MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-316N19
Chromosome	5 (Build37)
Map Location	36,613,073 - 36,733,038
singlet/doublet	doublet
Overlap gene	Sorcs2
Upstream gene	Adra2c, Hmx1, Cpz, Plk-ps1, 2310079F23Rik, Acox3, Htra3, Sh3tc1, Ablim2, Afap1, LOC100040209, 2310020A21Rik
Downstream gene	Grpel1, Ccdc96, Tbc1d14, D5Ertd579e, LOC100040278, LOC100040825, Cno, Mrfap1, Man2b2, Ppp2r2c, Wfs1, Jakmip1, EG330070, Gm1043, LOC100040936, Crmp1, Evc, Evc2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Adra2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11553 MGI:87936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15371 MGI:107178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242939 MGI:88487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plk-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18818 MGI:103247
definition	note : polo-like kinase, pseudogene 1 pseudo : _no_value

name	2310079F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78890 MGI:1926140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80911 MGI:1933156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sh3tc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231147 MGI:2678949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ablim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231148 MGI:2385758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Afap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70292 MGI:1917542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	Sorcs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310020A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grpel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66717 MGI:1913967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100855 MGI:1098708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D5Ertd579e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	LOC100040825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Cno (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrfap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67568 MGI:1914818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17160 MGI:1195262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269643 MGI:2442660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jakmip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76071 MGI:1923321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Gm1043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100040936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Crmp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12933 MGI:107793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59056 MGI:1890596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68525 MGI:1915775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024218 GeneID:11553 MGI:87936
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 2c transcript_id : NM_007418.2

name	Hmx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129994 GeneID:15371 MGI:107178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H6 homeo box 1 transcript_id : NM_010445.2

name	Cpz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407065 GeneID:242939 MGI:88487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase Z transcript_id : NM_153107.2

name	2310079F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801895 GeneID:78890 MGI:1926140
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310079F23 gene transcript_id : NM_030208.2

name	Acox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328333 GeneID:80911 MGI:1933156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase 3, pristanoyl transcript_id : NM_030721.2

name	Htra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815868 GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 3 transcript_id : NM_030127.2

name	Htra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815866 GeneID:78558 MGI:1925808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 3 transcript_id : NM_001042615.1

name	Sh3tc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996510 GeneID:231147 MGI:2678949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 domain and tetratricopeptide repeats 1 transcript_id : NM_194344.1

name	Ablim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353512 GeneID:231148 MGI:2385758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin-binding LIM protein 2 transcript_id : NM_177678.5

name	Afap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78486554 GeneID:70292 MGI:1917542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin filament associated protein 1 transcript_id : NM_027373.2

name	Sorcs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301216 GeneID:81840 MGI:1932289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sortilin-related VPS10 domain containing receptor 2 transcript_id : NM_030889.2

name	2310020A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301213 GeneID:76943 MGI:1924193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310020A21 gene transcript_id : NM_175249.3

name	Grpel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542920 GeneID:17713 MGI:1334417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GrpE-like 1, mitochondrial transcript_id : NM_024478.2

name	Ccdc96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541960 GeneID:66717 MGI:1913967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 96 transcript_id : NM_025725.2

name	Tbc1d14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559984 GeneID:100855 MGI:1098708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 14 transcript_id : NM_133910.2

name	D5Ertd579e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486994 GeneID:320661 MGI:1261849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 5, ERATO Doi 579, expressed transcript_id : NM_001081232.1

name	LOC100040278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253859 GeneID:100040278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : hypothetical protein LOC100040278 transcript_id : XM_001474408.1

name	LOC100040825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253872 GeneID:100040825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to D5Ertd579e protein transcript_id : XM_001476163.1

name	Cno (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988412 GeneID:117197 MGI:1929230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cappuccino transcript_id : NM_133724.3

name	Mrfap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375273 GeneID:67568 MGI:1914818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Morf4 family associated protein 1 transcript_id : NM_026242.2

name	Man2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678791 GeneID:17160 MGI:1195262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B2 transcript_id : NM_008550.1

