MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-093N19
Chromosome	5 (Build37)
Map Location	140,830,779 - 140,830,981
singlet/doublet	singlet
Overlap gene	Snx8
Upstream gene	Cyp2w1, 3110082I17Rik, D830046C22Rik, Gpr146, C130050O18Rik, Gpr30, Zfand2a, Uncx4.1, LOC100041200, LOC100041209, LOC100041217, Micall2, Ints1, Mafk, BC019731, 1810042K04Rik, A930017N06Rik, LOC100041270, Mad1l1, Ftsj2, Nudt1
Downstream gene	Eif3s9, LOC100041291, EG231836, Chst12, Grifin, Lfng, Ttyh3, Iqce, AA881470, 6530401C20Rik, Gna12, Card11, LOC623466
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp2w1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins

name	3110082I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73212 MGI:1920462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830046C22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320197 MGI:2443565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80290 MGI:1933113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C130050O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76854 MGI:1924104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfand2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100494 MGI:2140729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uncx4.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22255 MGI:108013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041200 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Micall2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231830 MGI:2444818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68510 MGI:1915760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mafk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC019731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231832 MGI:2385897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810042K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66506 MGI:1913756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930017N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243312 MGI:2442479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 10 Proteins pseudo : _no_value

name	Mad1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17120 MGI:1341857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ftsj2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68017 MGI:1915267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17766 MGI:109280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231834 MGI:2443816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27979 MGI:106478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	EG231836 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231836 MGI:3646257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Chst12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59031 MGI:1929064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grifin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77998 MGI:1925248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lfng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16848 MGI:1095413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttyh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78339 MGI:1925589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqce (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74239 MGI:1921489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA881470 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231841 MGI:1891679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6530401C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231842 MGI:2442258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14673 MGI:95767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108723 MGI:1916978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1128 ESTs, 7 Proteins pseudo : _no_value

name	Cyp2w1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254651 GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins product : cytochrome P450, family 2, subfamily w, polypeptide 1 transcript_id : XM_620268.4

name	3110082I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801665 GeneID:73212 MGI:1920462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110082I17 gene transcript_id : NM_028469.2

name	D830046C22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802148 GeneID:320197 MGI:2443565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830046C22 gene transcript_id : NM_177097.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662751 GeneID:80290 MGI:1933113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_030258.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662746 GeneID:80290 MGI:1933113
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_001038703.1

name	C130050O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301224 GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130050O18 gene transcript_id : NM_177000.3

name	Gpr30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378497 GeneID:76854 MGI:1924104
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 30 transcript_id : NM_029771.2

name	Zfand2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475963 GeneID:100494 MGI:2140729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, AN1-type domain 2A transcript_id : NM_133349.2

name	Uncx4.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982739 GeneID:22255 MGI:108013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Unc4.1 homeobox (C. elegans) transcript_id : NM_013702.2

name	Micall2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341298 GeneID:231830 MGI:2444818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MICAL-like 2 transcript_id : NM_174850.2

name	Ints1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930422 GeneID:68510 MGI:1915760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 1 transcript_id : NM_026748.1

name	Mafk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130123 GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) transcript_id : NM_010757.2

name	BC019731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560761 GeneID:231832 MGI:2385897
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC019731 transcript_id : NM_144914.2

name	1810042K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345410 GeneID:66506 MGI:1913756
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810042K04 gene transcript_id : NM_025604.2

name	A930017N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342092 GeneID:243312 MGI:2442479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930017N06 gene transcript_id : NM_175522.2

name	Mad1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115648090 GeneID:17120 MGI:1341857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitotic arrest deficient 1-like 1 transcript_id : NM_010752.3

name	Ftsj2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386001 GeneID:68017 MGI:1915267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FtsJ homolog 2 (E. coli) transcript_id : NM_026510.1

name	Nudt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678949 GeneID:17766 MGI:109280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 1 transcript_id : NM_008637.1

name	Snx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375675 GeneID:231834 MGI:2443816
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 8 transcript_id : NM_172277.2

