MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-312P17
Chromosome	5 (Build37)
Map Location	145,518,716 - 145,663,696
singlet/doublet	doublet
Overlap gene	Tmem130, LOC100039427, Trrap, Smurf1
Upstream gene	Eif2ak1, 4921520G13Rik, Jtv1, Pms2, 4930526H21Rik, AU022870, Ocm, Lmtk2, Bhlhb8, 2210010N04Rik, Bri3, Baiap2l1, 4930568B11Rik, Nptx2, EG621967
Downstream gene	AW146299, EG231885, EG666992, 1700018F24Rik, Arpc1a, Arpc1b, Pdap1, Bud31, Ptcd1, Cpsf4, Atp5j2, Zkscan14, Zkscan5, EG622116, Zfp655, LOC677270, EG666311, EG622127, LOC100039566, Cyp3a16, LOC100041375, LOC667065, Cyp3a41, Cyp3a44
Link	Open Mouse BAC browser

Click to get alignment info.

name	Eif2ak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15467 MGI:1353448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921520G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66729 MGI:1913979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jtv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231872 MGI:2385237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pms2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18861 MGI:104288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930526H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75136 MGI:1922386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	AU022870 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231874 MGI:2141070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ocm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18261 MGI:97401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmtk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231876 MGI:3036247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bhlhb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17341 MGI:891976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210010N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70381 MGI:1917631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bri3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55950 MGI:1933174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Baiap2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66898 MGI:1914148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930568B11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75873 MGI:1923123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Nptx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53324 MGI:1858209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621967 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621967 MGI:3643871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Tmem130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243339 MGI:3607706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Trrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100683 MGI:2153272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smurf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	AW146299 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381686 MGI:2141165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG231885 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231885 MGI:3648713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein

name	EG666992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666992 MGI:3647320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	1700018F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69396 MGI:1916646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56443 MGI:1928896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arpc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11867 MGI:1343142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231887 MGI:2448536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bud31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231889 MGI:2141291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71799 MGI:1919049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54188 MGI:1861602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5j2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57423 MGI:1927558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zkscan14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67235 MGI:1914485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zkscan5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22757 MGI:107533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622116 MGI:3643197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp655 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72611 MGI:1919861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG666311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins

name	LOC100039566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cyp3a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13114 MGI:106099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins

name	LOC667065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Cyp3a41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53973 MGI:1858451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2ak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248524 GeneID:15467 MGI:1353448
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2 alpha kinase 1 transcript_id : NM_013557.2

name	4921520G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349436 GeneID:66729 MGI:1913979
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921520G13 gene transcript_id : NM_025732.2

name	Jtv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122694 GeneID:231872 MGI:2385237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : JTV1 gene transcript_id : NM_146165.1

name	Pms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583909 GeneID:18861 MGI:104288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : postmeiotic segregation increased 2 (S. cerevisiae) transcript_id : NM_008886.2

name	4930526H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375815 GeneID:75136 MGI:1922386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : RIKEN cDNA 4930526H21 gene, transcript variant 1 transcript_id : XM_205565.5

name	AU022870 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129297 GeneID:231874 MGI:2141070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU022870 transcript_id : NM_177682.3

name	Ocm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31742493 GeneID:18261 MGI:97401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oncomodulin transcript_id : NM_033039.1

name	Lmtk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487400 GeneID:231876 MGI:3036247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lemur tyrosine kinase 2 transcript_id : NM_001081109.1

name	Bhlhb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50363366 GeneID:17341 MGI:891976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic helix-loop-helix domain containing, class B, 8 transcript_id : NM_010800.3

name	2210010N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249057 GeneID:70381 MGI:1917631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210010N04 gene transcript_id : NM_027410.1

name	Bri3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370800 GeneID:55950 MGI:1933174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain protein I3 transcript_id : NM_018772.3

name	Baiap2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110034 GeneID:66898 MGI:1914148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAI1-associated protein 2-like 1 transcript_id : NM_025833.3

