MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-322C04
Chromosome	5 (Build37)
Map Location	38,147,540 - 38,290,147
singlet/doublet	doublet
Overlap gene	Msx1
Upstream gene	Mrfap1, Man2b2, Ppp2r2c, Wfs1, Jakmip1, EG330070, Gm1043, LOC100040936, Crmp1, Evc, Evc2, LOC100040355, LOC100040988, Stk32b, Cytl1
Downstream gene	Stx18, Nsg1, LOC100040397, Zfp509, Lyar, Tmem128, Otop1, Drd5, 4930487D11Rik, Slc2a9, Wdr1, 4930421P07Rik, 6820424L24Rik, Clnk
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mrfap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67568 MGI:1914818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17160 MGI:1195262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269643 MGI:2442660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jakmip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76071 MGI:1923321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG330070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Gm1043 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100040936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Crmp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12933 MGI:107793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59056 MGI:1890596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68525 MGI:1915775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040988 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Stk32b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64293 MGI:1927552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cytl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231162 MGI:2684993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17701 MGI:97168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stx18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71116 MGI:1918366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18196 MGI:109149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75079 MGI:1922329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyar (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17089 MGI:107470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66309 MGI:1913559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21906 MGI:2388363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13492 MGI:94927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930487D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78172 MGI:1925422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117591 MGI:2152844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22388 MGI:1337100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930421P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195712 MGI:1921025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	6820424L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100515 MGI:2140750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clnk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27278 MGI:1351468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrfap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375273 GeneID:67568 MGI:1914818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Morf4 family associated protein 1 transcript_id : NM_026242.2

name	Man2b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678791 GeneID:17160 MGI:1195262
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B2 transcript_id : NM_008550.1

name	Ppp2r2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475972 GeneID:269643 MGI:2442660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform transcript_id : NM_172994.2

name	Wfs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672922 GeneID:22393 MGI:1328355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolfram syndrome 1 homolog (human) transcript_id : NM_011716.2

name	Jakmip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801680 GeneID:76071 MGI:1923321
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : janus kinase and microtubule interacting protein 1 transcript_id : NM_178394.3

name	EG330070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374698 GeneID:330070 MGI:3643506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG330070 transcript_id : XM_897537.2

name	Gm1043 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374701 GeneID:381634 MGI:2685889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 1043, (NCBI) transcript_id : XM_355598.4

name	LOC100040936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253874 GeneID:100040936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : hypothetical protein LOC100040936 transcript_id : XM_001476309.1

name	Crmp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068506 GeneID:12933 MGI:107793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : collapsin response mediator protein 1 transcript_id : NM_007765.3

name	Evc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947019 GeneID:59056 MGI:1890596
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld gene homolog (human) transcript_id : NM_021292.1

name	Evc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981838 GeneID:68525 MGI:1915775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ellis van Creveld syndrome 2 homolog (human) transcript_id : NM_145920.2

name	LOC100040988 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253879 GeneID:100040988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to Ubtf protein transcript_id : XM_001476413.1

name	Stk32b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468970 GeneID:64293 MGI:1927552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 32B transcript_id : NM_022416.1

name	Cytl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487394 GeneID:231162 MGI:2684993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine like 1 transcript_id : NM_001081106.1

name	Msx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199782 GeneID:17701 MGI:97168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box, msh-like 1 transcript_id : NM_010835.2

name	Stx18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77736534 GeneID:71116 MGI:1918366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 18 transcript_id : NM_026959.2

name	Nsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77736540 GeneID:18196 MGI:109149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuron specific gene family member 1 transcript_id : NM_010942.3

name	LOC100040397 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253861 GeneID:100040397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001474616.1

name	Zfp509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816976 GeneID:75079 MGI:1922329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 509 transcript_id : NM_029162.2

name	Lyar (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370829 GeneID:17089 MGI:107470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly1 antibody reactive clone transcript_id : NM_025281.2