name	Eif3s9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129791 GeneID:27979 MGI:106478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 9 (eta) transcript_id : NM_133916.2

name	LOC100041291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254654 GeneID:100041291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : hypothetical protein LOC100041291 transcript_id : XM_001476110.1

name	EG231836 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254656 GeneID:231836 MGI:3646257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG231836 transcript_id : XM_144611.7

name	Chst12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981188 GeneID:59031 MGI:1929064
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate sulfotransferase 12 transcript_id : NM_021528.2

name	Grifin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115749431 GeneID:77998 MGI:1925248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galectin-related inter-fiber protein transcript_id : NM_030022.1

name	Lfng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778987 GeneID:16848 MGI:1095413
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lunatic fringe gene homolog (Drosophila) transcript_id : NM_008494.3

name	Ttyh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803168 GeneID:78339 MGI:1925589
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 3 (Drosophila) transcript_id : NM_175274.3

name	Iqce (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130547 GeneID:74239 MGI:1921489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing E transcript_id : NM_028833.3

name	AA881470 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388761 GeneID:231841 MGI:1891679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EST AA881470 transcript_id : NM_181066.2

name	AA881470 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387704 GeneID:231841 MGI:1891679
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EST AA881470 transcript_id : NM_172724.2

name	6530401C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326472 GeneID:231842 MGI:2442258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6530401C20 gene transcript_id : NM_173405.2

name	Gna12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129987 GeneID:14673 MGI:95767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 12 transcript_id : NM_010302.2

name	Card11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28202024 GeneID:108723 MGI:1916978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 11 transcript_id : NM_175362.1

name	Cyp2w1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254652 GeneID:545817 MGI:3616076
definition	codon_start : 1 product : similar to cytochrome P450, family 2, subfamily W, polypeptide 1 protein_id : XP_620268.4

name	3110082I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312132 GeneID:73212 MGI:1920462
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC73212 protein_id : NP_082745.1

name	D830046C22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893027 GeneID:320197 MGI:2443565
definition	codon_start : 1 product : hypothetical protein LOC320197 protein_id : NP_796071.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662747 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_001033792.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981402 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_084534.2

name	C130050O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301225 GeneID:319772 MGI:2442694
definition	codon_start : 1 product : hypothetical protein LOC319772 protein_id : NP_795974.2

name	Gpr30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037469 CCDS:CCDS19811.1 GeneID:76854 MGI:1924104
definition	GO_function : GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : constitutively expressed peptide-like receptor like product : G protein-coupled receptor 30 protein_id : NP_084047.1

name	Zfand2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111158 CCDS:CCDS19812.1 GeneID:100494 MGI:2140729
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, AN1-type domain 2A protein_id : NP_579927.1

name	Uncx4.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305613 CCDS:CCDS19813.1 GeneID:22255 MGI:108013
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Unc4.1 homeobox protein_id : NP_038730.1

name	Micall2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424677 GeneID:231830 MGI:2444818
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MICAL-like 2 protein_id : NP_777275.1

name	Ints1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930423 GeneID:68510 MGI:1915760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : integrator complex subunit 1 protein_id : NP_081024.1

name	Mafk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754612 CCDS:CCDS19814.1 GeneID:17135 MGI:99951
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear factor, erythroid derived 2, ubiquitous; p18 NF-E2 product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K protein_id : NP_034887.1

name	BC019731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560762 GeneID:231832 MGI:2385897
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231832 protein_id : NP_659163.2

name	1810042K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313432 CCDS:CCDS19815.1 GeneID:66506 MGI:1913756
definition	codon_start : 1 product : hypothetical protein LOC66506 protein_id : NP_079880.1

name	A930017N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425288 CCDS:CCDS19816.1 GeneID:243312 MGI:2442479
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243312 protein_id : NP_780731.1

name	Mad1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014564 CCDS:CCDS19817.1 GeneID:17120 MGI:1341857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : mitotic arrest deficient 1-like 1 protein_id : NP_034882.2

name	Ftsj2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386002 GeneID:68017 MGI:1915267
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : FtsJ homolog 2 protein_id : NP_080786.1

