MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-330O21
Chromosome	5 (Build37)
Map Location	24,061,282 - 24,167,552
singlet/doublet	doublet
Overlap gene	Abcf2, LOC100042348, Smarcd3, 1700022A21Rik
Upstream gene	Srpk2, Pus7, Rint1, 4933427G23Rik, Tomm7, LOC671410, Drctnnb1a, LOC627317, Klhl7, LOC100042211, Nupl2, LOC434047, LOC100042244, Kcnh2, Nos3, Atg9b, Abcb8, Accn3, Cdk5, Slc4a2, Fastk, Tmub1, Centg3, Gbx1, Asb10, 4931409K22Rik
Downstream gene	Nub1, 2810046M22Rik, Crygn, Rheb, Prkag2, Galntl5, E130116L18Rik, Galnt11, Mll3, Gm443
Link	Open Mouse BAC browser

Click to get alignment info.

name	Srpk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20817 MGI:1201408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pus7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78697 MGI:1925947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rint1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72772 MGI:1916233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933427G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330053 MGI:3036235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 ESTs, 4 Proteins

name	Tomm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66169 MGI:1913419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Drctnnb1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84652 MGI:2149839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 546 ESTs, 4 Proteins pseudo : _no_value

name	Klhl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52323 MGI:1196453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042211 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 289 ESTs, 14 Proteins

name	Nupl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231042 MGI:2387631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434047
definition	note : heat shock protein 8 pseudogene pseudo : _no_value

name	LOC100042244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 387 ESTs, 3 Proteins

name	Kcnh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16511 MGI:1341722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nos3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18127 MGI:97362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213948 MGI:2685420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74610 MGI:1351667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Accn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171209 MGI:2159339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12568 MGI:101765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20535 MGI:109351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fastk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66587 MGI:1913837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64295 MGI:1923764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213990 MGI:2183446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231044 MGI:95667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117590 MGI:2152836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931409K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231045 MGI:3045319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27407 MGI:1351657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 mRNAs, 339 ESTs, 5 Proteins

name	Smarcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66993 MGI:1914243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72252 MGI:1919502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 19 Proteins

name	Nub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53312 MGI:1889001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810046M22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269633 MGI:1915466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crygn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214301 MGI:2449167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rheb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19744 MGI:97912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkag2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108099 MGI:1336153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galntl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67909 MGI:1915159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130116L18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77870 MGI:1925120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Galnt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231050 MGI:2444392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mll3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231051 MGI:2444959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm443 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:242891 MGI:2685289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srpk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059479 GeneID:20817 MGI:1201408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine-rich protein specific kinase 2 transcript_id : NM_009274.2

name	Pus7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351846 GeneID:78697 MGI:1925947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pseudouridylate synthase 7 homolog (S. cerevisiae) transcript_id : NM_178403.4

name	Rint1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62899066 GeneID:72772 MGI:1916233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD50 interactor 1 transcript_id : NM_177323.3

name	Tomm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801714 GeneID:66169 MGI:1913419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 7 homolog (yeast) transcript_id : NM_025394.2

name	Drctnnb1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940062 GeneID:84652 MGI:2149839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : down-regulated by Ctnnb1, a transcript_id : NM_053090.2

name	Klhl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802726 GeneID:52323 MGI:1196453
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 7 (Drosophila) transcript_id : NM_026448.2

name	LOC100042211 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253626 GeneID:100042211
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 289 ESTs, 14 Proteins product : similar to GEF-2 transcript_id : XM_001478223.1

name	Nupl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379823 GeneID:231042 MGI:2387631
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin like 2 transcript_id : NM_153092.3

name	LOC100042244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253628 GeneID:100042244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 387 ESTs, 3 Proteins product : similar to SMT3 suppressor of mif two 3 homolog 2 transcript_id : XM_001478249.1

name	Kcnh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305202 GeneID:16511 MGI:1341722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 2 transcript_id : NM_013569.1

name	Nos3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347596 GeneID:18127 MGI:97362
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitric oxide synthase 3, endothelial cell transcript_id : NM_008713.3

name	Atg9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890224 GeneID:213948 MGI:2685420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATG9 autophagy related 9 homolog B (S. cerevisiae) transcript_id : NM_001002897.2