name	Tmem128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354700 GeneID:66309 MGI:1913559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 128 transcript_id : NM_025480.3

name	Otop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360377 GeneID:21906 MGI:2388363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : otopetrin 1 transcript_id : NM_172709.2

name	Drd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371845 GeneID:13492 MGI:94927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine receptor 5 transcript_id : NM_013503.2

name	4930487D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374711 GeneID:78172 MGI:1925422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930487D11 gene transcript_id : XM_979477.1

name	Slc2a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704101 GeneID:117591 MGI:2152844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 9 transcript_id : NM_145559.1

name	Slc2a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59958360 GeneID:117591 MGI:2152844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 9 transcript_id : NM_001012363.1

name	Wdr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130065 GeneID:22388 MGI:1337100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 1 transcript_id : NM_011715.2

name	6820424L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487268 GeneID:100515 MGI:2140750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6820424L24 gene transcript_id : NM_001081144.1

name	Clnk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982737 GeneID:27278 MGI:1351468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine-dependent hematopoietic cell linker transcript_id : NM_013748.2

name	Mrfap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385746 CCDS:CCDS19242.1 GeneID:67568 MGI:1914818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : protein associated with MRG, 14 kDa protein_id : NP_080518.1

name	Man2b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678792 CCDS:CCDS19243.1 GeneID:17160 MGI:1195262
definition	GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 135 kD alpha-D-mannosidase; 135 kDa alpha-D-mannosidase product : mannosidase alpha class 2B member 2 protein_id : NP_032576.1

name	Ppp2r2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370502 CCDS:CCDS19244.1 GeneID:269643 MGI:2442660
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform protein_id : NP_766582.1

name	Wfs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755997 CCDS:CCDS19245.1 GeneID:22393 MGI:1328355
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Wolfram syndrome 1 protein homolog protein_id : NP_035846.1

name	Jakmip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409980 CCDS:CCDS19246.1 GeneID:76071 MGI:1923321
definition	GO_component : GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : gamma-aminobutyric acid (GABA-B) receptor binding protein protein_id : NP_848481.1

name	EG330070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897377 GeneID:330070 MGI:3643506
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902630.1

name	Gm1043 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374702 GeneID:381634 MGI:2685889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_355598.4

name	LOC100040936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253875 GeneID:100040936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476359.1

name	Crmp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068507 GeneID:12933 MGI:107793
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : collapsin response mediator protein 1 protein_id : NP_031791.3

name	Evc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947020 CCDS:CCDS19247.1 GeneID:59056 MGI:1890596
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EvC protein (Ellis-van Creveld syndrome) product : Ellis van Creveld gene homolog protein_id : NP_067267.1

name	Evc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122329 CCDS:CCDS19248.1 GeneID:68525 MGI:1915775
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Ellis van Creveld syndrome 2 homolog protein_id : NP_666032.1

name	LOC100040988 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253880 GeneID:100040988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476463.1

name	Stk32b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468971 GeneID:64293 MGI:1927552
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : serine threonine kinase 32 product : serine/threonine kinase 32B protein_id : NP_071861.1

name	Cytl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487395 GeneID:231162 MGI:2684993
definition	codon_start : 1 product : cytokine like 1 protein_id : NP_001074575.1

name	Msx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199783 CCDS:CCDS19249.1 GeneID:17701 MGI:97168
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0030900 - forebrain development [Evidence IMP]; GO:0030901 - midbrain development [Evidence IMP]; GO:0007517 - muscle development [Evidence IPI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : muscle-segment homeobox product : homeo box, msh-like 1 protein_id : NP_034965.2

name	Stx18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77736535 CCDS:CCDS19250.1 GeneID:71116 MGI:1918366
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : syntaxin 18 protein_id : NP_081235.2

