MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-334I12
Chromosome	5 (Build37)
Map Location	66,046,577 - 66,238,413
singlet/doublet	doublet
Overlap gene	9030416H16Rik, 1700022K14Rik, LOC384261, B3bp, LOC100041809
Upstream gene	Klf3, Tlr1, Tlr6, 9130005N14Rik, Tmem156, Klhl5, Wdr19, Rfc1, Klb, Rpl9, Lias, Ugdh, 1110003E01Rik, 4930589O11Rik, Hip2
Downstream gene	Rhoh, LOC626641, EG666827, Chrna9, 9130230L23Rik, BC013481, LOC626714, LOC666854, LOC100042394, Nsun7, Apbb2, Uchl1, LOC100041876, 3732412D22Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16599 MGI:1342773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21897 MGI:1341295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21899 MGI:1341296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130005N14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68303 MGI:1915553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243025 MGI:2685292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Klhl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71778 MGI:1919028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213081 MGI:2443231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19687 MGI:97891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83379 MGI:1932466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20005 MGI:1298373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lias (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79464 MGI:1934604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ugdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22235 MGI:1306785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110003E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68552 MGI:1915802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930589O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78214 MGI:1925464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs

name	Hip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53323 MGI:1858216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030416H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71521 MGI:1918771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74234 MGI:1921484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC384261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein

name	B3bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333789 MGI:2684414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Rhoh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74734 MGI:1921984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	EG666827 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666827 MGI:3643549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Chrna9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231252 MGI:1202403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130230L23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231253 MGI:3041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC013481 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245945 MGI:2384294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC626714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100042394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Nsun7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70918 MGI:1918168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11787 MGI:108405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uchl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22223 MGI:103149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041876 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	3732412D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77569 MGI:1924819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802499 GeneID:16599 MGI:1342773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 3 (basic) transcript_id : NM_008453.3

name	Tlr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507602 GeneID:21897 MGI:1341295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 1 transcript_id : NM_030682.1

name	Tlr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58743328 GeneID:21899 MGI:1341296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 6 transcript_id : NM_011604.2

name	9130005N14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560127 GeneID:68303 MGI:1915553
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130005N14 gene transcript_id : NM_026667.2

name	Tmem156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253910 GeneID:243025 MGI:2685292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : transmembrane protein 156 transcript_id : XM_144292.7

name	Klhl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892613 GeneID:71778 MGI:1919028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 5 (Drosophila) transcript_id : NM_175174.3

name	Wdr19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510248 GeneID:213081 MGI:2443231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 19 transcript_id : NM_153391.1

name	Rfc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755305 GeneID:19687 MGI:97891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication factor C (activator 1) 1 transcript_id : NM_011258.1

name	Klb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130737 GeneID:83379 MGI:1932466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : klotho beta transcript_id : NM_031180.2

name	Rpl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14149646 GeneID:20005 MGI:1298373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L9 transcript_id : NM_011292.1

name	Lias (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376612 GeneID:79464 MGI:1934604
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipoic acid synthetase transcript_id : NM_024471.3

name	Ugdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981926 GeneID:22235 MGI:1306785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-glucose dehydrogenase transcript_id : NM_009466.2

name	1110003E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801855 GeneID:68552 MGI:1915802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110003E01 gene transcript_id : NM_133697.3

name	4930589O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253941 GeneID:78214 MGI:1925464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs product : RIKEN cDNA 4930589O11 gene transcript_id : XM_899432.3

name	Hip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601007 GeneID:53323 MGI:1858216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : huntingtin interacting protein 2 transcript_id : NM_016786.3

name	9030416H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486764 GeneID:71521 MGI:1918771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030416H16 gene transcript_id : NM_001081321.1

name	1700022K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253912 GeneID:74234 MGI:1921484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700022K14 gene transcript_id : XM_001477016.1

name	LOC384261 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374788 GeneID:384261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : hypothetical LOC384261 transcript_id : XM_986220.1

name	B3bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906815 GeneID:333789 MGI:2684414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl3 binding protein transcript_id : NM_001024917.1

name	LOC100041809 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253916 GeneID:100041809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041809 transcript_id : XM_001477042.1

name	Rhoh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487388 GeneID:74734 MGI:1921984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member H transcript_id : NM_001081105.1

name	EG666827 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374790 GeneID:666827 MGI:3643549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG666827 transcript_id : XM_986287.1

name	Chrna9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487390 GeneID:231252 MGI:1202403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 9 transcript_id : NM_001081104.1

name	BC013481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342581 GeneID:245945 MGI:2384294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013481 transcript_id : NM_178446.2

name	BC013481 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20532345 GeneID:245945 MGI:2384294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC013481 transcript_id : NM_139065.1