name	Abcb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753994 GeneID:74610 MGI:1351667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family B (MDR/TAP), member 8 transcript_id : NM_029020.2

name	Accn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33695147 GeneID:171209 MGI:2159339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride-sensitive cation channel 3 transcript_id : NM_183000.1

name	Cdk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348589 GeneID:12568 MGI:101765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 5 transcript_id : NM_007668.3

name	Slc4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802444 GeneID:20535 MGI:109351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 2 transcript_id : NM_009207.2

name	Fastk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861159 GeneID:66587 MGI:1913837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas-activated serine/threonine kinase transcript_id : NM_023229.2

name	Tmub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379909 GeneID:64295 MGI:1923764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and ubiquitin-like domain containing 1 transcript_id : NM_022418.2

name	Centg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301218 GeneID:213990 MGI:2183446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, gamma 3 transcript_id : NM_139153.2

name	Gbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130963 GeneID:231044 MGI:95667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrulation brain homeobox 1 transcript_id : NM_015739.2

name	Asb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382985 GeneID:117590 MGI:2152836
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 10 transcript_id : NM_080444.3

name	4931409K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373177 GeneID:231045 MGI:3045319
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931409K22 gene transcript_id : NM_177676.3

name	Abcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956077 GeneID:27407 MGI:1351657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family F (GCN20), member 2 transcript_id : NM_013853.1

name	LOC100042348 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253630 GeneID:100042348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 mRNAs, 339 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G transcript_id : XM_001478455.1

name	Smarcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404372 GeneID:66993 MGI:1914243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 transcript_id : NM_025891.3

name	1700022A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374345 GeneID:72252 MGI:1919502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 19 Proteins product : RIKEN cDNA 1700022A21 gene transcript_id : XM_131911.3

name	Nub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360353 GeneID:53312 MGI:1889001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : negative regulator of ubiquitin-like proteins 1 transcript_id : NM_016736.2

name	2810046M22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517673 GeneID:269633 MGI:1915466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810046M22 gene transcript_id : NM_001081441.1

name	Crygn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346484 GeneID:214301 MGI:2449167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, gamma N transcript_id : NM_153076.1

name	Rheb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893211 GeneID:19744 MGI:97912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-homolog enriched in brain transcript_id : NM_053075.3

name	Prkag2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703801 GeneID:108099 MGI:1336153
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 2 non-catalytic subunit transcript_id : NM_145401.1

name	Galntl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361629 GeneID:67909 MGI:1915159
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 transcript_id : NM_026449.2

name	E130116L18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374346 GeneID:77870 MGI:1925120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA E130116L18 gene transcript_id : XM_001000959.1

name	Galnt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387638 GeneID:231050 MGI:2444392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 transcript_id : NM_144908.2

name	Mll3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487062 GeneID:231051 MGI:2444959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia 3 transcript_id : NM_001081383.1

name	Gm443 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930709 GeneID:242891 MGI:2685289
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 443, (NCBI) transcript_id : NM_198621.2

name	Srpk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059480 GeneID:20817 MGI:1201408
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0008380 - RNA splicing [Evidence IDA]; GO:0000245 - spliceosome assembly [Evidence IDA] codon_start : 1 note : WW domain binding protein 6 product : serine/arginine-rich protein specific kinase 2 protein_id : NP_033300.2

name	Pus7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111935 GeneID:78697 MGI:1925947
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0004730 - pseudouridylate synthase activity [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : pseudouridylate synthase 7 homolog protein_id : NP_848490.2

name	Rint1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62899067 GeneID:72772 MGI:1916233
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0031572 - G2/M transition DNA damage checkpoint [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Rad50-interacting protein 1 protein_id : NP_796297.2

name	Tomm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313592 GeneID:66169 MGI:1913419
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005741 - mitochondrial outer membrane [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA] codon_start : 1 product : translocase of outer mitochondrial membrane 7 homolog protein_id : NP_079670.1

name	Drctnnb1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117940063 CCDS:CCDS19113.1 GeneID:84652 MGI:2149839
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : down-regulated by Ctnnb1, a protein_id : NP_444320.2

name	Klhl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312720 CCDS:CCDS19114.1 GeneID:52323 MGI:1196453
definition	codon_start : 1 exception : mismatches in translation product : SBBI26 protein protein_id : NP_080724.1