name	Nudt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678950 CCDS:CCDS19818.1 GeneID:17766 MGI:109280
definition	GO_function : GO:0008413 - 8-oxo-7,8-dihydroguanine triphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006203 - dGTP catabolism [Evidence IDA]; GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 note : mutT (E. coli) human homolog (8-oxo-dGTPase); 8-oxo-7,8-dihydro-2'-dGTPase product : nudix-type motif 1 protein_id : NP_032663.1

name	Snx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986581 GeneID:231834 MGI:2443816
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 8 protein_id : NP_758481.1

name	Eif3s9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789343 CCDS:CCDS19819.1 GeneID:27979 MGI:106478
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 3, subunit 9 protein_id : NP_598677.1

name	LOC100041291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254655 GeneID:100041291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476160.1

name	EG231836 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254657 GeneID:231836 MGI:3646257
definition	codon_start : 1 product : similar to Kinesin-like protein KIF19 protein_id : XP_144611.7

name	Chst12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981189 CCDS:CCDS19820.1 GeneID:59031 MGI:1929064
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050656 - 3'-phosphoadenosine 5'-phosphosulfate binding [Evidence ISS]; GO:0047756 - chondroitin 4-sulfotransferase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0030208 - dermatan sulfate biosynthesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : chondroitin 4-O-sulfotransferase; chondroitin 4-sulfotransferase 2 product : carbohydrate sulfotransferase 12 protein_id : NP_067503.2

name	Grifin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115749432 GeneID:77998 MGI:1925248
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : galectin-related inter-fiber protein protein_id : NP_084298.1

name	Lfng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678680 CCDS:CCDS19821.1 GeneID:16848 MGI:1095413
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007386 - compartment specification [Evidence IMP]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : lunatic fringe gene homolog protein_id : NP_032520.1

name	Ttyh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424932 CCDS:CCDS19822.1 GeneID:78339 MGI:1925589
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005254 - chloride channel activity [Evidence ISS] codon_start : 1 exception : mismatches in translation product : tweety 3 protein_id : NP_780483.1

name	Iqce (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254171 GeneID:74239 MGI:1921489
definition	codon_start : 1 product : IQ motif containing E protein_id : NP_083109.2

name	AA881470 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841004 CCDS:CCDS19823.1 GeneID:231841 MGI:1891679
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC231841 isoform 2 protein_id : NP_851411.1

name	AA881470 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370062 GeneID:231841 MGI:1891679
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC231841 isoform 1 protein_id : NP_766312.1

name	6530401C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734160 CCDS:CCDS19824.1 GeneID:231842 MGI:2442258
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : archeobacterial metalloproteinase-like 1 product : archaemetzincin-1 protein_id : NP_775581.1

name	Gna12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754006 CCDS:CCDS19825.1 GeneID:14673 MGI:95767
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IDA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0042733 - embryonic digit morphogenesis [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS] [Evidence IEA] [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha 12 protein_id : NP_034432.1

name	Card11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202025 GeneID:108723 MGI:1916978
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030890 - positive regulation of B cell proliferation [Evidence IMP]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence IMP]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IMP]; GO:0050870 - positive regulation of T cell activation [Evidence IMP]; GO:0042102 - positive regulation of T cell proliferation [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0045577 - regulation of B cell differentiation [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0045580 - regulation of T cell differentiation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA]; GO:0045061 - thymic T cell selection [Evidence IMP] codon_start : 1 exception : mismatches in translation product : caspase recruitment domain family, member 11 protein_id : NP_780571.1