name	4930568B11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254735 GeneID:75873 MGI:1923123
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4930568B11 gene transcript_id : XM_001472771.1

name	Nptx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560467 GeneID:53324 MGI:1858209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin 2 transcript_id : NM_016789.2

name	EG621967 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82899793 GeneID:621967 MGI:3643871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG621967 transcript_id : XM_886369.1

name	Tmem130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130473 GeneID:243339 MGI:3607706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 130 transcript_id : NM_177735.4

name	LOC100039427 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254737 GeneID:100039427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039427 transcript_id : XM_001472864.1

name	Trrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486948 GeneID:100683 MGI:2153272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation/transcription domain-associated protein transcript_id : NM_001081362.1

name	Smurf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044885 GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMAD specific E3 ubiquitin protein ligase 1 transcript_id : NM_029438.3

name	Smurf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044889 GeneID:75788 MGI:1923038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SMAD specific E3 ubiquitin protein ligase 1 transcript_id : NM_001038627.1

name	AW146299 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446031 GeneID:381686 MGI:2141165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW146299 transcript_id : NM_001013774.2

name	EG231885 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254742 GeneID:231885 MGI:3648713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein product : predicted gene, EG231885, transcript variant 1 transcript_id : XM_124689.4

name	1700018F24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380212 GeneID:69396 MGI:1916646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700018F24 gene transcript_id : NM_027069.2

name	Arpc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130576 GeneID:56443 MGI:1928896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 1A transcript_id : NM_019767.2

name	Arpc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963526 GeneID:11867 MGI:1343142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin related protein 2/3 complex, subunit 1B transcript_id : NM_023142.1

name	Pdap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351074 GeneID:231887 MGI:2448536
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDGFA associated protein 1 transcript_id : NM_001033313.2

name	Bud31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222237 GeneID:231889 MGI:2141291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BUD31 homolog (yeast) transcript_id : NM_001008705.1

name	Ptcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526931 GeneID:71799 MGI:1919049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pentatricopeptide repeat domain 1 transcript_id : NM_133735.1

name	Cpsf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802866 GeneID:54188 MGI:1861602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specific factor 4 transcript_id : NM_178576.2

name	Atp5j2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372981 GeneID:57423 MGI:1927558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2 transcript_id : NM_020582.2

name	Zkscan14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158684 GeneID:67235 MGI:1914485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 14 transcript_id : NM_023322.2

name	Zkscan5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46409653 GeneID:22757 MGI:107533
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 5 transcript_id : NM_016683.1

name	EG622116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375840 GeneID:622116 MGI:3643197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG622116 transcript_id : XM_896865.2

name	Zfp655 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130475 GeneID:72611 MGI:1919861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 655 transcript_id : NM_028298.3

name	EG666311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487458 GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666311 transcript_id : NM_001081431.1

name	EG622127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254740 GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins product : predicted gene, EG622127 transcript_id : XM_001473095.1

name	Cyp3a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681116 GeneID:13114 MGI:106099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 16 transcript_id : NM_007820.1

name	LOC100041375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254743 GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins product : similar to cytochrome P450 transcript_id : XM_001476442.1

name	Cyp3a41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802389 GeneID:53973 MGI:1858451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 41 transcript_id : NM_017396.2

name	Cyp3a44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130400 GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 44 transcript_id : NM_177380.3

name	Eif2ak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248525 GeneID:15467 MGI:1353448
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004694 - eukaryotic translation initiation factor 2alpha kinase activity [Evidence ISS]; GO:0020037 - heme binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0046986 - negative regulation of hemoglobin biosynthesis [Evidence IDA]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045993 - negative regulation of translational initiation by iron [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence IEP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IMP]; GO:0009605 - response to external stimulus [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : heme-regulated inhibitor product : eukaryotic translation initiation factor 2 alpha kinase 1 protein_id : NP_038585.2