name	LOC100042211 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253627 GeneID:100042211
definition	codon_start : 1 product : similar to GEF-2 protein_id : XP_001478273.1

name	Nupl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68163576 CCDS:CCDS19115.1 GeneID:231042 MGI:2387631
definition	GO_component : GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nucleoporin-like protein 1 product : nucleoporin like 2 protein_id : NP_694732.2

name	LOC100042244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253629 GeneID:100042244
definition	codon_start : 1 product : similar to SMT3 suppressor of mif two 3 homolog 2 protein_id : XP_001478299.1

name	Kcnh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305203 CCDS:CCDS19116.1 GeneID:16511 MGI:1341722
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ether a go-go related product : voltage-gated potassium channel, subfamily H, member 2 protein_id : NP_038597.1

name	Nos3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982150 CCDS:CCDS19117.1 GeneID:18127 MGI:97362
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0010181 - FMN binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0050661 - NADP binding [Evidence IEA]; GO:0004517 - nitric-oxide synthase activity [Evidence IMP]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0007612 - learning [Evidence IMP]; GO:0031663 - lipopolysaccharide-mediated signaling pathway [Evidence IMP]; GO:0006809 - nitric oxide biosynthesis [Evidence IMP]; GO:0001542 - ovulation (sensu Mammalia) [Evidence IMP] codon_start : 1 exception : mismatches in translation note : endothelial nitric oxide synthase product : nitric oxide synthase 3, endothelial cell protein_id : NP_032739.2

name	Atg9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50872161 GeneID:213948 MGI:2685420
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0000045 - autophagic vacuole formation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : autophagy 9-like 2 protein product : nitric oxide synthase 3 antisense protein_id : NP_001002897.1

name	Abcb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753995 CCDS:CCDS19118.1 GeneID:74610 MGI:1351667
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family B (MDR/TAP), member 8 protein_id : NP_083296.2

name	Accn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695148 GeneID:171209 MGI:2159339
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence ISS] [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA] [Evidence TAS] [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IMP] [Evidence IDA]; GO:0050907 - detection of chemical stimulus during sensory perception [Evidence IMP]; GO:0050968 - detection of chemical stimulus during sensory perception of pain [Evidence IMP]; GO:0050974 - detection of mechanical stimulus during sensory perception [Evidence IMP]; GO:0050966 - detection of mechanical stimulus during sensory perception of pain [Evidence IMP]; GO:0050961 - detection of temperature stimulus during sensory perception [Evidence IMP]; GO:0050965 - detection of temperature stimulus during sensory perception of pain [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0001101 - response to acid [Evidence ISS] [Evidence IMP] [Evidence IDA]; GO:0009408 - response to heat [Evidence IMP]; GO:0009612 - response to mechanical stimulus [Evidence IMP]; GO:0006814 - sodium ion transport [Evidence ISS] [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : amiloride-sensitive cation channel 3 protein_id : NP_892045.1

name	Cdk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680908 GeneID:12568 MGI:101765
definition	GO_component : GO:0030424 - axon [Evidence ISS]; GO:0043025 - cell soma [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence IDA]; GO:0030425 - dendrite [Evidence ISS]; GO:0030175 - filopodium [Evidence IDA]; GO:0030426 - growth cone [Evidence ISS]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016020 - membrane [Evidence ISS]; GO:0031594 - neuromuscular junction [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0030549 - acetylcholine receptor activator activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0005176 - ErbB-2 class receptor binding [Evidence IDA]; GO:0043125 - ErbB-3 class receptor binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IDA]; GO:0050321 - tau-protein kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0048675 - axon extension [Evidence ISS]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA]; GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0009790 - embryonic development [Evidence ISS]; GO:0031175 - neurite development [Evidence ISS]; GO:0030182 - neuron differentiation [Evidence ISS]; GO:0043525 - positive regulation of neuron apoptosis [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0030334 - regulation of cell migration [Evidence IMP]; GO:0007519 - striated muscle development [Evidence ISS] codon_start : 1 product : cyclin-dependent kinase 5 protein_id : NP_031694.1