name	Nsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543351 CCDS:CCDS19251.1 GeneID:18196 MGI:109149
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050780 - dopamine receptor binding [Evidence IEA] GO_process : GO:0007212 - dopamine receptor signaling pathway [Evidence IEA] codon_start : 1 product : neuron specific gene family member 1 protein_id : NP_035072.2

name	LOC100040397 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253862 GeneID:100040397
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474666.1

name	Zfp509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037397 CCDS:CCDS19252.1 GeneID:75079 MGI:1922329
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 509 protein_id : NP_083438.1

name	Lyar (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384622 CCDS:CCDS19253.1 GeneID:17089 MGI:107470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ly1 antibody reactive clone protein_id : NP_079557.1

name	Tmem128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228979 CCDS:CCDS19254.1 GeneID:66309 MGI:1913559
definition	codon_start : 1 product : hypothetical protein LOC66309 protein_id : NP_079756.2

name	Otop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370034 GeneID:21906 MGI:2388363
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_process : GO:0009590 - detection of gravity [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy note : isoform a is encoded by transcript variant a; tilted product : otopetrin 1 isoform a protein_id : NP_766297.1

name	Drd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789042 CCDS:CCDS19255.1 GeneID:13492 MGI:94927
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0019226 - transmission of nerve impulse [Evidence IMP] codon_start : 1 product : dopamine receptor 5 protein_id : NP_038531.1

name	4930487D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374712 GeneID:78172 MGI:1925422
definition	codon_start : 1 product : hypothetical protein LOC78172 protein_id : XP_984571.1

name	Slc2a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704102 CCDS:CCDS19256.1 GeneID:117591 MGI:2152844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005355 - glucose transporter activity [Evidence IDA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; facilitated glucose transporter, type 9 product : solute carrier family 2, member 9 isoform b protein_id : NP_663534.1

name	Slc2a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59958361 GeneID:117591 MGI:2152844
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005355 - glucose transporter activity [Evidence IDA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant a; facilitated glucose transporter, type 9 product : solute carrier family 2, member 9 isoform a protein_id : NP_001012363.1

name	Wdr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755995 GeneID:22388 MGI:1337100
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007605 - sensory perception of sound [Evidence ISS] codon_start : 1 note : WD40 repeat protein 1 product : WD repeat domain 1 protein_id : NP_035845.1

name	6820424L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487269 GeneID:100515 MGI:2140750
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC100515 protein_id : NP_001074613.1

name	Clnk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982738 GeneID:27278 MGI:1351468
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation product : cytokine-dependent hematopoietic cell linker protein_id : NP_038776.2

name	LOC100040355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040355
definition	number : 1 pseudo : _no_value

name	4930421P07Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253882 GeneID:195712 MGI:1921025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : RIKEN cDNA 4930421P07 gene transcript_id : XR_032878.1