name	Ppp2r2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475972 GeneID:269643 MGI:2442660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform transcript_id : NM_172994.2

name	Wfs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672922 GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolfram syndrome 1 homolog (human) transcript_id : NM_011716.2

name	Jakmip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801680 GeneID:76071 MGI:1923321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : janus kinase and microtubule interacting protein 1 transcript_id : NM_178394.3

name	EG330070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374698 GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG330070 transcript_id : XM_897537.2

name	Gm1043 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374701 GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 1043, (NCBI) transcript_id : XM_355598.4

name	LOC100040936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253874 GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : hypothetical protein LOC100040936 transcript_id : XM_001476309.1

name	Crmp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068506 GeneID:12933 MGI:107793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : collapsin response mediator protein 1 transcript_id : NM_007765.3

name	Evc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947019 GeneID:59056 MGI:1890596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld gene homolog (human) transcript_id : NM_021292.1

name	Evc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981838 GeneID:68525 MGI:1915775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld syndrome 2 homolog (human) transcript_id : NM_145920.2

name	Adra2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680664 CCDS:CCDS19226.1 GeneID:11553 MGI:87936
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004935 - adrenoceptor activity [Evidence IEA]; GO:0004938 - alpha2-adrenergic receptor activity [Evidence IEA] [Evidence TAS]; GO:0004930 - G-protein coupled receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : subtype alpha2-C4 product : adrenergic receptor, alpha 2c protein_id : NP_031444.1

name	Hmx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754218 CCDS:CCDS19228.1 GeneID:15371 MGI:107178
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : H6 homeo box 1 protein_id : NP_034575.1

name	Cpz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407066 CCDS:CCDS19229.1 GeneID:242939 MGI:88487
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence TAS] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0004181 - metallocarboxypeptidase activity [Evidence TAS] GO_process : GO:0016485 - protein processing [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : carboxypeptidase Z protein_id : NP_694747.2

name	2310079F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313518 CCDS:CCDS19230.1 GeneID:78890 MGI:1926140
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC78890 protein_id : NP_084484.1

name	Acox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328334 CCDS:CCDS19232.1 GeneID:80911 MGI:1933156
definition	GO_component : GO:0005782 - peroxisomal matrix [Evidence TAS]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016402 - pristanoyl-CoA oxidase activity [Evidence TAS] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence TAS]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : pristanoyl-CoA oxidase product : acyl-Coenzyme A oxidase 3, pristanoyl protein_id : NP_109646.2

name	Htra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815869 CCDS:CCDS19233.1 GeneID:78558 MGI:1925808
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : isoform a precursor is encoded by transcript variant 1; toll-associated serine protease; pregnancy-related serine protease product : HtrA serine peptidase 3 isoform a precursor protein_id : NP_084403.2

name	Htra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815867 GeneID:78558 MGI:1925808
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : isoform b precursor is encoded by transcript variant 2; toll-associated serine protease; pregnancy-related serine protease product : HtrA serine peptidase 3 isoform b precursor protein_id : NP_001036080.1

name	Sh3tc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996511 CCDS:CCDS19234.1 GeneID:231147 MGI:2678949
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : SH3 domain and tetratricopeptide repeats 1 protein_id : NP_919325.1

name	Ablim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66773171 CCDS:CCDS19235.1 GeneID:231148 MGI:2385758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : actin-binding LIM protein 2 protein_id : NP_808346.3

name	Afap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859696 CCDS:CCDS19236.1 GeneID:70292 MGI:1917542
definition	GO_process : GO:0009966 - regulation of signal transduction [Evidence ISS] codon_start : 1 note : actin filament associated protein product : actin filament associated protein 1 protein_id : NP_081649.1

name	Sorcs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301217 CCDS:CCDS19237.1 GeneID:81840 MGI:1932289
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : VPS10 domain receptor protein product : VPS10 domain receptor protein SORCS 2 protein_id : NP_112151.2

name	2310020A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301214 GeneID:76943 MGI:1924193
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006665 - sphingolipid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76943 protein_id : NP_780458.2