name	4921520G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385192 GeneID:66729 MGI:1913979
definition	codon_start : 1 product : hypothetical protein LOC66729 protein_id : NP_080008.1

name	Jtv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122695 GeneID:231872 MGI:2385237
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : JTV1 protein_id : NP_666277.1

name	Pms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583910 GeneID:18861 MGI:104288
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0007126 - meiosis [Evidence TAS]; GO:0006298 - mismatch repair [Evidence ISS] [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : mismatch repair; DNA mismatch repair product : postmeiotic segregation increased 2 protein_id : NP_032912.2

name	4930526H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899845 GeneID:75136 MGI:1922386
definition	codon_start : 1 product : hypothetical protein LOC75136 isoform 1 protein_id : XP_205565.4

name	AU022870 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244114 CCDS:CCDS19846.1 GeneID:231874 MGI:2141070
definition	codon_start : 1 product : hypothetical protein LOC231874 protein_id : NP_808350.1

name	Ocm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31742494 GeneID:18261 MGI:97401
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : oncomodulin protein_id : NP_149028.1

name	Lmtk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487401 GeneID:231876 MGI:3036247
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence ISS]; GO:0048011 - nerve growth factor receptor signaling pathway [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : lemur tyrosine kinase 2 protein_id : NP_001074578.1

name	Bhlhb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754700 CCDS:CCDS19847.1 GeneID:17341 MGI:891976
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0007267 - cell-cell signaling [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007030 - Golgi organization and biogenesis [Evidence IMP]; GO:0048312 - intracellular distribution of mitochondria [Evidence IMP]; GO:0006851 - mitochondrial calcium ion transport [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : muscle, intestine and stomach expression 1 protein_id : NP_034930.1

name	2210010N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249058 GeneID:70381 MGI:1917631
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70381 protein_id : NP_081686.1

name	Bri3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098094 CCDS:CCDS19848.1 GeneID:55950 MGI:1933174
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : brain protein I3 protein_id : NP_061242.2

name	Baiap2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313234 GeneID:66898 MGI:1914148
definition	codon_start : 1 product : BAI1-associated protein 2-like 1 protein_id : NP_080109.1

name	4930568B11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254736 GeneID:75873 MGI:1923123
definition	codon_start : 1 product : hypothetical protein LOC75873 protein_id : XP_001472821.1

name	Nptx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949098 CCDS:CCDS19849.1 GeneID:53324 MGI:1858209
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : neuro activity regulated petaxin product : neuronal pentraxin 2 protein_id : NP_058069.1

name	EG621967 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899794 GeneID:621967 MGI:3643871
definition	codon_start : 1 product : similar to ribosomal protein S29 protein_id : XP_891462.1

name	Tmem130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048368 CCDS:CCDS19851.1 GeneID:243339 MGI:3607706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243339 protein_id : NP_808403.2

name	LOC100039427 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254738 GeneID:100039427
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472914.1

name	Trrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486949 GeneID:100683 MGI:2153272
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0007093 - mitotic checkpoint [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transactivation/transformation-domain associated protein product : transformation/transcription domain-associated protein protein_id : NP_001074831.1

name	Smurf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044886 GeneID:75788 MGI:1923038
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0007398 - ectoderm development [Evidence ISS]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence ISS] [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Smad ubiquitination regulatory factor 1 product : Smad ubiquitination regulatory factor 1 isoform 2 protein_id : NP_083714.3

name	Smurf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044890 GeneID:75788 MGI:1923038
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0007398 - ectoderm development [Evidence ISS]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0042787 - protein ubiquitination during ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence ISS] [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Smad ubiquitination regulatory factor 1 product : Smad ubiquitination regulatory factor 1 isoform 1 protein_id : NP_001033716.1

name	AW146299 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446032 CCDS:CCDS19852.1 GeneID:381686 MGI:2141165
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IEA] codon_start : 1 note : nuclear transport receptor product : hypothetical protein LOC381686 protein_id : NP_001013796.2

name	EG231885 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20848821 GeneID:231885 MGI:3648713
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_124689.1