clone name	MSMg01-542E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170J22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-322C04.b	B6Ng01-322C04.g
ACC	GA111058	GA111059
length	838	1,158
definition	B6Ng01-322C04.b	B6Ng01-322C04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(38,289,047 - 38,290,147)	(38,147,540 - 38,148,696)
sequence	gaattctgcctaccagacaccttagtattcctgtcctttcttccaatagc atctgtgtcctggtcagggacctggtcagggtcatttgacaggaatagtt gttacctgttactggaacatttgcttcaaatctttctgctggacgaaagc tagccaaattcaccaggagatcatggggacttgggggaaagcatgtttgc acagggccttgggtctaaccttccaacggcctgcaaaatcatagcaagac ccttagcttctccatgtgtggcagccctccacggggaataattgatatca tcgaagccatccttgtccttcagtcctcttacctggctcacagtgagcct gagaggtcccgatttatttccaggccactcggaagagggaagctggaaag tccatagctgtggcttcactgctgcttcccagatggctgtaaggtgcatt ctagcatggtgaaaagactgcccagccggtccttttcaggaagccaagcc accacagtgctaattctgcaggctgtcatcgttgggcatcactgcgtgct gatggtcggccgagtgagtgtaaatagagtcaagattttgctctacaaat gccttggcgcacagctgctcctgggaacacccccccctcacccccccgtc catgccatgtttgaagcgacttctaattggcctcatcctgacccagcctt ggagagaggccctagctggtctcagccaccatgaaaggcagcagatgggg ttcggagcacccctgagcatcactactgggtgtggaaactggcagaagct gatgtttggaagacagcaatccagaggcccagctctgc	gaattctttatgttcagacagagtgatagaaaacccagaagaatctcaac ctccaagaaatcaaagccatcaccctccttacacggagcagcacagggtg ctgtcgtctgagtccctccagatcactgctttgcgcacagttgtgaacca atctgtgaggaagaggaataactttgtcatccctcaagaattagctgctg gggattgagctggatgaatgcaggcttagacaggaggtatcacactcagg gtctaccacccctgtcatcccagctagttaggaggctgaggcaggaggat cacagtgcaagaactacctgagtgaaagtgtgttccaaatcagcctgggc aacttagagaaagaaaccctgcctcaaagtttgaaaggtggagggatcca gctcagcggtagagagcacgcctacactgtaaatgcatcatattaaataa ataggtggagaggcgaatcagcagttaagagctcttattgataggaccca agttcaagtctcagcacccatactgaacagctcacagccacctgtaaccc cagcaccagggaatctaactccttcttctggtctctacaaatatgatcca cttacatacacacatgtacacacacacacacacacacaaataataaataa cttacacatcatccccacactgtgtaaagatgaaactccatcactacaca tcttgggatttctttgcaagagctcttttgggtggataacccctgtctcc cagacaacagctccttcgagtagtggcagtctgtgtgcactgccttgcct ggcctggcaagttactgttggacttataccacagggcgactagagttagt gaggatgcaggtcaaagatgcccctggcagctggcagagactgataaaca gagtgaggtctgacagaggcagaaggaggagacccgctcttattgtcaca ctgcaaacccctaccgtgcctcccaaggcaccagctggcttgaggaatca cccacaataaatgcacacaataaacctccaacattttggactctgcattt ttttctaaggtctttgagaatgcaatggtgaggtttcacggggattcccc aagcttctgtgttatcttgcttgttacctctggttctactcaagttcttc atcatctt
quality values	Open. Hide. 58 47 23 33 62 51 47 41 54 62 56 62 62 41 33 62 54 47 51 62 62 62 62 62 62 59 51 59 62 62 62 59 43 38 38 56 62 62 62 62 62 62 62 49 39 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 59 59 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 33 54 59 62 62 62 62 62 54 54 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 52 58 58 58 58 58 54 54 58 58 58 34 58 58 58 58 58 58 54 54 58 58 58 58 54 58 52 58 54 58 58 54 58 42 58 58 58 58 58 58 58 51 51 51 50 58 58 58 58 54 58 58 58 58 45 