name	LOC100042394 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253943 GeneID:100042394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042394 transcript_id : XM_001478594.1

name	Nsun7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519165 GeneID:70918 MGI:1918168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NOL1/NOP2/Sun domain family, member 7 transcript_id : NM_027602.1

name	Apbb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468878 GeneID:11787 MGI:108405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 2 transcript_id : NM_009686.1

name	Uchl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755928 GeneID:22223 MGI:103149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin carboxy-terminal hydrolase L1 transcript_id : NM_011670.1

name	LOC100041876 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253920 GeneID:100041876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041876 transcript_id : XM_001477152.1

name	3732412D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053895 GeneID:77569 MGI:1924819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3732412D22 gene transcript_id : NM_001001980.2

name	Klf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680582 CCDS:CCDS19301.1 GeneID:16599 MGI:1342773
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Kruppel-like factor 3 product : Kruppel-like factor 3 (basic) protein_id : NP_032479.1

name	Tlr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507603 CCDS:CCDS19302.1 GeneID:21897 MGI:1341295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] [Evidence NAS]; GO:0045335 - phagocytic vesicle [Evidence NAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] [Evidence NAS]; GO:0042497 - triacylated lipoprotein binding [Evidence NAS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence NAS]; GO:0042495 - detection of triacylated bacterial lipoprotein [Evidence NAS]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0042116 - macrophage activation [Evidence NAS]; GO:0002217 - physiological defense response [Evidence IMP]; GO:0045410 - positive regulation of interleukin-6 biosynthesis [Evidence IMP]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IMP] codon_start : 1 product : toll-like receptor 1 protein_id : NP_109607.1

name	Tlr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58743329 CCDS:CCDS19303.1 GeneID:21899 MGI:1341296
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : toll-like receptor 6 protein_id : NP_035734.2

name	9130005N14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560128 CCDS:CCDS19304.1 GeneID:68303 MGI:1915553
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68303 protein_id : NP_080943.2

name	Tmem156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253911 GeneID:243025 MGI:2685292
definition	codon_start : 1 product : hypothetical protein protein_id : XP_144292.6

name	Klhl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30039720 CCDS:CCDS19305.1 GeneID:71778 MGI:1919028
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 5 protein_id : NP_780383.1

name	Wdr19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510249 GeneID:213081 MGI:2443231
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : WD repeat membrane protein PWDMP protein_id : NP_700440.1

name	Rfc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755306 GeneID:19687 MGI:97891
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003911 - DNA ligase (NAD+) activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : replication factor C, 140 kDa product : replication factor C 1 protein_id : NP_035388.1

name	Klb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626032 CCDS:CCDS19306.1 GeneID:83379 MGI:1932466
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0015926 - glucosidase activity [Evidence IEA] codon_start : 1 product : klotho beta protein_id : NP_112457.1

name	Rpl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149647 GeneID:20005 MGI:1298373
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L9 protein_id : NP_035422.1

name	Lias (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277380 CCDS:CCDS19307.1 GeneID:79464 MGI:1934604
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051538 - 3 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0016992 - lipoate synthase activity [Evidence IEA]; GO:0017140 - lipoic acid synthase activity [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0009107 - lipoate biosynthesis [Evidence IEA]; GO:0009105 - lipoic acid biosynthesis [Evidence IGI] codon_start : 1 product : lipoic acid synthetase protein_id : NP_077791.1

name	Ugdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678499 CCDS:CCDS19308.1 GeneID:22235 MGI:1306785
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0003979 - UDP-glucose 6-dehydrogenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP] codon_start : 1 product : UDP-glucose dehydrogenase protein_id : NP_033492.1

name	1110003E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526868 CCDS:CCDS19309.1 GeneID:68552 MGI:1915802
definition	codon_start : 1 product : hypothetical protein LOC68552 protein_id : NP_598458.1

name	4930589O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897580 GeneID:78214 MGI:1925464
definition	codon_start : 1 product : hypothetical protein LOC78214 protein_id : XP_904525.1

name	Hip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542956 GeneID:53323 MGI:1858216
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence TAS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : huntingtin interacting protein 2 protein_id : NP_058066.2

name	9030416H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486765 GeneID:71521 MGI:1918771
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71521 protein_id : NP_001074790.1

name	1700022K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253913 GeneID:74234 MGI:1921484
definition	codon_start : 1 product : hypothetical protein LOC74234 protein_id : XP_001477066.1

name	LOC384261 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374789 GeneID:384261
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991314.1

name	B3bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906816 CCDS:CCDS19310.1 GeneID:333789 MGI:2684414
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004113 - 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0046404 - ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Nedd4 binding protein 2 protein_id : NP_001020088.1