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 2 pseudo : _no_value

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 1 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 2 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 1 pseudo : _no_value

name	LOC100041217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041217
definition	number : 1 pseudo : _no_value

name	LOC100041270 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254653 GeneID:100041270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 10 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_032546.1

name	LOC623466 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254660 GeneID:623466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1128 ESTs, 7 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_033501.1

clone name	MSMg01-111J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-444E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061P06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-093N19.T7 (MSMg01no093_n19.b1)	MSMg01-093N19.TJ (MSMg01no093_n19.g1)
ACC	AG311189	AG311190
length	1,260	1,286
length of high quality (start - end)	---	206 (114 - 319)
definition	CHROMAT_FILE: MSMg01no093_n19.b1 PHD_FILE: MSMg01no093_n19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:49:06 2005	CHROMAT_FILE: MSMg01no093_n19.g1 PHD_FILE: MSMg01no093_n19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:49:06 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CCTAAAAGCGCCGAATTAGGAATCAAGGTGAAGTGAAACCCTTTAAAAAG GCCACACAATGGCCCCATACAGGCTCACTGGCCGCAGCAAACAGACCCTC TGTGGAGAGGGATGTTGGCAATGGAGGAGTCATAGACTGAGGTAGGGGTC ATTGTAAATTCTGATATATAAAGATATATATAGTTCAATAACTGCTGTAA TACATTATTACCCTCGCTTCACGTCTCATAGTAGCCTGTTCTACTTAACA TGACCCTTATTGCTTTGCCCTTTCCCATAAATTTTTTACTTATTAATGTC ATATGATTCTTTGAAATCTTTCCTCCCAACATTTTTTTTTTTGACCCTAT ACGAGGATATGTTAATTCAAGTATCTTCCTCCCCCTCTTTTTTTCACCCC CCCCCCAACATTTGTCTTTTGTTTCTTTATTTCATTCTTTTCTTTTTTTC ATTCTTCTTTCTTTATTCTATCTGTGCCCACTCTTATTCATTTTAATTCT TTGTTTTTCACTTTTCTTATTTATTTTTTCTCTCTCTTTCCTATATTCCT TTCCATATTTTTTTCCCTTCTTTCTCCTTTTTTTCTTTTTTCCATCTTTT CTTCTTTTTACTTTTCTTTTTTTTTTACTTTCTTAATTTTTTTTTCTTAT TCCTTCTTTCTTTCTTTCTCTCTTTTCTTTCCCTTTTTTTTTTCTTCTAT TTTTATCTTATTTTCTCTTTATTTTTTCTCTTTTTTTTTCTTATCTTTTT TTTTTTTTTCTGTCTTTTTCTTCTCTCCTATCTATCTTCATTCTTTTCTC TTTTCTAATATTTCTTTTCCTTTTTTTCTTTCTTTTTTTCTTTCTTTTTT TTTTTTCTTACTTCTCACTTTCTATTTTTTTTCTTCTTTTATTTTTTATC TTCTTTTTTTCTTTCTTTTTATTTTTTTTCCCCTTTTTAATTTCTTTTTT TCTTTCTCTTTTCTTCTTTTTTCTTTTTTTTTCTTTTCCCGCCCTTTTCT TTTCTTTTCTATTTATATTTAATTTTATCTTTTTATACTTTTTTTTTTTC ATATTTTTCTCTTTCTCTCTAGTTCTTTTTATCTTCATATTTTTTTTTAT TTTTATTTTTTCTTTCTTCTTCTCTCTCCATTCTCTTTCTTTCTTCTTAT