name	Slc4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678021 CCDS:CCDS19119.1 GeneID:20535 MGI:109351
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015380 - anion exchanger activity [Evidence IEA]; GO:0015297 - antiporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005452 - inorganic anion exchanger activity [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : erythrocyte membrane protein band 3-like; anion exchanger product : solute carrier family 4 (anion exchanger), member 2 protein_id : NP_033233.1

name	Fastk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861160 CCDS:CCDS19120.1 GeneID:66587 MGI:1913837
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : Fas-activated serine/threonine kinase protein_id : NP_075718.2

name	Tmub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967945 CCDS:CCDS19121.1 GeneID:64295 MGI:1923764
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : transmembrane and ubiquitin-like domain containing 1 protein_id : NP_071863.1

name	Centg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301219 CCDS:CCDS19122.1 GeneID:213990 MGI:2183446
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : spidin; MR1-interacting protein product : centaurin, gamma 3 protein_id : NP_631892.2

name	Gbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859672 CCDS:CCDS19123.1 GeneID:231044 MGI:95667
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : gastrulation brain homeobox 1 protein_id : NP_056554.1

name	Asb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17978258 CCDS:CCDS19124.1 GeneID:117590 MGI:2152836
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 10 protein_id : NP_536692.1

name	4931409K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244104 GeneID:231045 MGI:3045319
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231045 protein_id : NP_808344.1

name	Abcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956078 CCDS:CCDS19125.1 GeneID:27407 MGI:1351657
definition	GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 note : developmentally regulated repeat element-containing transcript 3 product : ATP-binding cassette, sub-family F (GCN20), member 2 protein_id : NP_038881.1

name	LOC100042348 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253631 GeneID:100042348
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478505.1

name	Smarcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404373 CCDS:CCDS19126.1 GeneID:66993 MGI:1914243
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3 protein_id : NP_080167.3

name	1700022A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20823227 GeneID:72252 MGI:1919502
definition	codon_start : 1 product : hypothetical protein LOC72252 protein_id : XP_131911.1

name	Nub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360354 GeneID:53312 MGI:1889001
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : NY-REN-18 antigen product : Nedd8 ultimate buster-1 protein_id : NP_058016.2

name	2810046M22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517674 GeneID:269633 MGI:1915466
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC269633 protein_id : NP_001074910.1

name	Crygn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346485 CCDS:CCDS19129.1 GeneID:214301 MGI:2449167
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : crystallin, gamma N protein_id : NP_694716.1

name	Rheb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28626508 GeneID:19744 MGI:97912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-homolog enriched in brain protein_id : NP_444305.2

name	Prkag2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703802 CCDS:CCDS19130.1 GeneID:108099 MGI:1336153
definition	GO_function : GO:0004679 - AMP-activated protein kinase activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 exception : mismatches in translation note : 5-AMP-activated protein kinase, gamma-2 subunit product : AMP-activated protein kinase gamma2 subunit protein_id : NP_663376.1

name	Galntl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385946 CCDS:CCDS19132.1 GeneID:67909 MGI:1915159
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5 protein_id : NP_080725.1

name	E130116L18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374347 GeneID:77870 MGI:1925120
definition	codon_start : 1 product : hypothetical protein LOC77870 protein_id : XP_001000959.1

name	Galnt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450297 CCDS:CCDS19133.1 GeneID:231050 MGI:2444392
definition	EC_number : 2.4.1.41 GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 note : UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 protein_id : NP_659157.1

name	Mll3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487063 GeneID:231051 MGI:2444959
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : myeloid/lymphoid or mixed-lineage leukemia 3 protein_id : NP_001074852.1

name	Gm443 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348482 CCDS:CCDS19134.1 GeneID:242891 MGI:2685289
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC242891 protein_id : NP_941023.1