name	LOC100041809 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253917 GeneID:100041809
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477092.1

name	Rhoh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487389 GeneID:74734 MGI:1921984
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : ras homolog gene family, member H protein_id : NP_001074574.1

name	EG666827 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374791 GeneID:666827 MGI:3643549
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991381.1

name	Chrna9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487391 GeneID:231252 MGI:1202403
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 product : cholinergic receptor, nicotinic, alpha 9 protein_id : NP_001074573.1

name	BC013481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20532346 CCDS:CCDS19313.1 GeneID:245945 MGI:2384294
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245945 protein_id : NP_620704.1

name	BC013481 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425362 CCDS:CCDS19313.1 GeneID:245945 MGI:2384294
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245945 protein_id : NP_848541.1

name	LOC100042394 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253944 GeneID:100042394
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478644.1

name	Nsun7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519166 CCDS:CCDS19314.1 GeneID:70918 MGI:1918168
definition	codon_start : 1 product : NOL1/NOP2/Sun domain family, member 7 protein_id : NP_081878.1

name	Apbb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468879 GeneID:11787 MGI:108405
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0035035 - histone acetyltransferase binding [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IDA] GO_process : GO:0030048 - actin filament-based movement [Evidence NAS]; GO:0007411 - axon guidance [Evidence IGI]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0030308 - negative regulation of cell growth [Evidence IDA]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence IDA]; GO:0001764 - neuron migration [Evidence IGI]; GO:0043065 - positive regulation of apoptosis [Evidence IDA]; GO:0050821 - protein stabilization [Evidence NAS]; GO:0045449 - regulation of transcription [Evidence IDA] codon_start : 1 note : zinc finger-like protein product : amyloid beta (A4) precursor protein-binding, family B, member 2 protein_id : NP_033816.1

name	Uchl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755929 CCDS:CCDS19315.1 GeneID:22223 MGI:103149
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence ISS]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0008242 - omega peptidase activity [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0043130 - ubiquitin binding [Evidence ISS] [Evidence IDA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence ISS] [Evidence IDA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP] [Evidence IGI]; GO:0007412 - axon target recognition [Evidence IMP]; GO:0019896 - axon transport of mitochondrion [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0042755 - eating behavior [Evidence IGI]; GO:0050905 - neuromuscular physiological process [Evidence IMP]; GO:0016579 - protein deubiquitination [Evidence ISS]; GO:0006950 - response to stress [Evidence IMP]; GO:0006512 - ubiquitin cycle [Evidence IMP]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gracile axonal dystrophy; protein gene product 9.5; PGP 9.5 product : ubiquitin carboxy-terminal hydrolase L1 protein_id : NP_035800.1

name	LOC100041876 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253921 GeneID:100041876
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477202.1

name	3732412D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053896 GeneID:77569 MGI:1924819
definition	GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031032 - actomyosin structure organization and biogenesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77569 protein_id : NP_001001980.2

name	LOC626714 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626714
definition	number : 1 pseudo : _no_value

name	LOC666854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666854
definition	number : 2 pseudo : _no_value

name	LOC666854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666854
definition	number : 1 pseudo : _no_value

name	LOC626641 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149253918 GeneID:626641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to 2410004L22Rik protein pseudo : _no_value transcript_id : XR_033040.1

name	9130230L23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253942 GeneID:231253 MGI:3041166
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9130230L23 gene transcript_id : XR_035361.1