name	Grpel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277394 CCDS:CCDS19238.1 GeneID:17713 MGI:1334417
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0000774 - adenyl-nucleotide exchange factor activity [Evidence IEA]; GO:0051087 - chaperone binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : GrpE-like 1, mitochondrial protein_id : NP_077798.1

name	Ccdc96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385186 CCDS:CCDS19239.1 GeneID:66717 MGI:1913967
definition	codon_start : 1 product : coiled-coil domain containing 96 protein_id : NP_080001.1

name	Tbc1d14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559985 CCDS:CCDS19240.1 GeneID:100855 MGI:1098708
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 14 protein_id : NP_598671.2

name	D5Ertd579e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486995 GeneID:320661 MGI:1261849
definition	codon_start : 1 product : hypothetical protein LOC320661 protein_id : NP_001074701.1

name	LOC100040825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253873 GeneID:100040825
definition	codon_start : 1 product : similar to D5Ertd579e protein protein_id : XP_001476213.1

name	LOC100040278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253860 GeneID:100040278
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474458.1

name	Cno (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526908 CCDS:CCDS19241.1 GeneID:117197 MGI:1929230
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : cappuccino protein_id : NP_598485.1

name	Mrfap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385746 CCDS:CCDS19242.1 GeneID:67568 MGI:1914818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : protein associated with MRG, 14 kDa protein_id : NP_080518.1

name	Man2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678792 CCDS:CCDS19243.1 GeneID:17160 MGI:1195262
definition	GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 135 kD alpha-D-mannosidase; 135 kDa alpha-D-mannosidase product : mannosidase alpha class 2B member 2 protein_id : NP_032576.1

name	Ppp2r2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370502 CCDS:CCDS19244.1 GeneID:269643 MGI:2442660
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform protein_id : NP_766582.1

name	Wfs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755997 CCDS:CCDS19245.1 GeneID:22393 MGI:1328355
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Wolfram syndrome 1 protein homolog protein_id : NP_035846.1

name	Jakmip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409980 CCDS:CCDS19246.1 GeneID:76071 MGI:1923321
definition	GO_component : GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : gamma-aminobutyric acid (GABA-B) receptor binding protein protein_id : NP_848481.1

name	EG330070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897377 GeneID:330070 MGI:3643506
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902630.1

name	Gm1043 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374702 GeneID:381634 MGI:2685889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355598.4

name	LOC100040936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253875 GeneID:100040936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476359.1

name	Crmp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068507 GeneID:12933 MGI:107793
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : collapsin response mediator protein 1 protein_id : NP_031791.3

name	Evc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947020 CCDS:CCDS19247.1 GeneID:59056 MGI:1890596
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EvC protein (Ellis-van Creveld syndrome) product : Ellis van Creveld gene homolog protein_id : NP_067267.1

name	Evc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122329 CCDS:CCDS19248.1 GeneID:68525 MGI:1915775
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Ellis van Creveld syndrome 2 homolog protein_id : NP_666032.1

name	LOC100040209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040209
definition	number : 1 pseudo : _no_value

name	LOC100040209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040209
definition	number : 2 pseudo : _no_value