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 11 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 10 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 9 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 8 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 7 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 6 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 5 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 4 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 3 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 2 pseudo : _no_value

name	LOC671410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671410
definition	number : 1 pseudo : _no_value

name	4933427G23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94374340 GeneID:330053 MGI:3036235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 ESTs, 4 Proteins product : RIKEN cDNA 4933427G23 gene transcript_id : XR_002344.1

name	LOC627317 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253625 GeneID:627317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 546 ESTs, 4 Proteins product : similar to ribosomal protein L11 pseudo : _no_value transcript_id : XR_033591.1

clone name	MSMg01-276D11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115O11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-164I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-196A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-068C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530D16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-154E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-315P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149O06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-330O21.b	B6Ng01-330O21.g
ACC	GA117441	GA117442
length	799	1,088
definition	B6Ng01-330O21.b	B6Ng01-330O21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(24,061,282 - 24,062,078)	(24,166,442 - 24,167,552)
sequence	gaattccaacccattgtgcctacgttcttaaactgaggggtggggctggg agttcaaggttggggacacttgtctaggaagacatctctgaggctgcaca ctcaaagtccacaggcagttgctataggaatgttagggcaagccaggcgt ggtggcgcacgcctttaatcccagcactcaggaggcagaggcaggcggat ttctgagtgcaaggccagcctggtctacaaagtgagttccaggacagcca gggctacacaaagaaaccctgtctcaaataaataaataaataaataaata aataaataaataaataggaaatgtcaggggtcagggcagagtgtgagaca actctggctactcttcttgtacctatcaataaagtaataaagtaacactc ccatgaccgaagcaatctatagaagaatttattttggcttatggttccag agtgctagagtccatgatggtatgtcatgcgacctaccatgctgcaggca gtcatggcaactggaacaagaagctgagagttcacatcttcaacttcaaa cacaaagcagagagagtgaactacagatccagcgcaaggcttcttccagc tctcaaaccccgttgggatacttctctagccaggccctgcctcctaagcc tccctaaacagcaccactaaggaccaaacatgcaaatgtggtggattaaa ggagacatcacattcaccacaaccaccatcacactatgaccaccctcctc tcctgtgctctgcagcttttactcctttgtgtggggggtggggggataa	gaattcacagaaagaaacacaccacaaaacttctgggggtgctctgttgg cttcctgctgcttccatggactcaggccaattggcagagtgatatctgtt gatacaggctcacgtggttaggcaagacaataaaaaagaaaagaaacgga gtataaaaaaaatcataggaagaaatatttagtttgaaagtccttaagga gagagttagagattaaaaagaaaaatattttctgttaaaatggaaaacgt gccaggcgtggtggcacacgcctttaatcccagcacttgggaggcagagg caagcagatttctgagttcgaggccagcctggtctacaaagtgagttcca ggacagccagggctacacagagaaaccctgtctcgaaaacaaaacaaaac aaaaaaaggaaaacgcaatggcacaacacacctggatcccatgtgacttt gttccatttgccagcatgtacataataatgattaaaaatttatatatcct ctttaagaaagatatcagaatacatcagacttagaggaccgaaaaatgga attctgggttacaagatataaaacagaggttagaggattctttaaatcag aataaagaaccttcagaagagtccagtctggaacttacaataacagcaaa aaagggtagttccaggtgagaagaatccacaaagcctcgaggaattagaa tgcaacccataaagatgcagtatattgaattaagaatttagccgggcatt ggtggcacacacctttaattccagcactcgggaggcagaagcaggtggat ttctgagttcaaggccagccctggtctacaaagagagtttgcaggacagc cagggctatacagagcaaaaaggcctctaagccaactgagcaagcactca cagagactgacacagcatgcacagggcctagtgggtctgcacctggctca gtgtatgtgttatggctccagttaatgtttatatgggatttctgggtgtg tgacagtgggtctctgattctgtgccttccctcgactcttccttctgttt tttttgccaggttcacgtgctagttgttatctatctgt