clone name	MSMg01-400B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224P03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-334I12.b	B6Ng01-334I12.g
ACC	GA120013	GA120014
length	1,209	1,226
definition	B6Ng01-334I12.b	B6Ng01-334I12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(66,237,203 - 66,238,413)	(66,046,577 - 66,047,804)
sequence	ggaattctactcctaatacccagctatatttaagagaggatctgaagcta agcccttttctggctagcttacatgtagtttgtccctcagacaacatgcc ctacccctgtggcctgacgggatttgccaagggtccaggacagcctaaga agagctaaataaagcctagagactggggatgtagctgacagagtgcttgc ctagcaggcatgagggcctgggtttgatccctagtacctcagaaggcaga tgtggtacatgcctggaatccagccctcgggaggtaaaggctaaaagtcc aaggctatccttggctacacaacgagtttgagacaaccctgggctacatg agactctatctcaagaaataaaggaaggggacaagaggacatctcagtga aagcctaacaacctgggatcccatggtagaaaaagaggaagtagccgggc atggtggcgcacgcctttaatccctgcacttgggaggcagaggcacgagg atgtctgaattcgaggccagcctggtctacagagtgagttccagcacagc caaggctacacagaaaaaccctgtctcgaaaaaccaaaaaaagaaaagag agaaaaaaaaaaggaagaactcctgacctctgacctgcatacctaccatt gtccttcactctgtagacacaggccggggtatacacagtcacacacacag atacttatcataaagttttgaaaagacatcataactttttaaaggccttt gcttctcctcctcctctctcttccctccctcttcctccccatctccctcc cctttttcccacaactctagatatggtccttcagcacccctagaactgcg gcactgctcacttctccacactgctccctccctagacactacccttagcc caccttacctgtaggtaaatggcagcttttacctctacagacctttttgg gctctctttaaagtcatgaatacacccatgtatcagagttgtatgtatca aacatagcactgggctgtgtgtgttttggacttttgtgtgcttgtctctt aacatctaacgcagcagcaatgtcttcagtgaactgatccagacctacag tggggtctgggtcagaacaaatctccaagtggtctggttctgcattccga aagagcgacctcattcatgaaccggttgattctgctctgccctcctggta atcagggag	gaattcaaaattcaagttatcactgtcagaaagcttgtgggcagtggagt aaaagttgcacacttgtataaagcaatggaaaatgacaattatgtaaggc ttacacacagtagtaacaaaatggaaactttaaaaacttttttctcaacc aaaataaaacaatggtcagcactataaacatttagtatgtctaaaattta ctaatccaatttgctctctttaaagaaaaattaatgtcttaagtattaaa cagtagactttataaaaaattttgtattacttgtgagtgactatatttac agacccatgattacttcaagtaatgtgaggtttcacatctataaactact aaaacaaaactaatctgatctaaagccctgccgccatcactgtaaggtgt catgtttctcaagtaaagctgaaattgccttcaggagtaaaacggtttgt tattgctgacagacaaatgtgttgatttgtcataatgaagtattatgata atataaatatgttgaactgaaaatatcccttaatgagtgaaaagtccaaa aatataaaaattctacatttatagtttaatcaattattttttctagtatt acatttatttagtgtatgactgaatgtgcatcctaatatactaaattggt aagaaaatgattaaacccattacttatataataagtaagtttagtattta cttaaatatgtaaatgttctttaatattaatactgaatattgtaaatttc aaagatgacactacttttacatctccttccactgtttatcagcagataac aactagggatatgtttcatatgttacatgagctaaatgagatagactaaa ctcatatttcactcccatataattagagaaaaaacatcttcaaagtagat ttttttttccctatacaccttaaagaataccttcagtttgaattcaagct gtggcatgacagatacagtaactgaggatcgatagcaaaaagttcctgat cagatcaatacgttgttcagacaggtcgctgactgatgatctgcccagca ccaggacttgatgaaaactataagagaaattacaataaaaaaaaaaaatg gtgttatttttatttaagaagcttaacacggttttctataaacatacatg taaagactgatttgacatatacattactggaagaatcaattagctcatct gatttctaacatgtaagaggagagtc
quality values	Open. Hide. 8 41 31 24 25 58 46 54 52 62 62 62 62 47 45 62 62 62 62 62 41 24 62 62 54 62 62 62 47 62 47 51 44 28 43 34 46 46 49 44 43 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 59 59 59 62 62 62 62 62 51 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 56 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 51 62 62 62 56 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 56 62 56 62 43 62 62 56 62 46 62 56 62 47 42 62 62 62 62 62 62 56 54 62 62 48 62 62 62 54 62 47 62 48 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 62 54 62 62 52 62 52 62 52 52 54 45 46 58 37 58 52 52 50 52 33 47 39 52 58 54 45 41 47 40 52 52 50 52 33 29 34 36 39 52 52 29 40 42 41 42 41 52 52 47 47 52 52 33 54 48 52 54 42 58 29 54 52 54 52 52 52 52 52 52 52 52 58 58 58 58 58 52 58 46 42 58 53 58 58 58 54 34 54 53 58 58 49 42 39 58 51 58 54 43 49 46 53 58 51 51 54 28 46 53 58 58 53 58 58 50 58 42 32 49 54 53 41 53 36 53 49 51 42 30 48 33 50 48 44 58 46 58 58 37 22 50 50 37 