ATTCTATTCTTTTACATTCTAATTCCATATTCACCCTATTTCAATTTTAC TATTCTTTCTTTATACTCCATTTCTTATTCTTTTTTTCTTCTTTTCTCTT TATCATTTCT	TCCCCATTGGAGGCTGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXAAAACCACTGCACCCCAGGCTTGAAGGCCACA CCAGGCCCTAAAAAAGTCTCACTAGGGAGCAGACCCGCACCTACCATGCA TGAGGTTCAAGGTGCAAAGACAGCACCACACCAAGAAAAGAAACAAGGCT GTTTCCACTGGGGGTGGAAAGTTAAGGGTGTGTGTGTGACCTATTGAAAG CCTGGGACCTTCCAAAGAGGCCAGCTGTCCTTGGTGAAGTAAAATCAAGC ACAAACACTAGGCTGGTTTAGCTAGATGTCTCAGTGGATAACAGTATTTG CTGCTACAACTTGAGAGTATGAGTTCGACACCCCAGCCCACGTATTTTTT TGTGTATGCCCACAGGTACCTCTAACTCTACCGCTGTGGGAAGTACTTTT TTTTTTCCCCCCCCCCGATTGTTGGTTGCCCCCCTAAAAAAAACGGAGTG ACCCTGTCTTTTCATAGTACTGTGTTAGAGGTACAATCTGTATACCTATT CTCTATCTTCCCCTTTACTATTTTCTCTTTTGATTCAACTATTTCTCTGT TTCTTCCCTTCTTTTACTTTTATCATTTCTTTTCTCTTTTGTGTTTCACT CTTTGATTGCTTTCTTTTCCTTCTGTTCTGTCTACTGAACTATTTTCTTT CTATACTCTTCCATTTGTCCTATTTTTCTTCTCTATTCTTTTTTTTCTTT TTTCCTTTTTTAATTTTTTTTTCTTCCTTGCTTTTTTCCTTCTTATTTTT TTTTTTTTTCTTTCCTCATTTTTATTTTTTTTTACTCTTTTTTTCCTTGT TCTTTTTGTTCTTCTAATGTCTTCTCCCTTTTATTCTCTCTCTTCCTTCT TTTCTTTTTTTCCTTTATATTACTTTTTTATTTTTTCTACCTTTTTCTTT TTCCATTCTTATTTTTCTTATTCAACTTTACATTTTTTTTCCATTCTTTT TCTTTTTTTCTCCTTTTATTCTCCTTTATTTATCTCTCCTTTTTTCTCTA TTTATTACTTTTTTTTCTCTTCTTATTCTTATCATTTTTTTCTCTTTGTT ATTTCTTTTCCTATTTCTTTTCTCTTTTCTTTTTTATATTTCTCTCTTTT TTGTGTCCTCTCTTTCCTCGTACATTATCATCATTCGTTTTATCTTACAT TTCTTCTATCTTTCTTCTTTCTCCCATCTCCTTCCATCTTAATCCATTTC CATTTCTACCTTCTTTTTTTCTCTCTTTTTGTTTTT
quality values	Open. Hide. 21 21 12 12 12 14 6 6 6 6 8 8 10 15 26 25 33 33 37 33 33 39 44 38 32 32 20 20 20 20 28 24 28 28 28 30 25 16 8 8 7 7 7 11 11 12 12 15 17 21 18 14 14 14 21 19 22 22 32 19 13 8 8 8 8 10 10 16 19 14 14 14 15 15 19 26 24 28 19 18 12 12 12 19 21 15 12 11 11 11 18 19 15 20 20 24 24 37 33 27 27 29 17 20 20 23 41 28 32 18 19 12 15 12 12 15 15 13 13 13 12 19 14 14 14 15 15 16 18 12 12 19 16 11 11 12 24 19 30 14 14 15 24 19 30 15 10 8 8 8 12 14 17 10 10 10 15 16 32 36 37 42 37 32 32 21 16 10 10 10 10 12 15 14 15 15 13 16 14 15 14 17 15 19 18 10 10 12 19 16 14 13 26 14 21 17 18 15 10 10 10 10 10 10 10 10 10 14 18 18 12 10 8 8 8 8 8 8 11 11 11 8 10 8 8 8 8 8 8 8 8 10 11 11 11 11 12 12 11 14 18 22 17 16 13 13 14 12 12 13 12 12 12 12 11 18 26 19 16 16 8 8 8 12 8 8 13 13 10 11 11 21 21 10 10 9 9 9 9 9 10 10 10 10 10 12 15 10 10 8 10 7 6 8 8 8 8 8 8 8 8 8 15 11 15 10 9 9 9 10 8 8 8 8 8 11 10 10 10 10 13 9 9 9 9 9 11 12 8 8 8 8 8 8 10 10 12 10 10 9 9 10 10 10 10 10 8 10 9 9 9 10 12 11 11 9 9 8 12 14 14 14 8 8 8 8 8 8 10 12 12 10 10 7 7 8 9 10 10 10 12 11 12 10 8 8 8 8 10 14 12 10 8 8 8 8 8 8 13 11 13 10 15 11 8 8 8 8 8 8 9 10 9 9 8 8 8 8 10 10 11 8 8 6 6 8 8 8 6 6 8 8 