name	1700018F24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386196 GeneID:69396 MGI:1916646
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC69396 protein_id : NP_081345.1

name	Arpc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790221 CCDS:CCDS19855.1 GeneID:56443 MGI:1928896
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS] codon_start : 1 note : actin related protein 2/3 complex, subunit 1A (41 kDa) product : actin related protein 2/3 complex, subunit 1A protein_id : NP_062741.1

name	Arpc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963527 CCDS:CCDS19856.1 GeneID:11867 MGI:1343142
definition	GO_component : GO:0005885 - Arp2/3 protein complex [Evidence TAS] codon_start : 1 exception : mismatches in translation note : actin related protein 2/3 complex, subunit 1B (41 kDa) product : actin related protein 2/3 complex, subunit 1B protein_id : NP_075631.1

name	Pdap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781781 GeneID:231887 MGI:2448536
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0048407 - platelet-derived growth factor binding [Evidence ISS] GO_process : GO:0048008 - platelet-derived growth factor receptor signaling pathway [Evidence ISS] codon_start : 1 product : PDGFA associated protein 1 protein_id : NP_001028485.1

name	Bud31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222238 CCDS:CCDS19857.1 GeneID:231889 MGI:2141291
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : maternal G10 transcript protein_id : NP_001008705.1

name	Ptcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76253682 CCDS:CCDS19858.1 GeneID:71799 MGI:1919049
definition	codon_start : 1 exception : mismatches in translation product : pentatricopeptide repeat domain 1 protein_id : NP_598496.2

name	Cpsf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30466247 CCDS:CCDS19859.1 GeneID:54188 MGI:1861602
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : musculus clipper/cleavage and polyadenylation specificity factor 30 kDa subunit; cleavage and polyadenylation specific factor 4, 30kD subunit product : cleavage and polyadenylation specific factor 4 protein_id : NP_848671.1

name	Atp5j2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181184 GeneID:57423 MGI:1927558
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005753 - proton-transporting ATP synthase complex (sensu Eukaryota) [Evidence ISS]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit f, isoform 2 protein_id : NP_065607.1

name	Zkscan14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158685 CCDS:CCDS19860.1 GeneID:67235 MGI:1914485
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 99 protein_id : NP_075811.2

name	Zkscan5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46409654 GeneID:22757 MGI:107533
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 95 protein_id : NP_057892.1

name	EG622116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899802 GeneID:622116 MGI:3643197
definition	codon_start : 1 product : hypothetical protein protein_id : XP_901958.1

name	Zfp655 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312242 CCDS:CCDS19861.1 GeneID:72611 MGI:1919861
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 655 isoform a protein_id : NP_082574.1

name	EG666311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487459 GeneID:666311 MGI:3647079
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : predicted gene, EG666311 protein_id : NP_001074900.1

name	EG622127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254741 GeneID:622127 MGI:3646373
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001473145.1

name	Cyp3a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681117 CCDS:CCDS19862.1 GeneID:13114 MGI:106099
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a16 product : cytochrome P450, family 3, subfamily a, polypeptide 16 protein_id : NP_031846.1

name	LOC100041375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254744 GeneID:100041375
definition	codon_start : 1 product : similar to cytochrome P450 protein_id : XP_001476492.1

name	Cyp3a41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393235 CCDS:CCDS19863.1 GeneID:53973 MGI:1858451
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, steroid inducible 3a41 product : cytochrome P450, family 3, subfamily a, polypeptide 41 protein_id : NP_059092.1

name	Cyp3a44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893549 CCDS:CCDS19864.1 GeneID:337924 MGI:2449818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 3a44 product : cytochrome P450, family 3, subfamily a, polypeptide 44 protein_id : NP_796354.1