42 50 54 51 49 52 53 28 53 34 53 49 58 40 51 38 52 39 53 50 43 48 53 52 51 40 40 53 39 36 58 33 31 58 58 26 29 20 58 58 41 30 50 50 37 53 52 34 53 47 49 53 53 58 58 58 32 50 53 36 50 54 28 58 20 50 50 50 50 50 50 37 50 39 54 25 38 39 32 34 44 44 44 42 52 45 53 16 42 29 40 42 40 27 44 40 41 50 44 32 24 47 37 34 54 51 34 31 40 37 49 21 54 40 44 37 51 53 41 41 53 54 47 51 40 51 40 27 40 37 31 40 32 37 29 8 19 40 14 33 32 23 38 31 54 35 34 34 35 18 31 40 32 37 52 40 40 26 40 32 31 35 25 32 32 28 25 27 15 14 21 31 45 32 30 24 28 29 45 53 32 35 24 35 20 28 29 30 39 45 18 53 31 51 36 32 41 37 40 26 31 27 28 16 33 42 36 32 31 51 32 28 13 25 18 33 51 44 18 13 25 10 9 14 24 30 31 51 20 31 25 33 23 31 48 42 26 31 16 11 7 11 31 31 29 28 21 16 16 25 31 31 21 17 25 11 9 23 23 31 8 41 46 48 21 42 48 27 25 19 23 21 17 14 48 25 25 39 12 23 23 35 25 27 31 26 32 25 22 25 8 23 31 33 22 31 30 11 7 11 11 15 7 39 11 26 31 36 17 9 10 21 11 11 18 31 29 32 26 22 18 11 7 7 13 22 24 32 10 36 9 8 17 26 16 19 11 18 16 21 30 38 44 31 16 14 10 12 37 43 34 18 19 13 22 9 18 31 32 24 25 21 24 9 21 4 15 19 6 13 11 8 15 32 37 20 15 6 22 21 22 30 5 4 9 16 14 22 22 11 33 7 8 38 16 15 6 5 6 18 18 7 14 13 9 8 24 9 6 21 13 23 28 6 9 9 13 5 22 13 19 20 5 18 7 26 29 21 6 22 9 10 14 21 5 5 12 21 10 5 4 4 5 5 16 4 6 12 9 14 19 4 18 7 18 7 7 13 16 5 17 8 25 5 9 13 5 28 10 4 13 4 3 4 5 11 7 9 8 7 6 14 6 5 4 3 3 2 4 6 7 5 10 5 2 3 2 8 4 6 7 3 5 10 20 6 7 14 15 16 8 15 2 1 1 4 23 14 5 2 2 2 1 3 2 7	Open. Hide. 62 47 51 44 62 44 51 62 62 62 62 59 59 39 35 33 59 59 62 59 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 59 54 62 62 62 62 42 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 54 58 58 58 58 58 58 58 58 58 58 53 49 54 54 54 52 52 54 54 54 58 58 58 58 54 58 58 58 58 49 58 54 49 54 58 54 58 58 58 48 47 53 54 58 58 58 58 54 47 58 58 58 58 58 52 58 58 58 54 54 58 51 51 58 46 54 48 54 51 46 58 53 58 51 46 58 58 58 58 54 58 51 58 58 53 53 47 58 51 58 52 58 58 58 58 58 58 53 54 51 53 58 39 54 51 58 51 43 50 58 58 42 49 58 42 53 49 50 52 53 58 52 51 49 39 53 53 50 48 46 49 58 49 43 51 58 46 40 50 58 42 54 58 58 40 33 51 39 25 52 51 49 58 50 58 51 34 53 52 40 53 53 53 53 50 50 50 52 52 38 50 39 46 52 58 49 47 50 58 50 53 52 40 50 37 58 50 38 53 42 51 32 58 40 49 50 39 38 37 50 38 42 53 53 42 42 50 39 54 53 34 37 42 40 40 49 37 49 40 39 42 37 53 37 45 45 38 38 51 54 31 45 54 41 37 49 50 52 34 54 47 37 53 32 40 41 32 32 43 37 33 44 29 54 54 31 31 40 26 46 53 42 40 41 29 52 32 45 32 45 28 53 37 54 17 28 32 39 30 35 52 31 23 41 22 42 30 32 26 30 40 25 28 19 49 33 33 29 35 35 34 20 49 52 33 31 40 32 32 39 22 37 30 45 29 40 45 52 29 52 28 15 46 33 31 42 42 31 27 21 35 31 31 30 32 29 51 31 31 42 35 28 43 39 31 51 41 31 30 31 39 35 51 30 18 31 33 39 29 26 26 42 31 28 42 33 37 46 41 46 46 23 30 21 30 34 36 17 30 30 46 32 31 33 36 23 31 18 48 48 48 48 47 47 47 29 32 46 33 30 31 25 18 31 20 26 31 23 34 32 46 25 20 35 29 32 32 33 33 34 42 38 33 37 33 46 29 33 27 27 24 26 35 21 30 24 32 35 36 21 9 29 19 12 15 36 28 31 20 22 37 10 16 14 31 31 29 28 18 30 31 38 32 21 24 33 28 27 24 33 11 9 14 25 31 41 47 24 24 19 19 22 21 26 31 21 30 11 17 17 14 22 17 15 30 31 27 13 15 10 31 7 10 18 19 19 15 14 26 11 8 30 19 15 24 21 25 34 27 24 19 32 34 32 27 32 16 12 17 11 21 13 39 30 21 24 16 11 19 29 15 24 9 11 16 16 22 28 17 28 11 22 34 38 28 19 15 15 27 26 27 12 27 7 6 6 3 3 7 16 14 8 18 8 8 27 40 29 29 30 29 28 28 21 27 19 3 8 5 5 13 10 11 7 7 29 34 31 10 15 19 29 21 9 13 12 22 22 10 16 10 8 22 24 5 6 4 7 6 17 28 28 10 20 6 4 6 5 30 8 5 3 4 4 7 4 4 6 5 9 10 6 6 16 16 11 23 7 8 8 9 6 2 2 3 5 9 13 5 5 2 2 6 20 5 4 7 5 10 5 4 5 22 5 7 4 12 3 8 8 9 18 8 5 5 8 13 5 7 6 7 18 23 9 7 13 8 4 3 1 5 4 9 14 6 13 23 12 12 4 4 7 16 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr5_66237203_66238413
seq2: B6Ng01-334I12.b_49_1257 (reverse)