8 8 8 8 8 8 10 10 9 9 9 10 9 9 15 9 8 8 8 8 9 8 9 9 9 9 9 10 19 12 16 14 11 11 8 8 8 10 10 10 10 9 7 7 8 7 6 6 6 8 8 8 8 8 8 8 8 8 8 11 12 9 9 8 8 6 6 8 10 9 10 10 10 10 12 11 9 11 8 8 8 8 12 13 8 8 8 8 8 8 8 8 9 8 12 10 9 9 9 8 8 8 10 8 8 10 10 8 6 6 6 6 6 8 8 9 9 10 10 11 11 8 8 6 6 8 8 9 9 21 17 12 9 9 9 10 10 8 8 8 8 6 7 12 8 13 15 13 16 13 13 13 7 7 8 8 9 10 9 9 6 6 6 6 8 8 10 10 11 10 10 9 9 12 8 10 9 8 8 8 10 16 9 9 9 9 9 9 9 9 10 13 11 8 6 6 7 10 11 9 12 13 10 12 11 11 11 11 13 21 10 10 6 6 8 8 8 6 6 6 8 8 8 8 10 11 8 8 6 6 8 6 6 8 8 10 9 9 10 10 9 15 18 12 8 8 10 8 6 7 8 7 10 10 8 9 9 10 9 8 8 8 10 8 8 8 8 8 15 15 12 8 8 8 8 8 8 10 10 10 9 9 10 9 9 8 8 8 8 8 12 12 12 10 12 9 10 13 12 11 11 12 11 16 12 12 11 8 8 6 6 6 7 7 11 11 14 14 16 21 16 17 13 13 8 8 8 8 7 7 9 11 11 13 8 8 8 6 8 6 6 8 8 6 6 8 6 6 8 6 6 6 6 8 8 8 8 9 6 12 6 9 8 10 10 11 7 6 8 8 8 10 7 6 8 8 9 9 8 10 10 11 10 10 15 15 11 8 11 8 8 8 8 12 9 10 10 11 10 10 10 12 13 10 8 8 8 8 8 8 8 8 8 8 12 10 9 8 9 9 9 9 9 10 12 13 8 8 8 8 8 8 6 6 6 8 8 8 6 6 8 8 8 10 13 10 13 8 8 6 6 8 10 9 7 12 10 6 6 8 8 8 8 8 9 9 9 8 10 8 8 8 8 8 10 8 8 6 7 8 8 9 9 9 9 9 19 13 16 11 11 11 11 15 11 12 10 10 10 10 10 10 15 10 11 8 8 8 8 7 6 7 7 10 10 13 13 13 15 12 10 10 8 8 6 6 8 12 23 26 28 28 30 22 22 15 14 8 10 6 6 8 15 14 17 11 19 12 12 8 8 11 22 23 22 15 11 11 11 11 10 9 9 10 11 10 10 10 10 11 10 10 8 10 10 8 8 8 9 9 10 10 10 11 11 10 16 8 8 6 6 8 8 8 8 9 9 9 10 15 10 6 6 6 6 6 8 8 8 11 9 13 11 12 12 10 16 8 8 6 6 8 8 9 9 12 10 10 9 9 11 10 10 7 7 8 8 7 7 6 6 6 6 8 8 11 12 11 9 9 7 6 10 6 6 6 6 8 8 9 9 10 13 10 10 8 8 9 9 15 7 12 6 6 8 8 11 11 14 10 10 8 8 6 6 8 8 11 10 21 12 12 11 10 8 8 6 6 8 8 10 10 10 11 11 10 11 8 10 11 13 10 10 7 6 8 8 6 6 8 8 8 6 6 8 6 6 8 8 13 8 8 6 6 8 8 8 6 6 6 6 8 8 8 8 6 6 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 10 8 8 8 8 8 8 8 8 9 10 10 15 10 8 8 10 8 6 6 8 8 9 8 8 6 6 6 6 6 8 8 6 6 6 6 11 17 13 8 8 8 6 6 8 6 6 11 8 8 7 8 8 9 9 11 8 8 6 6 8 8 8 9 9 9	Open. Hide. 9 9 9 9 9 6 6 6 7 8 7 6 8 8 8 8 8 8 9 13 17 9 8 6 6 10 10 23 19 19 19 14 19 19 28 23 26 24 24 30 36 37 37 43 43 37 37 39 47 47 47 50 53 53 50 50 50 41 41 37 37 15 15 10 10 13 10 11 10 11 12 12 26 20 30 30 30 30 30 31 39 47 57 48 48 43 43 39 39 42 39 43 43 48 48 48 48 47 41 47 30 30 11 11 11 11 11 9 9 9 9 9 10 23 28 28 28 28 30 22 30 30 36 36 33 39 41 40 39 37 37 14 13 9 9 10 12 11 23 23 40 40 40 48 48 48 43 43 40 40 39 43 39 43 43 47 47 47 40 39 39 37 37 43 43 43 43 47 43 43 43 40 40 40 41 37 34 21 13 10 10 10 10 22 25 47 39 39 39 39 39 39 43 40 43 43 43 48 48 57 57 53 53 47 57 48 48 48 44 44 57 57 57 59 59 59 47 37 43 42 43 43 47 47 43 43 