54 51 54 53 51 51 49 58 58 58 58 58 53 58 52 54 41 47 58 51 50 47 34 58 58 58 58 58 58 43 12 14 12 6 6 7 58 58 58 58 47 39 41 47 39 50 48 54 50 46 52 58 54 54 48 48 58 58 32 53 46 40 39 53 50 42 41 50 52 52 58 52 36 28 49 51 52 41 52 41 58 41 58 51 51 58 58 50 49 58 50 50 37 42 44 36 29 51 32 36 24 44 26 54 58 49 49 38 44 37 49 46 32 53 35 39 42 31 41 39 32 52 50 30 45 49 44 50 44 23 44 21 47 29 49 49 29 53 29 53 54 54 54 39 52 47 40 54 51 23 53 45 52 53 46 46 37 31 32 13 49 35 40 34 21 22 37 32 37 31 46 36 51 39 53 45 51 31 38 49 34 32 28 38 40 31 45 35 51 36 27 45 34 32 53 32 53 45 47 34 36 32 28 42 24 33 13 32 29 53 31 23 30 32 51 31 21 29 8 51 28 40 40 35 32 32 27 31 26 31 33	Open. Hide. 62 47 56 47 62 62 62 62 54 62 47 56 42 38 20 11 21 38 38 43 59 44 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 58 43 58 58 58 58 58 58 58 58 54 58 58 54 58 58 54 58 54 58 58 58 58 58 58 45 58 58 58 58 58 54 58 54 58 58 42 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 54 58 58 58 54 58 54 58 58 58 58 58 51 58 58 58 58 51 58 54 58 58 58 58 52 58 58 51 58 58 58 54 58 58 58 58 52 54 58 50 49 58 51 49 54 58 49 43 37 58 53 51 58 58 58 49 58 58 51 52 51 58 58 51 58 58 51 50 58 51 48 50 52 52 58 58 51 50 51 58 54 49 58 37 50 53 58 58 52 54 50 51 52 58 53 54 51 58 51 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 41 43 58 58 44 49 58 58 49 50 58 49 58 52 54 49 49 53 53 54 53 53 52 51 54 54 49 40 52 53 54 47 54 31 51 41 51 54 49 49 47 32 50 54 54 50 49 53 53 49 26 53 53 42 49 47 52 53 32 51 40 51 51 32 39 42 42 42 35 31 49 35 39 35 54 47 40 40 33 37 45 54 24 40 47 44 51 46 33 42 39 54 24 22 49 38 35 25 34 47 25 46 47 46 31 41 35 47 53 37 49 36 32 29 39 26 34 38 34 40 32 45 53 32 39 26 31 32 24 47 24 32 40 27 37 46 22 30 31 31 31 32 30 51 31 51 45 40 30 23 30 29 33 25 30 33 28 30 25 40 30 45 26 30 33 24 17 22 27 29 26 39 34 27 31 35 31 46 28 31 37 25 31 23 30 41 31 38 29 23 30 29 31 19 25 47 25 37 26 27 26 34 31 28 42 31 42 31 36 33 30 31 31 22 36 27 27 31 30 13 24 22 20 31 35 41 33 25 24 20 31 32 37 31 31 31 31 31 18 30 35 35 37 31 34 22 38 19 35 6 22 24 32 31 25 32 32 44 26 19 21 21 33 17 24 32 20 12 17 16 32 25 31 28 19 31 17 38 19 38 27 20 18 42 32 25 15 23 11 17 35 16 28 17 39 22 15 28 34 21 28 17 15 5 23 17 14 7 13 9 14 31 32 30 22 24 47 32 31 31 26 13 12 31 20 22 25 12 20 12 23 29 17 33 10 4 9 19 25 17 21 13 13 15 20 28 18 21 24 18 23 15 21 7 6 27 7 13 12 9 6 13 40 13 7 9 11 21 14 14 32 21 6 22 13 9 15 6 10 15 26 18 17 34 21 24 19 9 5 6 4 7 9 14 21 47 34 16 10 7 4 4 9 10 6 5 4 6 20 34 34 28 30 28 20 11 8 8 6 19 15 11 18 16 28 18 12 18 5 12 21 7 14 20 13 10 9 20 5 4 14 10 5 14 4 16 11 16 13 6 14 26 26 15 3 7 5 4 26 30 26 6 12 5 5 4 5 5 6 12 6 3 2 2 4 10 3 2 4 6 5 2 5 6 4 5 8 11 2 4 11 7 15 21 6 7 10 20 12 9 6 22 5 5 6 2 1 4 5 11 20 19 9 22 7 5 6 13 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_38289047_38290147
seq2: B6Ng01-322C04.b_49_1141 (reverse)