seq1  CTCCCAGATT-CCAGGAGGGCAGAGCCAGATTCCACACGTTTCCTGGAAT  49
      ||||| |||| |||||||||||||| |||| || || || ||| | ||||
seq2  CTCCCTGATTACCAGGAGGGCAGAG-CAGAATCAAC-CGGTTCAT-GAAT  47

seq1  GAGGCTGCTTCTTTCAGAATGCAGAA-CAGGACACTTTGTGA-TTGTTCT  97
      ||||  || |||||| |||||||||| |||  ||||| | || |||||||
seq2  GAGGTCGC-TCTTTCGGAATGCAGAACCAGACCACTTGGAGATTTGTTCT  96

seq1  GGACCCAGGCCCCACTGTAGGTCTGGATCAGTTCACTGGAGGACATTGCC  147
       ||||||| |||||||||||||||||||||||||||| || ||||||| |
seq2  -GACCCAGACCCCACTGTAGGTCTGGATCAGTTCACT-GAAGACATTG-C  143

seq1  TGCTGCGTTAG-TGTTAAGGAGACAAGCACACAAAAGTCCAAAACACACA  196
      ||||||||||| |||||| |||||||||||||||||||||||||||||||
seq2  TGCTGCGTTAGATGTTAA-GAGACAAGCACACAAAAGTCCAAAACACACA  192

seq1  CAG-CCAGTGCTATGTTTGATACATACAACTCTGATACATGGGTGTATTC  245
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCCAGTGCTATGTTTGATACATACAACTCTGATACATGGGTGTATTC  242

seq1  ATGACTTTAAAGAGAGCCC-AAAAGGTCTGTAGAGGTAAAAGCTGCCATT  294
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  ATGACTTTAAAGAGAGCCCAAAAAGGTCTGTAGAGGTAAAAGCTGCCATT  292

seq1  TACCTACAGGTAAGGTGGGCTAAGGGTAGTGTCTAGGGGAGGGAGCAGTG  344
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TACCTACAGGTAAGGTGGGCTAAGGGTAGTGTCTA-GGGAGGGAGCAGTG  341

seq1  TGGAGAAGTGAGCAGTGCCGCAGTTCTAGGGGTGCTGAAGGACCATATCT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGAAGTGAGCAGTGCCGCAGTTCTAGGGGTGCTGAAGGACCATATCT  391

seq1  AGAGTTGTGGGAAAAAGGGGAGGGAGATGGGGAGGAAGAGGGAGGGAAGA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTTGTGGGAAAAAGGGGAGGGAGATGGGGAGGAAGAGGGAGGGAAGA  441

seq1  GAGAGGAGGAGGAGAAGCAAAGGCCTTTAAAAAGTTATGATGTCTTTTC-  493
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GAGAGGAGGAGGAGAAGCAAAGGCCTTTAAAAAGTTATGATGTCTTTTCA  491

seq1  AAACTTTATGATAAGTATCTGTGTGTGTGACTGTGTATACCCCGGCCTGT  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTTTATGATAAGTATCTGTGTGTGTGACTGTGTATACCCCGGCCTGT  541

seq1  GTCTACAGAGTGAAGGACAATGGTAGGTATGCAGGTCAGAGGTCAGGAGT  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTACAGAGTGAAGGACAATGGTAGGTATGCAGGTCAGAGGTCAGGAGT  591