43 43 43 43 46 46 57 43 39 37 25 25 29 29 37 57 57 57 44 44 43 42 43 46 48 46 44 42 30 30 30 42 42 57 57 46 42 42 35 37 37 47 43 44 44 39 39 32 35 35 44 35 35 39 40 32 25 17 17 17 27 26 32 35 39 39 46 37 37 25 25 25 25 25 25 28 34 36 36 36 36 31 34 30 30 30 34 30 21 15 15 15 15 10 8 6 6 8 8 11 21 18 18 24 19 18 15 11 11 10 13 13 24 24 19 19 12 12 17 32 32 42 43 43 43 36 43 31 28 15 14 14 23 26 33 28 23 15 11 11 11 13 15 21 25 19 23 23 19 22 21 18 13 13 13 28 30 37 35 35 39 37 37 37 20 19 11 10 9 9 8 9 10 8 7 7 11 15 15 11 10 10 8 8 12 15 36 19 19 12 10 10 11 13 9 9 9 12 15 15 20 29 22 15 10 8 8 15 16 12 23 22 14 12 12 12 11 10 10 10 10 15 18 25 17 19 10 9 9 9 9 12 12 9 9 9 12 12 10 9 7 7 8 10 8 8 10 8 8 8 7 10 8 10 10 8 8 6 6 8 7 11 14 14 16 11 13 10 11 10 8 8 8 8 13 8 11 11 13 13 13 13 10 10 10 10 10 10 12 11 11 11 11 11 13 8 8 6 6 8 8 9 8 8 6 6 8 8 8 8 8 8 8 8 8 12 10 10 10 11 10 10 10 8 8 8 8 8 8 8 8 6 6 8 15 8 8 8 8 8 8 8 8 8 9 8 6 6 6 6 8 8 11 11 7 6 8 8 11 10 11 10 10 11 9 9 9 10 10 8 6 9 8 10 11 9 8 8 6 6 8 8 8 6 6 6 6 8 9 9 9 10 8 8 10 10 8 8 8 8 8 12 8 8 8 10 8 8 10 10 9 11 10 10 10 11 11 10 18 17 17 11 10 10 10 8 8 12 8 8 8 12 12 9 9 9 8 8 8 9 10 9 11 9 8 8 15 15 15 21 13 9 9 9 8 8 9 9 9 9 11 11 12 12 11 10 10 14 12 8 8 8 8 13 19 13 13 9 9 8 8 7 6 8 8 8 8 8 8 10 10 10 8 10 8 8 8 8 8 8 6 6 8 8 8 8 10 8 8 8 9 13 13 21 12 10 9 9 10 11 6 6 8 8 19 12 12 8 8 8 8 14 12 12 8 8 8 8 11 11 11 15 12 10 9 9 8 8 13 13 8 8 8 8 10 12 13 14 14 13 10 8 8 12 10 8 8 8 8 8 8 10 13 11 18 16 20 20 23 21 16 14 16 17 16 12 8 8 8 8 6 6 10 8 8 8 8 8 13 10 10 10 13 11 11 10 9 8 8 8 7 12 12 13 12 10 10 8 8 6 8 6 6 8 8 6 7 8 8 10 9 9 9 12 10 11 8 8 8 8 9 8 6 6 8 8 8 8 13 11 11 10 10 15 8 8 6 6 8 8 8 8 8 8 6 6 8 8 8 8 8 8 9 10 10 9 9 8 8 8 8 10 10 10 11 11 11 13 12 10 9 9 9 9 10 9 12 12 12 11 12 8 8 6 7 10 8 10 8 8 8 8 8 8 15 15 10 10 8 8 7 6 10 10 12 11 8 8 8 8 8 10 8 6 6 8 8 8 8 6 6 8 6 8 8 8 8 8 8 8 10 10 8 6 6 8 6 10 10 14 10 10 12 10 8 8 8 8 10 10 11 9 11 9 13 8 8 8 10 9 9 10 10 8 8 8 8 8 10 6 6 7 7 10 8 6 6 8 10 13 7 9 8 8 6 6 6 6 8 8 8 10 10 10 8 8 8 8 8 8 8 8 10 10 10 10 13 13 13 10 12 12 16 11 11 12 11 11 8 10 8 8 8 10 6 6 8 8 8 9 9 7 8 8 6 10 7 7 10 10 11 20 15 12 9 9 9 9 10 10 8 8 8 7 7 8 8 8 10 8 8 9 6 6 8 8 8 8 8 8 9 9 8 10 8 8 8 8 8 10 8 9 7 10 8 11 6 6 6 6 6 7 7 9 13 8 8 8 8 10 10 11 11 11 11 9 10 6 8 8 8 8 8 12 11 9 8 10 8 8 8 8 8 7 7 8 8 8 8 11 9 8 8 8 8 8 8 8 8 8 13 8 8 11 8 8 8 8 8 8 8 6 6 10 12 10 10 11 8 8 8 8 6 7 8 8 6 7 10 11 10 11 8 8 8 8 6 7 8 9 9 12 10 10 8 8 8 8 10 10 11 11 9 8 8 6 6 6 6 6 6 10 6 6 6 6 6 9 9 9 10 10 8 8 8 8 10 8 8 6 10 10 8 8 8 10 10 9 9 6 12 10 10 7 9 9 10 13 12 12