seq1  AAAAGCATGTCCAAATGCCAAGCCATGTTGCTGGGTGACCCTCCCTGGCT  50
      |||||||||| ||||||| |  | ||| |||||||||| ||| |||||||
seq2  AAAAGCATGT-CAAATGCAAGTCAATGATGCTGGGTGAACCT-CCTGGCT  48

seq1  GTATCGCCGCCTGCCC-AGGGAAGACAATGCTAATGAAATGCCAATAAAA  99
      |||||||   |||||| ||||||||| ||||||||||||||||||| |||
seq2  GTATCGC--GCTGCCCAAGGGAAGAC-ATGCTAATGAAATGCCAAT-AAA  94

seq1  TATTTTGAAGGAAAGTATGAAGGCTTCAAAATGAGTTAATTAAAAGCGGA  149
      |||||   ||||||||||||||||||||||||||||||||| ||||||||
seq2  TATTT--GAGGAAAGTATGAAGGCTTCAAAATGAGTTAATT-AAAGCGGA  141

seq1  TCAAACACAAGGCTCCAAAAGTATGTGCAGTAAATTTTGGGCTTGAAATT  199
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TC-AACACAAGGCTCCAAAAGTATGTGCAGTAAATTTTGGGCTTGAAATT  190

seq1  TGACAGAGGGAAAGTTTTGGTTTGGTTTGGTTTTGTCCCCAGCACTAG-G  248
      ||||||||||||||||||||||||||||||||||||||||||||||||  
seq2  TGACAGAGGGAAAGTTTTGGTTTGGTTTGGTTTTGTCCCCAGCACTAGNN  240

seq1  CAGAACTTTAAAGTGGCAGAGCTGGGCCTCTGGATTGCTGTCTTCCAAAC  298
                     |||||||||||||||||||||||||||||||||||
seq2  NNNNNNNNNNNNNNNGCAGAGCTGGGCCTCTGGATTGCTGTCTTCCAAAC  290

seq1  ATCAGCTTCTGCCAGTTTCCACACCCAGTAGTGATGCTCAGGGGTGCTCC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCTTCTGCCAGTTTCCACACCCAGTAGTGATGCTCAGGGGTGCTCC  340

seq1  GAACCCCATCTGCTGCCTTTCATGGTGGCTGAGACCAGCTAGGGCCTCTC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCCCATCTGCTGCCTTTCATGGTGGCTGAGACCAGCTAGGGCCTCTC  390

seq1  TCCAAGGCTGGGTCAGGATGAGGCCAATTAGAAGTCGCTTCAAACATGGC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGGCTGGGTCAGGATGAGGCCAATTAGAAGTCGCTTCAAACATGGC  440

seq1  ATGGACGGGGGGGGGAGGGGGGGGTGTTCCCAGGAGCAGCTGTGCGCCAA  498
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATGGACGGGGGGGTGAGGGGGGGGTGTTCCCAGGAGCAGCTGTGCGCCAA  490

seq1  GGCATTTGTAGAGCAAAATCTTGACTCTATTTACACTCACTCGGCCGACC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATTTGTAGAGCAAAATCTTGACTCTATTTACACTCACTCGGCCGACC  540

seq1  ATCAGCACGCAGTGATGCCCAACGATGACAGCCTGCAGAATTAGCACTGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCACGCAGTGATGCCCAACGATGACAGCCTGCAGAATTAGCACTGT  590

seq1  GGTGGCTTGGCTTCCTGAAAAGGACCGGCTGGGCAGTCTTTTCACCATGC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCTTGGCTTCCTGAAAAGGACCGGCTGGGCAGTCTTTTCACCATGC  640

seq1  TAGAATGCACCTTACAGCCATCTGGGAAGCAGCAGTGAAGCCACAGCTAT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATGCACCTTACAGCCATCTGGGAAGCAGCAGTGAAGCCACAGCTAT  690