quality values	Open. Hide. 49 23 27 20 58 62 31 12 62 62 62 41 37 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 44 43 45 38 46 44 38 34 28 38 49 46 59 62 62 62 54 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 54 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 58 58 58 54 58 58 58 54 58 58 58 58 54 58 58 52 58 21 54 54 58 52 58 58 58 58 54 58 58 58 58 54 54 58 54 58 52 52 58 58 53 54 54 54 58 54 58 58 58 58 58 54 45 42 52 58 58 53 58 53 51 58 58 51 58 58 58 58 51 58 58 58 58 49 40 53 51 58 58 54 58 54 48 58 50 58 44 49 51 58 49 58 54 51 54 49 54 54 49 54 38 47 58 50 58 58 58 50 58 58 51 50 58 54 58 51 51 54 49 39 39 42 54 49 49 49 36 58 39 27 40 49 36 58 51 52 58 58 58 40 54 58 54 54 53 54 54 53 54 51 51 31 40 54 54 54 44 54 51 40 46 35 39 53 45 52 49 40 54 54 53 42 47 39 51 53 52 53 53 32 33 54 47 37 54 45 42 47 44 51 41 33 37 37 38 31 44 40 46 38 38 52 53 46 51 42 41 42 46 41 46 32 51 47 40 47 43 47 52 53 35 46 36 36 49 52 32 42 42 33 36 30 51 41 51 45 51 31 33 46 46 36 46 29 31 36 46 46 33 33 32 51 30 12 9	Open. Hide. 62 59 56 59 62 59 43 62 59 34 51 38 28 28 48 43 38 59 51 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 59 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 49 58 58 58 58 54 58 58 54 58 58 58 58 58 47 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 53 58 54 58 45 37 58 58 58 58 58 58 58 54 58 58 58 58 45 58 58 58 58 58 58 54 53 52 49 51 58 58 48 49 58 53 58 58 58 58 54 58 54 58 39 58 54 51 54 53 58 51 58 58 32 58 58 53 58 51 58 58 58 58 54 58 42 58 38 50 58 58 58 49 58 54 44 41 41 58 54 52 52 58 58 30 58 32 52 50 48 40 53 53 58 58 58 58 54 50 50 50 58 50 51 40 58 41 41 54 54 53 53 49 54 58 58 58 58 51 40 58 51 52 58 50 51 53 53 51 52 51 54 41 51 54 27 54 49 35 54 41 39 41 41 44 50 50 54 54 41 49 54 47 52 41 38 36 50 54 30 29 53 53 37 54 49 37 54 45 45 37 51 54 44 40 52 45 54 53 52 51 31 52 52 53 29 37 53 45 52 42 52 49 54 45 40 45 37 51 45 52 41 29 53 53 43 32 53 51 29 49 40 32 40 47 27 47 49 21 51 52 36 31 52 34 52 33 40 41 41 33 39 31 31 30 45 31 30 25 42 42 37 32 42 43 27 46 33 9 6 46 30 39 39 51 46 17 16 6 4 8 21 31 33 42 31 48 42 32 32 31 46 12 38 38 29 24 31 24 46 18 28 21 17 19 40 22 23 30 43 31 43 36 34 36 23 47 34 32 32 19 31 21 13 46 21 31 31 16 12 12 31 19 36 32 31 30 25 31 46 28 19 31 27 30 26 42 32 30 33 16 30 29 41 47 43 10 12 17 26 24 27 32 31 20 31 26 29 26 18 31 31 42 38 38 16 36 44 13 13 18 28 31 32 33 27 31 28 17 32 15 33 31 31 33 32 17 9 28 24 25 22 20 24 33 32 22 21 26 33 47 17 5 4 26 33 10 14 31 37 29 22 32 31 29 30 21 24 38 19 13 3 5 4 18 15 7 10 23 11 26 26 21 16 11 18 5 12 13 23 18 11 16 5 18 18 9 19 12 3 5 8 15 8 19 23 12 16 16 18 25 40 21 16 11 34 20 28 5 11 30 13 7 8 6 6 6 9 24 7 9 18 3 11 25 13 4 9 7 7 4 13 18 9 5 7 8 5 4 6 8 17 14 16 9 28 6 8 18 4 14 9 10 6 4 3 7 11 3 7 21 4 16 24 29 25 17 17 27 5 11 2 3 2 8 7 7 9 6 16 22 13 5 5 8 11 15 14 3 3 2 2 4 3 22 5 11 5 13 5 25 5 18 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_24061282_24062078
seq2: B6Ng01-330O21.b_47_845