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 2 pseudo : _no_value

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 2 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 15 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 14 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 13 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 12 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 11 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 10 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 9 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 8 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 7 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 6 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 5 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 4 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 2 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 1 pseudo : _no_value

name	EG666992 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254739 GeneID:666992 MGI:3647320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG666992 pseudo : _no_value transcript_id : XR_001957.2

clone name	MSMg01-155G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486J24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-185O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335E12
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-054I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-312P17.b	B6Ng01-312P17.g
ACC	GA104315	GA104316
length	513	1,117
definition	B6Ng01-312P17.b	B6Ng01-312P17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(145,518,716 - 145,519,232)	(145,662,584 - 145,663,696)
sequence	cttttcttcaaattcatttgttgcgttataaagctgtttgagtcaagaga ctaaaggcacaggccaccactgccgtccaaaatggcatgggggttgaggg ttcatattgtcaacatgatgggatttggtttagttttgattttgagacga gatctccctctatgtagccctgattgtcctggacgacctatgtagacgga gctagccttgaactcacagagatgcagtgattatcagttgccatggctct tgctgccatgccctcctttcccaatatgattgactgtacttttgaattgt gagctgactgaaacaaacccttccttaatctgcttttgtcatgtacttta cacttatctatttaccgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgt gtatacacccaggagcatacttgtatgcatgaaacagggggtcaggtttt tttccctcgaaatttatgggtttcaggaatcaaatttcaaattcatgtct tcagctttgtcag	gaattccatctctgtgtttgtgcagttaatgttttaggcttaaatgatag tgtttacatttgttgattctccagtttgaggaaagatacttttttagata gttgctagggatgcttgtctaaagtgagacagtttgagagatgactgaca tattaacttctgtgatttttttccccctcctgttacaaacactaagtgtg cgggacgtttgctgtatcaatgttaactccagtgtctgcttgttttcagt attgtgtgccaagaaccttgcaaagaaagacttcttcagtaagtacaccc agcttcatttgtatatagagtttatgtacttctgaaaattattgtgtgtg tttcccgtagcatgcgtgtggaggtcagaggacagcttgcaggaagttct ccccttacaccatattgctacagagattgaatttagatcttgttggcctc tgacatttaattaaaaaacaaaacaaaacaaaacaaaacaatgggtgttg tctaagagtataggaggccagagcttgagcagcgtctcccagctgccccc agcataggtctcctcccccattgcagccatgcccacgtcccctgcatccg atctggtagcttgtaggaccctgctctctcctcaaatacaccaagacatt tacgatgtaagtggcttggctaaaattgccaatccagttttacaaaatac attccatttgaaaacctctgcaagggaggaactataaaatgctgagggct gtactcctgagcgcacctcgcccctgtgcagtcagccctgaaaactccct cgttcccatcccagggggcttgctgcctgagtggcgtcatctacagtttc aggaagaagagacttaggctcaaagactcagtagccaggaaactccaaag tggtggcttgcagccagcctctctccaagcctccgggccttgttgcttgt ctggcatcaaacctgtcgcatccacttgtgacttcggggacaggcgtcgt gatgccacagctaacacaggcaaaagatcagtaacattttctggggattg tgacttattgaaacttaccttgatagattcatgttttcttgcatcagttc agttcctttagtaatga