seq1  GGACTTTCCAGCTTCCCTCTTCCGAGTGGCCTGGAAATAAATCGGGACCT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTTTCCAGCTTCCCTCTTCCGAGTGGCCTGGAAATAAATCGGGACCT  740

seq1  CTCAGGCTCACTGTGAGCCAGGTAAGAGGACTGAAGGACAAGGATGGCTT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGCTCACTGTGAGCCAGGTAAGAGGACTGAAGGACAAGGATGGCTT  790

seq1  CGATGATATCAATTATTCCCCGTGGAGGGCTGCCACACATGGAGAAGCTA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGATGATATCAATTATTCCCCGTGGAGGGCTGCCACACATGGAGAAGCTA  840

seq1  AGGGTCTTGCTATGATTTTGCAGGCCGTTGGAAGGTTAGACCCAAGGCCC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTCTTGCTATGATTTTGCAGGCCGTTGGAAGGTTAGACCCAAGGCCC  890

seq1  TGTGCAAACATGCTTTCCCCCAAGTCCCCATGATCTCCTGGTGAATTTGG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCAAACATGCTTTCCCCCAAGTCCCCATGATCTCCTGGTGAATTTGG  940

seq1  CTAGCTTTCGTCCAGCAGAAAGATTTGAAGCAAATGTTCCAGTAACAGGT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCTTTCGTCCAGCAGAAAGATTTGAAGCAAATGTTCCAGTAACAGGT  990

seq1  AACAACTATTCCTGTCAAATGACCCTGACCAGGTCCCTGACCAGGACACA  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAACTATTCCTGTCAAATGACCCTGACCAGGTCCCTGACCAGGACACA  1040

seq1  GATGCTATTGGAAGAAAGGACAGGAATACTAAGGTGTCTGGTAGGCAGAA  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCTATTGGAAGAAAGGACAGGAATACTAAGGTGTCTGGTAGGCAGAA  1090

seq1  TTC  1101
      |||
seq2  TTC  1093

seq1: chr5_38147540_38148696
seq2: B6Ng01-322C04.g_66_1223

seq1  GAATTCTTTATGTTCAGACAGAGTGATAGAAAACCCAGAAGAATCTCAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTATGTTCAGACAGAGTGATAGAAAACCCAGAAGAATCTCAAC  50

seq1  CTCCAAGAAATCAAAGCCATCACCCTCCTTACACGGAGCAGCACAGGGTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAAGAAATCAAAGCCATCACCCTCCTTACACGGAGCAGCACAGGGTG  100

seq1  CTGTCGTCTGAGTCCCTCCAGATCACTGCTTTGCGCACAGTTGTGAACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCGTCTGAGTCCCTCCAGATCACTGCTTTGCGCACAGTTGTGAACCA  150

seq1  ATCTGTGAGGAAGAGGAATAACTTTGTCATCCCTCAAGAATTAGCTGCTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTGAGGAAGAGGAATAACTTTGTCATCCCTCAAGAATTAGCTGCTG  200

seq1  GGGATTGAGCTGGATGAATGCAGGCTTAGACAGGAGGTATCACACTCAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATTGAGCTGGATGAATGCAGGCTTAGACAGGAGGTATCACACTCAGG  250

seq1  GTCTACCACCCCTGTCATCCCAGCTAGTTAGGAGGCTGAGGCAGGAGGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTACCACCCCTGTCATCCCAGCTAGTTAGGAGGCTGAGGCAGGAGGAT  300

seq1  CACAGTGCAAGAACTACCTGAGTGAAAGTGTGTTCCAAATCAGCCTGGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTGCAAGAACTACCTGAGTGAAAGTGTGTTCCAAATCAGCCTGGGC  350

seq1  AACTTAGAGAAAGAAACCCTGCCTCAAAGTTTGAAAGGTGGAGGGATCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTAGAGAAAGAAACCCTGCCTCAAAGTTTGAAAGGTGGAGGGATCCA  400

