 20 38 25 32 33 31 38 19 9 25 13 16 20 32 19 15 4 4 17 36 24 24 17 25 15 21 32 14 33 14 39 18 31 37 32 19 27 34 32 21 22 15 12 9 20 23 26 13 32 27 32 31 22 12 5 15 9 21 15 28 26 27 28 27 18 31 18 13 11 10 16 27 17 32 47 27 23 24 38 21 15 34 34 18 10 19 18 34 34 18 17 5 34 30 40 11 6 5 10 11 23 6 11 27 38 21 21 31 28 21 28 21 20 5 9 13 10 19 4 4 6 26 17 17 27 18 17 8 8 6 6 17 8 10 6 16 13 16 28 14 19 18 6 11 20 20 13 16 10 22 17 13 6 24 7 6 9 15 12 18 9 25 15 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_147726341_147727344
seq2: B6Ng01-306M09.g_65_1060 (reverse)

seq1  GTTTGCTTTGCTTTGGTTTGAGACAGCCAGGGCTACAC-AGAGAAACCCT  49
      |||||| ||||||    ||||||||| ||||||||||| |||||||||||
seq2  GTTTGC-TTGCTT---GTTGAGACAG-CAGGGCTACACAAGAGAAACCCT  45

seq1  GTCTTGGAAAAAAAAAAACAAAAAACAAAAAACAAAAACCAAAAGGGAGG  99
      ||||||  |||||||||||  ||||||||||   ||||||||||||||||
seq2  GTCTTG--AAAAAAAAAAC-CAAAACAAAAA--CAAAACCAAAAGGGAGG  90

seq1  GTATAGGTTTACAGATGGTTGTGAGTACCATGGAGGTGCTGGG-AATTGA  148
      ||||||||||||||||||||||||||||||| ||||||||||| ||||||
seq2  GTATAGGTTTACAGATGGTTGTGAGTACCAT-GAGGTGCTGGGAAATTGA  139

seq1  ACCTGGGATCCACTGCAAGAGTAGCCAGTGCTGCTAACCTTTCTCTCTGG  198
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGGGAT-CACTGCAAGAGTAGCCAGTGCTGCTAACCTTTCTCTCTGG  188

seq1  CCCCTC--TTTTTTTTTTTTTTTTTGAGCTTGGATGACACAGATTTGGAA  246
      ||||||  ||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTCTTTTTTTTTTTTTTTTTTTGAGCTTGGATGACACAGATTTGGAA  238

seq1  CCCATGGGAACATGTTTCCGGGCAGACACCCTCAAAGAGGTGATGCTAAA  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATGGGAACATGTTTCCGGGCAGACACCCTCAAAGAGGTGATGCTAAA  288

seq1  TCCTGACTTGACCTGACTCTTCCTCAGACAGCAGCACACTGTCATGAAAG  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGACTTGACCTGACTCTTCCTCAGACAGCAGCACACTGTCATGAAAG  338

seq1  TTCGGTCAATACCATTTCCACAGGCAGGGCAACACCTTCAGTTCTATCTA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGGTCAATACCATTTCCACAGGCAGGGCAACACCTTCAGTTCTATCTA  388

seq1  CTCTAATAGAAACGATCAATAGCACTCCTTTGATACTGATGTGACAATTG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTAATAGAAACGATCAATAGCACTCCTTTGATACTGATGTGACAATTG  438

seq1  GTTGCATTGATTTGGATCAAGTTGCTAAGTGATACTGCCACCAACTCTCC  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGCATTGATTTGGATCAAGTTGCTAAGTGATACTGCCACCAACTCTCC  488

seq1  ACAAGGCATTTCCCCAAGTTAGTTTAAACCATGGCTTATTTCCCCTCAAA  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGGCATTTCCCCAAGTTAGTTTAAACCATGGCTTATTTCCCCTCAAA  538

seq1  CGAGCTCAGAACATAAAAATTTAATTGTTTTTATGTATAGGAAACTATTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGCTCAGAACATAAAAATTTAATTGTTTTTATGTATAGGAAACTATTC  588

seq1  TGTTTTTTAAAAAATAATCTCTCATTAGTATATTCTTTTTTGTTTGTTTT  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTTTAAAAAATAATCTCTCATTAGTATATTCTTTTTTGTTTGTTTT  638

seq1  TTTTTTTTCAAGAAGTATATTCTTTTTGAAAATAAAATTGTATTTGTGGA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCAAGAAGTATATTCTTTTTGAAAATAAAATTGTATTTGTGGA  688

seq1  GGGGAAACTGGGGAGAGGGATAACATTTGAACTGTAAATAAATAAAATAA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAAACTGGGGAGAGGGATAACATTTGAACTGTAAATAAATAAAATAA  738

seq1  CCAATTTTAAAAAATGAATAAAAAAGAAAATAAAAGTTTATTAACTCTTT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATTTTAAAAAATGAATAAAAAAGAAAATAAAAGTTTATTAACTCTTT  788

seq1  AGATTTTTGTTGTTGTTTTTGTTTTTTGTTTTACGTAGTCCTGACTGTCC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTTTTGTTGTTGTTTTTGTTTTTTGTTTTACGTAGTCCTGACTGTCC  838

seq1  TAGAACTCTCTCTCTCTAGACCAGGCTGGCCTCAAACTCAGAGCTCTCTC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAACTCTCTCTCTCTAGACCAGGCTGGCCTCAAACTCAGAGCTCTCTC  888

seq1  TGCCTTGGCTTCCTGAGTGCTGGGATTAAAGATCTGAGCCACCACCGCCC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTGGCTTCCTGAGTGCTGGGATTAAAGATCTGAGCCACCACCGCCC  938

seq1  AGCAATCCTTTAGAATATATACTATATATTTAATACTATTTTCACTTCTT  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAATCCTTTAGAATATATACTATATATTTAATACTATTTTCACTTCTT  988

seq1  CTGAATTC  1004
      ||||||||
seq2  CTGAATTC  996

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information