quality values	Open. Hide. 62 43 62 62 62 62 62 62 37 15 47 62 62 62 37 33 47 62 62 59 62 62 59 59 59 43 34 27 28 25 27 28 23 27 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 49 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 54 42 49 43 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 59 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 56 56 24 12 16 13 26 26 13 18 12 22 18 18 34 26 8 24 10 10 17 13 16 30 14 10 16 24 19 15 20 23 30 24 23 8 11 23 7 19 16 18 23 9 18 17 19 34 18 16 10 17 23 24 13 30 39 18 29 16 10 11 13 10 18 11 11 12 25 30 24 13 13 13 13 13 12 12 14 14 16 10 10 24 11 15 11 16 16 9 15 15 22 24 24 14 14 20 24 20 14 8 14 20 24 13 14 17 14 10 13 10 8 10 10	Open. Hide. 62 59 43 59 62 62 46 44 62 62 51 39 34 32 28 48 46 56 56 54 54 62 62 59 62 62 59 62 62 59 62 62 62 62 59 59 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 54 54 54 59 59 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 59 62 62 62 49 49 54 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 49 62 56 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 54 58 58 58 54 54 54 44 58 48 54 58 54 58 58 58 58 58 53 58 54 58 58 58 58 58 54 54 52 52 54 50 54 58 54 51 48 47 47 47 50 49 58 58 58 58 58 58 51 54 53 51 58 49 51 51 47 38 39 41 54 49 58 50 51 50 58 54 49 54 58 49 58 48 50 58 49 58 49 49 43 58 58 58 49 50 54 49 58 52 54 58 49 58 58 58 49 58 52 58 58 52 54 53 53 19 58 39 26 58 58 50 58 58 49 51 49 47 49 53 53 53 42 52 58 54 50 50 52 50 44 43 52 53 41 32 25 47 49 58 49 52 47 40 54 39 53 52 54 46 52 51 54 39 35 51 41 51 39 53 53 49 54 54 49 38 54 51 50 39 39 37 50 35 33 29 41 54 49 34 42 33 40 31 52 54 52 52 40 44 35 53 51 40 28 37 53 49 49 52 54 52 51 37 39 35 53 45 53 52 40 34 52 40 54 46 32 29 33 33 27 33 41 40 42 29 49 46 32 32 52 40 53 31 32 12 49 32 28 32 53 32 31 32 39 35 40 34 45 41 18 47 28 31 33 31 43 42 35 37 31 51 41 27 22 37 33 31 31 31 32 22 35 33 36 31 41 31 21 29 31 51 46 40 30 42 23 40 30 31 29 24 22 29 31 43 31 29 30 22 46 32 38 18 46 47 46 38 28 43 21 35 31 36 31 25 31 30 31 34 15 26 29 43 30 30 25 31 27 21 21 32 31 31 25 27 27 46 39 31 13 18 17 28 31 23 27 25 11 37 15 31 23 30 31 30 13 36 26 26 31 30 46 27 18 31 29 36 32 20 31 27 29 20 33 29 14 25 29 33 32 28 31 38 16 21 17 38 25 31 33 37 34 27 38 36 31 26 16 29 16 18 8 28 23 8 11 18 20 23 21 10 7 10 10 24 12 16 9 17 10 29 12 30 9 34 15 28 12 20 27 26 17 14 22 23 14 15 21 15 21 31 23 25 13 24 16 10 17 32 23 10 22 20 16 9 14 24 25 19 19 21 32 16 12 22 6 6 5 10 21 9 5 8 12 13 40 40 17 9 8 9 20 8 11 6 7 29 20 16 17 19 27 8 17 6 7 10 9 16 20 27 15 25 15 11 11 6 15 10 17 10 28 47 13 6 20 20 21 16 5 20 16 7 21 16 21 28 28 14 16 12 22 28 28 20 22 18 5 7 8 10 7 13 8 5 8 12 18 10 22 12 3 1 3 17 6 7 6 9 10 5 4 10 8 11 16 6 6 6 9 4 6 5 28 26 10 21 10 5 8 18 12 14 21 6 6 4 7 9 8 5 4 4 23 12 4 11 22 12 5 5 13 11 6 9 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_145518716_145519232
seq2: B6Ng01-312P17.b_48_566