clone name	MSMg01-116F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-316N19.b	B6Ng01-316N19.g
ACC	GA107152	GA107153
length	1,175	1,026
definition	B6Ng01-316N19.b	B6Ng01-316N19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(36,613,073 - 36,614,244)	(36,732,031 - 36,733,038)
sequence	gaattctgcttcatgatgacaacctcaggtgtccagtacagtgagggaga gggagttcacacagacaggtaactcatgaagaaaagacaacaggttcaga tcttgccaccaaatcaacccattaacccaaggttcattaaacagtgtctt agttagggtcttgttgctgtgaaaagacacaatgaccaagtcaactctta taaaggacaacatttaattgaggctggcttacaggttcaggggttcagtc catcatcatcatggtgggaatcatgacatcatacagacagacatggtgct agaggagctgagagttctacatcttgattcaaaaggcagcaggaggagac tatgtcacactggtagacttgagaatatatatgagacctcaaagtaccag ctccacagtgacacacttcctctaacaaagccacgtctcctctgataagg tcacacctcctaatactgccaccacccctgggccaaacgtattcaaatca ccaccaaaaggaactcaagagagacagaagaaactgacaaagcagacagc tgttcactccatcatccctgtatcatcagggcaccactactcatcacccc atcatctttccatcactgcaccatcacactgttattccatcactgcatca tcactctatcatgccatcatcactgcatcactgcatcattgctctatcac cactgcaacatcacctcatcatcattgcatcatcacttcattaccactgc atcatcattccatcatcactatgtcatcactgtatcatcactacatcatc agtctaccatgccaccccccagtctatcatgccatcattactccatcact gcatcattgatgcatcatgactgcatctcatttccaccattactgtatca ccactgcatcaccatcccaccatcactgcatcattactacatcatctcct cagcactgcatcaccactccatcactgcatcatcaaccccaattaccact gcatcattgcttcatcattactttgtcatcattcatcatcactgcatctc cactaacatcatcactgcaacttctcagtatgcaaatccactccaccata acctctcacagctgaaattatttgcgtgtatcatcatcaatcaccgaatc atcagtcttttatttgcgtcatcac	gaattctttccagagtgtcctcagggctgtgtgaacatgtgggtggggga ttcagggagactccctagaggaggtgcagatggagccgctctgaaggaca aggagaagagcctcacccagtctgaggtggagactgggaaagaaagcaag gatattgaggccaggagggaggtgaggagctgagaagcccagagagctct caggcagaggagggagacagctgccatcaggaagtttggctcagaggtgc cagggcagcccttcagcaaagttcctgacacacttcacacacccacttct gctttaatgaaggggctcttttagtctatagttgcaggaggttccagagc gcatgctaaggaggtcgtacactagctcgtctgcacactcgttgggtcag tctgtggcttgctcaggcctctccagagttgatgttactccacagtgatg attttccagtcaggttaggacttgccaggggtgacgcgaatgagtacaga gttggagcttctggaaaagcagctgggtgcctttgtggggccccgagctt acaggctaccttctggttggggctctctgggacccaaactttaagagtcc attgatggctctctttggatgctctgtgggttaccaagggaggctgagcc ctgagggtctaatgatgtcaccaggactgctactcaagatcattccttca gggtgcagggaccagggctgagctctgaccctgcagaatttatagtttgt cagatgtgaatactaatctatatgtgttaggctggcttgggtctgcacat gatagacatcaacagagtgcatgctcgtatcagatcatgtcatggctgtc ttgggttattgggagacccctttccagggtctttgcgtgagtgtgatctg ggattctgagtggtgaaagaagccaacaatatgattggggatgggcatgc ccccacatggtagagtcggggtgtgatcaccatgctttttctgggatccg cccccacaaaggttggaaactgaaga
quality values	Open. Hide. 46 31 33 35 58 62 47 47 42 62 54 39 27 62 62 41 41 62 47 56 33 62 62 62 62 47 47 62 62 62 62 59 59 59 21 32 33 40 51 47 56 62 62 59 62 62 62 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 49 42 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 42 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 54 58 54 58 54 54 52 58 54 58 58 49 58 58 58 58 58 58 54 52 58 58 58 54 58 58 52 58 46 58 58 58 58 58 58 58 47 54 54 58 58 44 54 58 58 58 58 58 58 49 58 58 58 58 58 58 54 54 58 54 58 58 58 58 50 49 58 50 58 49 49 58 58 46 47 58 58 58 51 58 58 58 49 58 54 58 58 58 58 58 54 40 38 36 58 58 51 51 58 58 58 53 41 51 53 58 51 52 51 53 54 47 58 58 46 51 39 58 50 44 46 58 58 51 51 58 58 58 52 54 53 53 54 58 52 54 51 51 49 53 53 39 38 54 58 51 50 50 58 51 53 53 52 54 58 50 58 51 50 51 52 51 38 46 51 49 41 51 52 52 51 49 51 52 51 51 42 54 51 52 52 49 50 52 49 42 54 34 44 54 49 42 47 41 49 50 54 54 52 50 47 49 42 