seq1  GCTCAGCGGTAGAGAGCACGCCTACACTGTAAATGCATCATATTAAATAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAGCGGTAGAGAGCACGCCTACACTGTAAATGCATCATATTAAATAA  450

seq1  ATAGGTGGAGAGGCGAATCAGCAGTTAAGAGCTCTTATTGATAGGACCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGTGGAGAGGCGAATCAGCAGTTAAGAGCTCTTATTGATAGGACCCA  500

seq1  AGTTCAAGTCTCAGCACCCATACTGAACAGCTCACAGCCACCTGTAACCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAAGTCTCAGCACCCATACTGAACAGCTCACAGCCACCTGTAACCC  550

seq1  CAGCACCAGGGAATCTAACTCCTTCTTCTGGTCTCTACAAATATGATCCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACCAGGGAATCTAACTCCTTCTTCTGGTCTCTACAAATATGATCCA  600

seq1  CTTACATACACACATGTACACACACACACACACACACAAATAATAAATAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACATACACACATGTACACACACACACACACACACAAATAATAAATAA  650

seq1  CTTACACATCATCCCCACACTGTGTAAAGATGAAACTCCATCACTACACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACACATCATCCCCACACTGTGTAAAGATGAAACTCCATCACTACACA  700

seq1  TCTTGGGATTTCTTTGCAAGAGCTCTTTTGGGTGGATAACCCCTGTCTCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGGGATTTCTTTGCAAGAGCTCTTTTGGGTGGATAACCCCTGTCTCC  750

seq1  CAGACAACAGCTCCTTCGAGTAGTGGCAGTCTGTGTGCACTGCCTTGCCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAACAGCTCCTTCGAGTAGTGGCAGTCTGTGTGCACTGCCTTGCCT  800

seq1  GGCCTGGCAAGTTACTGTTGGACTTATACCACAGGGCGACTAGAGTTAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGGCAAGTTACTGTTGGACTTATACCACAGGGCGACTAGAGTTAGT  850

seq1  GAGGATGCAGGTCAAAGATGCCCCTGGCAGCTGGCAGAGACTGATAAACA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATGCAGGTCAAAGATGCCCCTGGCAGCTGGCAGAGACTGATAAACA  900

seq1  GAGTGAGGTCTGACAGAGGCAGAAGGAGGAGACCCGCTCTTATTGTCAAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  GAGTGAGGTCTGACAGAGGCAGAAGGAGGAGACCCGCTCTTATTGTC-AC  949

seq1  ACTGCAAACCCCTACCGTGCCTCCCAAGGCACCAGCTGGCTTGAGGAATC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCAAACCCCTACCGTGCCTCCCAAGGCACCAGCTGGCTTGAGGAATC  999

seq1  ACCCACAATAAATGCACACAATAAACCTC--ACATTTTGGACTCTGCCAT  1048
      |||||||||||||||||||||||||||||  ||||||||||||||| |||
seq2  ACCCACAATAAATGCACACAATAAACCTCCAACATTTTGGACTCTG-CAT  1048

seq1  TTTTTTCT-AGGTCTTTGAG-ATGCA--TGTGAGG-TTCACGGGGATTTC  1093
      |||||||| ||||||||||| |||||   |||||| |||||||||||| |
seq2  TTTTTTCTAAGGTCTTTGAGAATGCAATGGTGAGGTTTCACGGGGATTCC  1098

seq1  CCCAGC-TCTGTGGTTATCCTTGCTTGTACCCTCTGTGTTCTTACTCCAG  1142
      || ||| ||||| ||||| |||||||||  |||||| |||| |||| || 
seq2  CCAAGCTTCTGT-GTTAT-CTTGCTTGTTACCTCTG-GTTC-TACT-CAA  1143

seq1  GTTCTTCATCATCTT  1157
      |||||||||||||||
seq2  GTTCTTCATCATCTT  1158

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information