seq1  GAATTCCTTTTCTTCAAATTCATTTGTTGCGTTATAAAGCTGTTTGAGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTTTCTTCAAATTCATTTGTTGCGTTATAAAGCTGTTTGAGTC  50

seq1  AAGAGACTAAAGGCACAGGCCACCACTGCCGTCCAAAATGGCATGGGGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGACTAAAGGCACAGGCCACCACTGCCGTCCAAAATGGCATGGGGGT  100

seq1  TGAGGGTTCATATTGTCAACATGATGGGATTTGGTTTAGTTTTGATTTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGGTTCATATTGTCAACATGATGGGATTTGGTTTAGTTTTGATTTTG  150

seq1  AGACGAGATCTCCCTCTATGTAGCCCTGATTGTCCTGGACGACCTATGTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACGAGATCTCCCTCTATGTAGCCCTGATTGTCCTGGACGACCTATGTA  200

seq1  GACGGAGCTAGCCTTGAACTCACAGAGATGCAGTGATTATCAGTTGCCAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGGAGCTAGCCTTGAACTCACAGAGATGCAGTGATTATCAGTTGCCAT  250

seq1  GGCTCTTGCTGCCATGCCCTCCTTTCCCAATATGATTGACTGTACTTTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCTTGCTGCCATGCCCTCCTTTCCCAATATGATTGACTGTACTTTTG  300

seq1  AATTGTGAGCTGACTGAAACAAACCCTTCCTTAATCTGCTTTTGTCATGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGTGAGCTGACTGAAACAAACCCTTCCTTAATCTGCTTTTGTCATGT  350

seq1  ACTTTACACTTATCTATTTACCGTGTGTGTGTGTGTGTGTGTGTGTGTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTACACTTATCTATTTACCGTGTGTGTGTGTGTGTGTGTGTGTGTGT  400

seq1  GTGTGTGTATACACGCAGGAGCACACTTGTATGCATGAAGCAGGGGGTCA  450
      |||||||||||||| |||||||| ||||||||||||||| ||||||||||
seq2  GTGTGTGTATACACCCAGGAGCATACTTGTATGCATGAAACAGGGGGTCA  450

seq1  GGTTTTTTTCCATC-TAATATATGGGTTCCAGGAATCAAA-TTCAAATTC  498
      ||||||||||| ||  ||| |||||||| ||||||||||| |||||||||
seq2  GGTTTTTTTCCCTCGAAATTTATGGGTTTCAGGAATCAAATTTCAAATTC  500

seq1  ATGTCTTCAGCTTTGGCAG  517
      ||||||||||||||| |||
seq2  ATGTCTTCAGCTTTGTCAG  519

seq1: chr5_145662584_145663696
seq2: B6Ng01-312P17.g_67_1183 (reverse)

seq1  TCATTACTAAAGGGACTGACTGGATGCA--GAAACATG-ATCTATCAAGT  47
      ||||||||||||| |||||   ||||||   ||||||| |||||||||| 
seq2  TCATTACTAAAGGAACTGAACTGATGCAAGAAAACATGAATCTATCAAGG  50

seq1  AAATTTTTCAAT-AGTCACAATCCCCAG-AAATGTTACTGATCTTTTGCC  95
       ||  ||||||| ||||||||||||||| |||||||||||||||||||||
seq2  TAA-GTTTCAATAAGTCACAATCCCCAGAAAATGTTACTGATCTTTTGCC  99

seq1  TGTGTTAGCTGTGGCATCACGGCGCCTGTCCCCG-AGTCACAAGTGGATG  144
      ||||||||||||||||||||| |||||||||||| |||||||||||||||
seq2  TGTGTTAGCTGTGGCATCACGACGCCTGTCCCCGAAGTCACAAGTGGATG  149

seq1  CGACAGGTTTGATGCCAGACAAGCAACAAGG-CCGGAGGCTTTGGAGAGA  193
      ||||||||||||||||||||||||||||||| |||||||| |||||||||
seq2  CGACAGGTTTGATGCCAGACAAGCAACAAGGCCCGGAGGC-TTGGAGAGA  198

seq1  GGCTGGGCTGCAAGCCACCACTTTGGAGTTTCCTGGCTACTGAGTCTTTG  243
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCT-GGCTGCAAGCCACCACTTTGGAGTTTCCTGGCTACTGAGTCTTTG  247

seq1  AGCCTAAGTCTCTTCTTCCTGAAACTGTAGATGACGCCACTCAGGCAGCA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTAAGTCTCTTCTTCCTGAAACTGTAGATGACGCCACTCAGGCAGCA  297