49 49 42 50 50 46 35 41 51 45 42 53 42 45 53 54 54 43 37 33 49 40 47 41 41 45 39 42 39 52 53 40 45 53 40 37 33 51 35 38 33 53 42 35 52 45 40 35 33 40 42 53 45 37 39 39 32 31 26 19 32 45 45 40 40 33 34 32 32 38 27 32 34 31 52 36 32 41 39 39 32 42 52 35 32 30 52 34 31 52 33 26 33 28 49 49 46 46 26 29 13 23 45 32 42 31 28 31 31 45 32 46 27 31 33 36 39 34 34 31 36 37 31 26 31 31 30 30 36 41 31 31 31 28 31 32 31 31 35 28 31 30 28 31 29 38 34 42 37 31 31 42 36 35 38 31 31 30 32 30 47 43 29 32 26 31 31 30 30 23 32 31 31 39 13 20 31 31 31 31 31 27 32 22 35 35 32 25 22 21 18 19 31 43 36 48 37 30 25 31 25 31 31 33 29 20 29 32 32 31 33 38 32 28 31 31 31 17 13 16 31 21 24 31 31 29 11 10 14 24 37 32 31 37 32 27 24 20 24 31 24 42 29 18 15 21 29 17 21 32 30 32 34 29 19 19 22 32 33 22 34 33 21 14 6 16 31 31 33 7 8 33 26 21 22 34 22 32 32 33 32 34 34 31 32 12 19 32 18 18 16 22 19 14 14 22 21 7 23 12 17 47 24 24 15 27 28 28 20 10 28 16 24 6 15 23 20 21 24 19 12 11 14 12 18 24 11 9 13 9 28 27 14 17 5 3 8 28 27 25 21 22 18 18 16 16 14 19 8 12 7 7 7 2 2 16 9 11 8 11 9 9 6 22 13 3 8 5 6 11 9 17 20 12 6 5 2 4 6 3 2 2 11 10 13 9 16 16 16 6 9 8 10 9 27 11 5 4 6 7 13 13 21 9 3 3 8 7 12 14 12 8 5 12 3 3 3 1 4 16 11 7 7 18 2 4 2 3 8 7 7 5 1 1 3 2 3 8 26 4 6 6 7 10 10 12 16 6 5 5 3 4 6 10	Open. Hide. 62 47 46 47 62 62 62 62 62 24 21 14 10 21 13 18 36 21 21 21 56 62 47 56 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 19 49 62 59 59 62 54 20 33 54 59 62 62 62 62 59 62 59 59 59 62 54 54 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 62 62 59 59 62 59 62 59 59 62 62 62 54 54 59 59 62 59 42 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 59 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 59 59 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 48 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 47 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 38 56 62 56 62 62 62 62 62 43 62 47 62 47 62 54 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 52 62 47 62 62 54 52 62 52 47 49 58 58 54 54 58 58 58 54 37 54 58 58 52 58 58 58 58 54 58 52 58 54 58 58 58 58 28 30 58 58 52 52 48 54 54 54 58 52 52 40 58 50 54 49 41 41 54 54 52 38 47 58 54 54 58 58 47 52 58 58 46 42 40 28 20 54 46 54 52 54 54 45 42 58 52 52 52 42 38 42 32 54 52 58 58 42 24 51 53 54 58 58 27 58 51 58 50 54 46 16 58 49 50 46 53 50 58 50 58 50 36 50 53 58 39 50 50 41 35 49 49 31 41 45 51 51 40 38 54 53 40 49 49 36 37 37 25 49 53 39 38 50 49 47 27 28 58 49 42 54 40 46 21 28 25 15 31 48 34 50 27 33 39 53 31 58 18 49 49 42 41 50 32 23 44 50 41 50 31 30 32 58 39 40 58 24 32 51 50 29 14 49 33 53 42 50 22 21 42 10 22 34 50 50 32 38 29 41 43 37 39 53 39 42 34 38 25 47 53 42 53 39 34 16 6 37 26 29 24 54 31 35 49 33 54 47 39 42 36 34 21 32 49 39 37 39 39 38 35 42 40 32 40 45 28 31 14 14 21 25 34 10 31 40 30 37 31 47 36 40 39 18 18 25 30 35 32 16 39 32 32 35 34 45 32 40 17 33 33 36 31 37 21 5 11 25 33 33 29 23 7 9 14 10 10 49 47 13 51 16 9 5 30 34 18 40 39 19 19 17 16 12 30 35 28 15 11 51 7 15 26 20 16 23 29 13 30 31 18 31 35 37 34 26 27 43 8 30 16 24 9 13 20 31 9 5 11 6 11 11 51 46 22 17 37 12 7 25 9 7 7 19 13 11 12 26 27 20 22 6 6 9 31 28 8 7 6 29 14 28 12 9 9 25 20 31 37 30 26 20 21 8 31 13 8 5 6 7 9 38 10 21 6 26 32 21 8 22 6 9 13 10 14 10 7 9 6 11 15 13 30 43 35 31 23 14 12 21 30 22 19 7 18 16 12 7 21 30 30 9 7 5 14 20 11 8 14 13 14 12 31 29 18 29 27 32 15 10 16 8 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_36613073_36614244
seq2: B6Ng01-316N19.b_50_1224