seq1  GAATTCCAACCCATTGTGCCTACGTTCTTAAACTGAGGGGTGGGGCTGGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAACCCATTGTGCCTACGTTCTTAAACTGAGGGGTGGGGCTGGG  50

seq1  AGTTCAAGGTTGGGGACACTTGTCTAGGAAGACATCTCTGAGGCTGCACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCAAGGTTGGGGACACTTGTCTAGGAAGACATCTCTGAGGCTGCACA  100

seq1  CTCAAAGTCCACAGGCAGTTGCTATAGGAATGTTAGGGCAAGCCAGGCGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAAGTCCACAGGCAGTTGCTATAGGAATGTTAGGGCAAGCCAGGCGT  150

seq1  GGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGAT  200

seq1  TTCTGAGTGCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGTGCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCA  250

seq1  GGGCTACACAAAGAAACCCTGTCTCAAATAAATAAATAAATAAATAAATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTACACAAAGAAACCCTGTCTCAAATAAATAAATAAATAAATAAATA  300

seq1  AATAAATAAATAAATAGGAAATGTCAGGGGTCAGGGCAGAGTGTGAGACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAATAAATAAATAGGAAATGTCAGGGGTCAGGGCAGAGTGTGAGACA  350

seq1  ACTCTGGCTACTCTTCTTGTACCTATCAATAAAGTAATAAAGTAACACTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTGGCTACTCTTCTTGTACCTATCAATAAAGTAATAAAGTAACACTC  400

seq1  CCATGACCGAAGCAATCTATAGAAGAATTTATTTTGGCTTATGGTTCCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATGACCGAAGCAATCTATAGAAGAATTTATTTTGGCTTATGGTTCCAG  450

seq1  AGTGCTAGAGTCCATGATGGTATGTCATGCGACCTACCATGCTGCAGGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTAGAGTCCATGATGGTATGTCATGCGACCTACCATGCTGCAGGCA  500

seq1  GTCATGGCAACTGGAACAAGAAGCTGAGAGTTCACATCTTCAACTTCAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATGGCAACTGGAACAAGAAGCTGAGAGTTCACATCTTCAACTTCAAA  550

seq1  CACAAAGCAGAGAGAGTGAACTACAGATCCAGCGCAAGGCTTCTTCCAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAAGCAGAGAGAGTGAACTACAGATCCAGCGCAAGGCTTCTTCCAGC  600

seq1  TCTCAAACCCCGTTGGGATACTTCTCTAGCCAGGCCCTGCCTCCTAAGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAAACCCCGTTGGGATACTTCTCTAGCCAGGCCCTGCCTCCTAAGCC  650

seq1  TCCCTAAACAGCACCACTAAGGACCAAACATGCAAATGTGGTGGATTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTAAACAGCACCACTAAGGACCAAACATGCAAATGTGGTGGATTAAA  700

seq1  GGAGACATCACATTCACCACAACCACCATCACACTATGACCACCCTCCTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGACATCACATTCACCACAACCACCATCACACTATGACCACCCTCCTC  750

seq1  TCCTGTGCTCTGCAGCTTTTACTCCTTTGTGTGGGGG--TGGGGGATAA  797
      |||||||||||||||||||||||||||||||||||||   |||||||||
seq2  TCCTGTGCTCTGCAGCTTTTACTCCTTTGTGTGGGGGGTGGGGGGATAA  799

seq1: chr5_24166442_24167552
seq2: B6Ng01-330O21.g_65_1152 (reverse)

seq1  ACAGATAAGATAAAAACAAAACCTAGCACGTTGGAACTGGACAAAAAAAA  50
      |||||| |||||| ||      |||||||| || | ||||      ||||
seq2  ACAGAT-AGATAACAA------CTAGCACG-TGAACCTGG-----CAAAA  37

seq1  AAAACAGAAGGGAAAAGAGTTCGAGGGAAGGCACAAGAATCAGAGACCCA  100
      |||||||||||   ||||| |||||||||||||| |||||||||||||||
seq2  AAAACAGAAGG---AAGAG-TCGAGGGAAGGCAC-AGAATCAGAGACCCA  82

seq1  CCTGTTCACACACCCAGAAATCCCATATAAAACATTAAACTGGAAGCCAT  150
       ||| ||||||||||||||||||||||| ||||||| |||||| ||||||
seq2  -CTG-TCACACACCCAGAAATCCCATAT-AAACATT-AACTGG-AGCCAT  127

seq1  AACACATACACTGAGGCCAGGTGCAGACCCACTAGGCCCTGTGCATGCTG  200
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AACACATACACTGA-GCCAGGTGCAGACCCACTAGGCCCTGTGCATGCTG  176