seq1  TCTTCCTTTTTTTTTTCTCTCTTTTCTTTTTTTGGTTTTTCGAGACAGGG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTTTTTTTTTTCTCTCTTTTCTTTTTTTGGTTTTTCGAGACAGGG  641

seq1  TTTTTCTGTGTAGCCTTGGCTGTGCTGGAACTCACTCTGTAGACCAGGCT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTCTGTGTAGCCTTGGCTGTGCTGGAACTCACTCTGTAGACCAGGCT  691

seq1  GGCCTCGAATTCAGACATCCTCGTGCCTCTGCCTCCCAAGTGCAGGGATT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTCGAATTCAGACATCCTCGTGCCTCTGCCTCCCAAGTGCAGGGATT  741

seq1  AAAGGCGTGCGCCACCATGCCCGGCTACTTCCTCTTTTTCTACCATGGGA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCGTGCGCCACCATGCCCGGCTACTTCCTCTTTTTCTACCATGGGA  791

seq1  TCCCAGGTTGTTAGGCTTTCACTGAGATGTCCTCTTGTCCCCTTCCTTTA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGGTTGTTAGGCTTTCACTGAGATGTCCTCTTGTCCCCTTCCTTTA  841

seq1  TTTCTTGAGATAGAGTCTCATGTAGCCCAGGGTTGTCTCAAACTCGTTGT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTGAGATAGAGTCTCATGTAGCCCAGGGTTGTCTCAAACTCGTTGT  891

seq1  GTAGCCAAGGATAGCCTTGGACTTTTAGCCTTTACCTCCCGAGGGCTGGA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCCAAGGATAGCCTTGGACTTTTAGCCTTTACCTCCCGAGGGCTGGA  941

seq1  TTCCAGGCATGTACCACATCTGCCTTCTGAGGTACTAGGGATCAAACCCA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGGCATGTACCACATCTGCCTTCTGAGGTACTAGGGATCAAACCCA  991

seq1  GGCCCTCATGCCTGCTAGGCAAGCACTCTGTCAGCTACATCCCCAGTCTC  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCTCATGCCTGCTAGGCAAGCACTCTGTCAGCTACATCCCCAGTCTC  1041

seq1  TAGGCTTTATTTAGCTCTTCTTAGGCTGTCCTGGACCCTTGGCAAATCCC  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCTTTATTTAGCTCTTCTTAGGCTGTCCTGGACCCTTGGCAAATCCC  1091

seq1  GTCAGGCCACAGGGGTAGGGCATGTTGTCTGAGGGACAAACTACATGTAA  1143
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGGCCACAGGGGTAGGGCATGTTGTCTGAGGGACAAACTACATGTAA  1141

seq1  GCTAGCCAGAAAAGGGCTTAGCTTCAGATCCTCTCTTAAATATAGCTGGG  1193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGCCAGAAAAGGGCTTAGCTTCAGATCCTCTCTTAAATATAGCTGGG  1191

seq1  TATTAGGAGTAGAATTCC  1211
      ||||||||||||||||||
seq2  TATTAGGAGTAGAATTCC  1209

seq1: chr5_66046577_66047804
seq2: B6Ng01-334I12.g_68_1293

seq1  GAATTCAAAATTCAAGTTATCACTGTCAGAAAGCTTGTGGGCAGTGGAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAAATTCAAGTTATCACTGTCAGAAAGCTTGTGGGCAGTGGAGT  50

seq1  AAAAGTTGCACACTTGTATAAAGCAATGGAAAATGACAATTATGTAAGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGTTGCACACTTGTATAAAGCAATGGAAAATGACAATTATGTAAGGC  100

seq1  TTACACACAGTAGTAACAAAATGGAAACTTTAAAAACTTTTTTCTCAACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACACACAGTAGTAACAAAATGGAAACTTTAAAAACTTTTTTCTCAACC  150

seq1  AAAATAAAACAATGGTCAGCACTATAAACATTTAGTATGTCTAAAATTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAAAACAATGGTCAGCACTATAAACATTTAGTATGTCTAAAATTTA  200

seq1  CTAATCCAATTTGCTCTCTTTAAAGAAAAATTAATGTCTTAAGTATTAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATCCAATTTGCTCTCTTTAAAGAAAAATTAATGTCTTAAGTATTAAA  250

seq1  CAGTAGACTTTATAAAAAATTTTGTATTACTTGTGAGTGACTATATTTAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAGACTTTATAAAAAATTTTGTATTACTTGTGAGTGACTATATTTAC  300