seq1  GAATTCTGCTTCATGATGACAACCTCAGGTGTCCAGTACAGTGAGGGAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGCTTCATGATGACAACCTCAGGTGTCCAGTACAGTGAGGGAGA  50

seq1  GGGAGTTCACACAGACAGGTAACTCATGAAGAAAAGACAACAGGTTCAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGTTCACACAGACAGGTAACTCATGAAGAAAAGACAACAGGTTCAGA  100

seq1  TCTTGCCACCAAATCAACCCATTAACCCAAGGTTCATTAAACAGTGTCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCCACCAAATCAACCCATTAACCCAAGGTTCATTAAACAGTGTCTT  150

seq1  AGTTAGGGTCTTGTTGCTGTGAAAAGACACAATGACCAAGTCAACTCTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAGGGTCTTGTTGCTGTGAAAAGACACAATGACCAAGTCAACTCTTA  200

seq1  TAAAGGACAACATTTAATTGAGGCTGGCTTACAGGTTCAGGGGTTCAGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGACAACATTTAATTGAGGCTGGCTTACAGGTTCAGGGGTTCAGTC  250

seq1  CATCATCATCATGGTGGGAATCATGACATCATACAGACAGACATGGTGCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATCATCATGGTGGGAATCATGACATCATACAGACAGACATGGTGCT  300

seq1  AGAGGAGCTGAGAGTTCTACATCTTGATTCAAAAGGCAGCAGGAGGAGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGAGCTGAGAGTTCTACATCTTGATTCAAAAGGCAGCAGGAGGAGAC  350

seq1  TATGTCACACTGGTAGACTTGAGAATATATATGAGACCTCAAAGTACCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTCACACTGGTAGACTTGAGAATATATATGAGACCTCAAAGTACCAG  400

seq1  CTCCACAGTGACACACTTCCTCTAACAAAGCCACGTCTCCTCTGATAAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACAGTGACACACTTCCTCTAACAAAGCCACGTCTCCTCTGATAAGG  450

seq1  TCACACCTCCTAATACTGCCACCACCCCTGGGCCAAACGTATTCAAATCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACACCTCCTAATACTGCCACCACCCCTGGGCCAAACGTATTCAAATCA  500

seq1  CCACCAAAAGGAACTCAAGAGAGACAGAAGAAACTGACAAAGCAGACAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCAAAAGGAACTCAAGAGAGACAGAAGAAACTGACAAAGCAGACAGC  550

seq1  TGTTCACTCCATCATCCCTGTATCATCAGGGCACCACTACTCATCACCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCACTCCATCATCCCTGTATCATCAGGGCACCACTACTCATCACCCC  600

seq1  ATCATCTTTCCATCACTGCACCATCACACTGTTATTCCATCACTGCATCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTTTCCATCACTGCACCATCACACTGTTATTCCATCACTGCATCA  650