seq1  TGTCAGTCTCTGTGAGTGCTTTGCTCAGTTGGCTTAGAGGCCTTTTTGCT  250
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TGTCAGTCTCTGTGAGTGC-TTGCTCAGTTGGCTTAGAGGCCTTTTTGCT  225

seq1  CTGTATAGCCCTGGCTGTCCTGC-AACTCTCTTTGTAGACCA-GGCTGGC  298
      ||||||||||||||||||||||| |||||||||||||||||| |||||||
seq2  CTGTATAGCCCTGGCTGTCCTGCAAACTCTCTTTGTAGACCAGGGCTGGC  275

seq1  CTTGAACTCAGAAATCCACCTGCTTCTGCCTCCCGAGTGCTGGAATTAAA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAACTCAGAAATCCACCTGCTTCTGCCTCCCGAGTGCTGGAATTAAA  325

seq1  GGTGTGTGCCACCAATGCCCGGCTAAATTCTTAATTCAATATACTGCATC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTGTGCCACCAATGCCCGGCTAAATTCTTAATTCAATATACTGCATC  375

seq1  TTTATGGGTTGCATTCTAATTCCTCGAGGCTTTGTGGATTCTTCTCACCT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGGGTTGCATTCTAATTCCTCGAGGCTTTGTGGATTCTTCTCACCT  425

seq1  GGAACTACCCTTTTTTGCTGTTATTGTAAGTTCCAGACTGGACTCTTCTG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACTACCCTTTTTTGCTGTTATTGTAAGTTCCAGACTGGACTCTTCTG  475

seq1  AAGGTTCTTTATTCTGATTTAAAGAATCCTCTAACCTCTGTTTTATATCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTTCTTTATTCTGATTTAAAGAATCCTCTAACCTCTGTTTTATATCT  525

seq1  TGTAACCCAGAATTCCATTTTTCGGTCCTCTAAGTCTGATGTATTCTGAT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAACCCAGAATTCCATTTTTCGGTCCTCTAAGTCTGATGTATTCTGAT  575

seq1  ATCTTTCTTAAAGAGGATATATAAATTTTTAATCATTATTATGTACATGC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTCTTAAAGAGGATATATAAATTTTTAATCATTATTATGTACATGC  625

seq1  TGGCAAATGGAACAAAGTCACATGGGATCCAGGTGTGTTGTGCCATTGCG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAAATGGAACAAAGTCACATGGGATCCAGGTGTGTTGTGCCATTGCG  675

seq1  TTTTCCTTTTTTTGTTTTGTTTTGTTTTCGAGACAGGGTTTCTCTGTGTA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCCTTTTTTTGTTTTGTTTTGTTTTCGAGACAGGGTTTCTCTGTGTA  725

seq1  GCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTC  775

seq1  AGAAATCTGCTTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATCTGCTTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGC  825

seq1  CACCACGCCTGGCACGTTTTCCATTTTAACAGAAAATATTTTTCTTTTTA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACGCCTGGCACGTTTTCCATTTTAACAGAAAATATTTTTCTTTTTA  875

seq1  ATCTCTAACTCTCTCCTTAAGGACTTTCAAACTAAATATTTCTTCCTATG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTAACTCTCTCCTTAAGGACTTTCAAACTAAATATTTCTTCCTATG  925

seq1  ATTTTTTTTATACTCCGTTTCTTTTCTTTTTTATTGTCTTGCCTAACCAC  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTTTTATACTCCGTTTCTTTTCTTTTTTATTGTCTTGCCTAACCAC  975

seq1  GTGAGCCTGTATCAACAGATATCACTCTGCCAATTGGCCTGAGTCCATGG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGCCTGTATCAACAGATATCACTCTGCCAATTGGCCTGAGTCCATGG  1025

seq1  AAGCAGCAGGAAGCCAACAGAGCACCCCCAGAAGTTTTGTGGTGTGTTTC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGCAGGAAGCCAACAGAGCACCCCCAGAAGTTTTGTGGTGTGTTTC  1075

seq1  TTTCTGTGAATTC  1111
      |||||||||||||
seq2  TTTCTGTGAATTC  1088

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information