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no093_n19.g1 MSMg01no093_n19.g1 CHROMAT_FILE:
MSMg01no093_n19.g1 PHD_FILE: MSMg01no093_n19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:49:06 2005
         (206 letters)



>mm_chr5_140830579_140831184
          Length = 606

 Score =  339 bits (175), Expect = 1e-97
 Identities = 196/203 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   aagtctcactagggagcagacccgcacctaccatgcatgaggttcaaggtgcaaagacag 60
           ||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||
Sbjct: 201 aagtctcactagggagcagataggcacctaccatgcatgaggttcaaggtgcaaagacag 260

                                                                       
Query: 61  caccacaccaagaaaagaaacaaggctgtttccactgggggtggaaagttaagggtgtgt 120
           |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 caccacaaaaagaaaagaaacaaggctgtttccactgggggtggaaagttaagggtgtgt 320

                                                                       
Query: 121 gtgtgacctattgaaagcctgggaccttccaaagaggccagctgtccttggtgaagtaaa 180
           ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 321 gtgtgacctattgaaagcctgagaccttccaaagaggccagctgtccttggggaagtaaa 380

                                  
Query: 181 atcaagcacaaacactaggctgg 203
           |||||||||||||||||||||||
Sbjct: 381 atcaagcacaaacactaggctgg 403


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 206
Length of database: 606
Length adjustment: 8
Effective length of query: 198
Effective length of database: 598
Effective search space:   118404
Effective search space used:   118404
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information