seq1  TCACTCTATCATGCCATCATCACTGCATCACTGCATCATTGCTCTATCAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCTATCATGCCATCATCACTGCATCACTGCATCATTGCTCTATCAC  700

seq1  CACTGCAACATCACCTCATCATCATTGCATCATCACTTCATTACCACTGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGCAACATCACCTCATCATCATTGCATCATCACTTCATTACCACTGC  750

seq1  ATCATCATTCCATCATCACTATGTCATCACTGTATCATCACTACATCATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCATTCCATCATCACTATGTCATCACTGTATCATCACTACATCATC  800

seq1  AGTCTACCATGCCACCCCCCAGTCTATCATGCCATCATTACTCCATCACT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTACCATGCCACCCCCCAGTCTATCATGCCATCATTACTCCATCACT  850

seq1  GCATCATTGATGCATCATGACTGCATCTCATTTCCACCATTACTGTATCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATCATTGATGCATCATGACTGCATCTCATTTCCACCATTACTGTATCA  900

seq1  CCACTGCATCACCATCCCACCATCACTGCATCATTACTACATCATCTCCT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGCATCACCATCCCACCATCACTGCATCATTACTACATCATCTCCT  950

seq1  CAGCACTGCATCACCACTCCATCACTGCATCATCA--CCCCATTACCACT  998
      |||||||||||||||||||||||||||||||||||  ||| |||||||||
seq2  CAGCACTGCATCACCACTCCATCACTGCATCATCAACCCCAATTACCACT  1000

seq1  GCATCATTGCTTCATCATTACTTTGTCATCATTCCATCATCACTGCATCT  1048
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  GCATCATTGCTTCATCATTACTTTGTCATCATT-CATCATCACTGCATCT  1049

seq1  CCACT-ACATCATCACTGCAACTCCTCAGTATTGCAAAATCACTCCACCA  1097
      ||||| ||||||||||||||||| ||||||| ||||||  ||||||||||
seq2  CCACTAACATCATCACTGCAACTTCTCAGTA-TGCAAATCCACTCCACCA  1098

seq1  TAAACCTCTCACAGCTG-AATTA-TTGC-TGTATCATCATTCCATCACCG  1144
      | ||||||||||||||| ||||| |||| |||||||||| || |||||||
seq2  T-AACCTCTCACAGCTGAAATTATTTGCGTGTATCATCA-TCAATCACCG  1146

seq1  AATCATCACTTCTTTA-TTGCGTCATCAC  1172
      |||||||| |  |||| ||||||||||||
seq2  AATCATCAGTCTTTTATTTGCGTCATCAC  1175

seq1: chr5_36732031_36733038
seq2: B6Ng01-316N19.g_72_1097 (reverse)

seq1  TCTTCAGTTTCCAGCC-TTGT-GGGGCGGGT-CCAG-AAAAGCGT-GTGA  45
      ||||||||||||| || |||| ||||||| | |||| |||||| | ||||
seq2  TCTTCAGTTTCCAACCTTTGTGGGGGCGGATCCCAGAAAAAGCATGGTGA  50

seq1  TCACA--CCGAC-CTGCCATGT-GGGGCATGCCCATCCCC-ATCATATTG  90
      |||||  ||||| || |||||| ||||||||||||||||| |||||||||
seq2  TCACACCCCGACTCTACCATGTGGGGGCATGCCCATCCCCAATCATATTG  100

seq1  -TGGCTTCTTTCA-CACTCAGAAT-CCAGATCACACTCACGC-AAGACCC  136
       |||||||||||| |||||||||| ||||||||||||||||| |||||||
seq2  TTGGCTTCTTTCACCACTCAGAATCCCAGATCACACTCACGCAAAGACCC  150

seq1  TGGAA--GGGTCTCCCA--TACCCAAGACAGCCATGACATGATCTGATAC  182
      |||||  ||||||||||   ||||||||||||||||||||||||||||||
seq2  TGGAAAGGGGTCTCCCAATAACCCAAGACAGCCATGACATGATCTGATAC  200