seq1  AGACCCATGATTACTTCAAGTAATGTGAGGTTTCACATCTATAAACTACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCATGATTACTTCAAGTAATGTGAGGTTTCACATCTATAAACTACT  350

seq1  AAAACAAAACTAATCTGATCTAAAGCCCTGCCGCCATCACTGTAAGGTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAAAACTAATCTGATCTAAAGCCCTGCCGCCATCACTGTAAGGTGT  400

seq1  CATGTTTCTCAAGTAAAGCTGAAATTGCCTTCAGGAGTAAAACGGTTTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTTTCTCAAGTAAAGCTGAAATTGCCTTCAGGAGTAAAACGGTTTGT  450

seq1  TATTGCTGACAGACAAATGTGTTGATTTGTCATAATGAAGTATTATGATA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGCTGACAGACAAATGTGTTGATTTGTCATAATGAAGTATTATGATA  500

seq1  ATATAAATATGTTGAACTGAAAATATCCCTTAATGAGTGAAAAGTCCAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAATATGTTGAACTGAAAATATCCCTTAATGAGTGAAAAGTCCAAA  550

seq1  AATATAAAAATTCTACATTTATAGTTTAATCAATTATTTTTTCTAGTATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATAAAAATTCTACATTTATAGTTTAATCAATTATTTTTTCTAGTATT  600

seq1  ACATTTATTTAGTGTATGACTGAATGTGCATCCTAATATACTAAATTGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTATTTAGTGTATGACTGAATGTGCATCCTAATATACTAAATTGGT  650

seq1  AAGAAAATGATTAAACCCATTACTTATATAATAAGTAAGTTTAGTATTTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAATGATTAAACCCATTACTTATATAATAAGTAAGTTTAGTATTTA  700

seq1  CTTAAATATGTAAATGTTCTTTAATATTAATACTGAATATTGTAAATTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAATATGTAAATGTTCTTTAATATTAATACTGAATATTGTAAATTTC  750

seq1  AAAGATGACACTACTTTTACATCTCCTTCCACTGTTTATCAGCAGATAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATGACACTACTTTTACATCTCCTTCCACTGTTTATCAGCAGATAAC  800

seq1  AACTAGGGATATGTTTCATATGTTACATGAGCTAAATGAGATAGACTAAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTAGGGATATGTTTCATATGTTACATGAGCTAAATGAGATAGACTAAA  850

seq1  CTCATATTTCACTCCCATATAATTAGAGAAAAAACATCTTCAAAGTAGAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATATTTCACTCCCATATAATTAGAGAAAAAACATCTTCAAAGTAGAT  900

seq1  TTTTTTTTCCCTATACACCTTAAAGAATACCTTCAGTTTGAATTCAAGCT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCCCTATACACCTTAAAGAATACCTTCAGTTTGAATTCAAGCT  950

seq1  GTGGCATGACAGATAACAGTAACTGAGGATCGATAGCAAAAAGTTCCTGA  1000
      |||||||||||||| |||||||||||||||||||||||||||||||||| 
seq2  GTGGCATGACAGAT-ACAGTAACTGAGGATCGATAGCAAAAAGTTCCTG-  998

seq1  ATCAGATCAAATACG-TGTTCAGACAGGTCGCTGACTGATGATCTGCCCA  1049
      |||||||| |||||| ||||||||||||||||||||||||||||||||||
seq2  ATCAGATC-AATACGTTGTTCAGACAGGTCGCTGACTGATGATCTGCCCA  1047

seq1  GCACCAGGACTTGATTGAAAAACTATAAGAGACATTACAATAAAAAAAAA  1099
      |||||||||||||||   |||||||||||||| |||||||||||||||||
seq2  GCACCAGGACTTGAT--GAAAACTATAAGAGAAATTACAATAAAAAAAAA  1095

seq1  AA--TGTGTTA-TTTTATTTAAGAAGCTAAACA--GTTTTCTATAAACAT  1144
      ||   |||||| |||||||||||||||| ||||  |||||||||||||||
seq2  AAATGGTGTTATTTTTATTTAAGAAGCTTAACACGGTTTTCTATAAACAT  1145

seq1  ACATGTAAAGACTGATTGAGCAT-TACCCATATAACTGAAAGATACAAAT  1193
      |||||||||||||||||   ||| |||    || |||| |||| |  |||
seq2  ACATGTAAAGACTGATTTGACATATAC----ATTACTGGAAGA-ATCAAT  1190

seq1  TAGCT--ACTGAATTTCTAACATGTAAGAGGAGAGTC  1228
      |||||   ||| |||||||||||||||||||||||||
seq2  TAGCTCATCTG-ATTTCTAACATGTAAGAGGAGAGTC  1226

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information