seq1  AGCCCCCTGGGATGGGAACGAGGGAGTTTTCAGGGCTGACTGCACAGGGG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCCCTGGGATGGGAACGAGGGAGTTTTCAGGGCTGACTGCACAGGGG  347

seq1  CGAGGTGCGCTCAGGAGTACAGCCCTCAGCATTTTATAGTTCCTCCCTTG  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGGTGCGCTCAGGAGTACAGCCCTCAGCATTTTATAGTTCCTCCCTTG  397

seq1  CAGAGGTTTTCAAATGGAATGTATTTTGTAAAACTGGATTGGCAATTTTA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGTTTTCAAATGGAATGTATTTTGTAAAACTGGATTGGCAATTTTA  447

seq1  GCCAAGCCACTTACATCGTAAATGTCTTGGTGTATTTGAGGAGAGAGCAG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAAGCCACTTACATCGTAAATGTCTTGGTGTATTTGAGGAGAGAGCAG  497

seq1  GGTCCTACAAGCTACCAGATCGGATGCAGGGGACGTGGGCATGGCTGCAA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCTACAAGCTACCAGATCGGATGCAGGGGACGTGGGCATGGCTGCAA  547

seq1  TGGGGGAGGAGACCTATGCTGGGGGCAGCTGGGAGACGCTGCTCAAGCTC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGAGGAGACCTATGCTGGGGGCAGCTGGGAGACGCTGCTCAAGCTC  597

seq1  TGGCCTCCTATACTCTTAGACAACACCCATTGTTTTGTTTTGTTTTGTTT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTCCTATACTCTTAGACAACACCCATTGTTTTGTTTTGTTTTGTTT  647

seq1  TGTTTTTTAATTAAATGTCAGAGGCCAACAAGATCTAAATTCAATCTCTG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTTTTAATTAAATGTCAGAGGCCAACAAGATCTAAATTCAATCTCTG  697

seq1  TAGCAATATGGTGTAAGGGGAGAACTTCCTGCAAGCTGTCCTCTGACCTC  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAATATGGTGTAAGGGGAGAACTTCCTGCAAGCTGTCCTCTGACCTC  747

seq1  CACACGCATGCTACGGGAAACACACACAATAATTTTCAGAAGTACATAAA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACGCATGCTACGGGAAACACACACAATAATTTTCAGAAGTACATAAA  797

seq1  CTCTATATACAAATGAAGCTGGGTGTACTTACTGAAGAAGTCTTTCTTTG  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATATACAAATGAAGCTGGGTGTACTTACTGAAGAAGTCTTTCTTTG  847

seq1  CAAGGTTCTTGGCACACAATACTGAAAACAAGCAGACACTGGAGTTAACA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGTTCTTGGCACACAATACTGAAAACAAGCAGACACTGGAGTTAACA  897

seq1  TTGATACAGCAAACGTCCCGCACACTTAGTGTTTGTAACAGGAGGGGGAA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATACAGCAAACGTCCCGCACACTTAGTGTTTGTAACAGGAGGGGGAA  947

seq1  AAAAATCACAGAAGTTAATATGTCAGTCATCTCTCAAACTGTCTCACTTT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATCACAGAAGTTAATATGTCAGTCATCTCTCAAACTGTCTCACTTT  997

seq1  AGACAAGCATCCCTAGCAACTATCTAAAAAAGTATCTTTCCTCAAACTGG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAAGCATCCCTAGCAACTATCTAAAAAAGTATCTTTCCTCAAACTGG  1047

seq1  AGAATCAACAAATGTAAACACTATCATTTAAGCCTAAAACATTAACTGCA  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATCAACAAATGTAAACACTATCATTTAAGCCTAAAACATTAACTGCA  1097

seq1  CAAACACAGAGATGGAATTC  1113
      ||||||||||||||||||||
seq2  CAAACACAGAGATGGAATTC  1117

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information