seq1  GAGCATGCACTCTGTTGATGTCTATCATGTGCAGACCCAAGCCAGCCTAA  232
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCATGCACTCTGTTGATGTCTATCATGTGCAGACCCAAGCCAGCCTAA  250

seq1  CACATATAGATTAGTATTCACATCTGACAAACTATAAATTCTGCAGGGTC  282
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATATAGATTAGTATTCACATCTGACAAACTATAAATTCTGCAGGGTC  300

seq1  AGAGCTCAGCCCTGGTCCCTGCACCCTGAAGGAATGATCTTGAGTAGCAG  332
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTCAGCCCTGGTCCCTGCACCCTGAAGGAATGATCTTGAGTAGCAG  350

seq1  TCCTGGTGACATCATTAGACCCTCAGGGCTCAGCCTCCCTTGGTAACCCA  382
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGTGACATCATTAGACCCTCAGGGCTCAGCCTCCCTTGGTAACCCA  400

seq1  CAGAGCATCCAAAGAGAGCCATCAATGGACTCTTAAAGTTTGGGTCCCAG  432
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCATCCAAAGAGAGCCATCAATGGACTCTTAAAGTTTGGGTCCCAG  450

seq1  AGAGCCCCAACCAGAAGGTAGCCTGTAAGCTCGGGGCCCCACAAAGGCAC  482
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCCCAACCAGAAGGTAGCCTGTAAGCTCGGGGCCCCACAAAGGCAC  500

seq1  CCAGCTGCTTTTCCAGAAGCTCCAACTCTGTACTCATTCGCGTCACCCCT  532
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTGCTTTTCCAGAAGCTCCAACTCTGTACTCATTCGCGTCACCCCT  550

seq1  GGCAAGTCCTAACCTGACTGGAAAATCATCACTGTGGAGTAACATCAACT  582
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAGTCCTAACCTGACTGGAAAATCATCACTGTGGAGTAACATCAACT  600

seq1  CTGGAGAGGCCTGAGCAAGCCACAGACTGACCCAACGAGTGTGCAGACGA  632
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAGAGGCCTGAGCAAGCCACAGACTGACCCAACGAGTGTGCAGACGA  650

seq1  GCTAGTGTACGACCTCCTTAGCATGCGCTCTGGAACCTCCTGCAACTATA  682
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGTGTACGACCTCCTTAGCATGCGCTCTGGAACCTCCTGCAACTATA  700

seq1  GACTAAAAGAGCCCCTTCATTAAAGCAGAAGTGGGTGTGTGAAGTGTGTC  732
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTAAAAGAGCCCCTTCATTAAAGCAGAAGTGGGTGTGTGAAGTGTGTC  750

seq1  AGGAACTTTGCTGAAGGGCTGCCCTGGCACCTCTGAGCCAAACTTCCTGA  782
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACTTTGCTGAAGGGCTGCCCTGGCACCTCTGAGCCAAACTTCCTGA  800

seq1  TGGCAGCTGTCTCCCTCCTCTGCCTGAGAGCTCTCTGGGCTTCTCAGCTC  832
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAGCTGTCTCCCTCCTCTGCCTGAGAGCTCTCTGGGCTTCTCAGCTC  850

seq1  CTCACCTCCCTCCTGGCCTCAATATCCTTGCTTTCTTTCCCAGTCTCCAC  882
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACCTCCCTCCTGGCCTCAATATCCTTGCTTTCTTTCCCAGTCTCCAC  900

seq1  CTCAGACTGGGTGAGGCTCTTCTCCTTGTCCTTCAGAGCGGCTCCATCTG  932
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGACTGGGTGAGGCTCTTCTCCTTGTCCTTCAGAGCGGCTCCATCTG  950

seq1  CACCTCCTCTAGGGAGTCTCCCTGAATCCCCCACCCACATGTTCACACAG  982
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTCCTCTAGGGAGTCTCCCTGAATCCCCCACCCACATGTTCACACAG  1000

seq1  CCCTGAGGACACTCTGGAAAGAATTC  1008
      ||||||||||||||||||||||||||
seq2  CCCTGAGGACACTCTGGAAAGAATTC  1026

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information