MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-132A04
Chromosome	5 (Build37)
Map Location	147,024,298 - 147,024,719
singlet/doublet	singlet
Overlap gene	Rnf6
Upstream gene	LOC677270, EG666311, EG622127, LOC100039566, Cyp3a16, LOC100041375, LOC667065, Cyp3a41, Cyp3a44, Cyp3a11, Cyp3a25, LOC667098, LOC667104, LOC100041449, LOC433961, EG622306, 1700001J03Rik, LOC667121
Downstream gene	Cdk8, Wasf3, LOC623198, LOC622924, 4930449I24Rik, LOC100041548, LOC100041554, LOC100041566, LOC100041578, EG667172, Gpr12, Usp12, 1700041I07Rik, Rpl21, Rasl11a, LOC100039699, LOC627218, Gtf3a, Mtif3, Lnx2, Rpo1-3, Gsh1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC677270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG666311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins

name	LOC100039566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cyp3a16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13114 MGI:106099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins

name	LOC667065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Cyp3a41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53973 MGI:1858451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13112 MGI:88609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp3a25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56388 MGI:1930638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins

name	LOC433961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	EG622306 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins

name	1700001J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69282 MGI:1916532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Rnf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wasf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245880 MGI:2658986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	LOC622924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins

name	4930449I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041548 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins

name	LOC100041554 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins

name	LOC100041566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 3 Proteins

name	LOC100041578 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins

name	EG667172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins pseudo : _no_value

name	Gpr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14738 MGI:101909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Usp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22217 MGI:1270128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700041I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73273 MGI:1920523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rpl21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19933 MGI:1278340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasl11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68895 MGI:1916145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC627218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Gtf3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66596 MGI:1913846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtif3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76366 MGI:1923616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lnx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140887 MGI:2155959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gsh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14842 MGI:95842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487458 GeneID:666311 MGI:3647079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666311 transcript_id : NM_001081431.1

name	EG622127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254740 GeneID:622127 MGI:3646373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 25 Proteins product : predicted gene, EG622127 transcript_id : XM_001473095.1

name	Cyp3a16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681116 GeneID:13114 MGI:106099
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 16 transcript_id : NM_007820.1

name	LOC100041375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254743 GeneID:100041375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 37 Proteins product : similar to cytochrome P450 transcript_id : XM_001476442.1

name	Cyp3a41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802389 GeneID:53973 MGI:1858451
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 41 transcript_id : NM_017396.2

name	Cyp3a44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130400 GeneID:337924 MGI:2449818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 44 transcript_id : NM_177380.3

name	Cyp3a11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131163 GeneID:13112 MGI:88609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 11 transcript_id : NM_007818.3

name	Cyp3a25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469130 GeneID:56388 MGI:1930638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 25 transcript_id : NM_019792.1

name	LOC100041449 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254753 GeneID:100041449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 24 Proteins product : similar to cytochrome P450IIIA25 transcript_id : XM_001476549.1

name	LOC433961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94375847 GeneID:433961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : hypothetical LOC433961 transcript_id : XM_485697.4

name	EG622306 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375836 GeneID:622306 MGI:3643357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 3 Proteins product : predicted gene, EG622306 transcript_id : XM_886734.2

name	1700001J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606116 GeneID:69282 MGI:1916532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001J03 gene transcript_id : NM_001008547.1

name	Rnf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803555 GeneID:74132 MGI:1921382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein (C3H2C3 type) 6 transcript_id : NM_028774.2

name	Cdk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611229 GeneID:264064 MGI:1196224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase 8 transcript_id : NM_153599.3

name	Wasf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130090 GeneID:245880 MGI:2658986
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS protein family, member 3 transcript_id : NM_145155.2

name	LOC623198 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254755 GeneID:623198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : hypothetical LOC623198 transcript_id : XM_001476794.1

name	LOC622924 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254757 GeneID:622924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins product : hypothetical LOC622924 transcript_id : XM_001476811.1

name	4930449I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360372 GeneID:67410 MGI:1914660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930449I24 gene transcript_id : NM_026136.2

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254759 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : hypothetical protein LOC100041548, transcript variant 1 transcript_id : XM_001476853.1

name	LOC100041548 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254761 GeneID:100041548
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041548, transcript variant 2 transcript_id : XM_001476864.1

name	LOC100041554 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254763 GeneID:100041554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 2 Proteins product : hypothetical protein LOC100041554 transcript_id : XM_001476873.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254765 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 3 Proteins product : hypothetical protein LOC100041566, transcript variant 1 transcript_id : XM_001476887.1

name	LOC100041566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254767 GeneID:100041566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : hypothetical protein LOC100041566, transcript variant 2 transcript_id : XM_001476901.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254769 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 3 Proteins product : hypothetical protein LOC100041578, transcript variant 1 transcript_id : XM_001476922.1

name	LOC100041578 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254771 GeneID:100041578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : hypothetical protein LOC100041578, transcript variant 2 transcript_id : XM_001476941.1

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91982768 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_001010941.2

name	Gpr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331127 GeneID:14738 MGI:101909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 12 transcript_id : NM_008151.3

name	Usp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130069 GeneID:22217 MGI:1270128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 12 transcript_id : NM_011669.3

name	1700041I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254773 GeneID:73273 MGI:1920523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700041I07 gene transcript_id : XM_001477033.1

name	Rpl21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366462 GeneID:19933 MGI:1278340
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L21 transcript_id : NM_019647.4

name	Rasl11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625727 GeneID:68895 MGI:1916145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 11, member A transcript_id : NM_026864.1

name	Gtf3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345515 GeneID:66596 MGI:1913846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor III A transcript_id : NM_025652.2

name	Mtif3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367401 GeneID:76366 MGI:1923616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial translational initiation factor 3 transcript_id : NM_029581.3

name	Lnx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328410 GeneID:140887 MGI:2155959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligand of numb-protein X 2 transcript_id : NM_080795.3

name	Rpo1-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677790 GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-3 transcript_id : NM_009087.1

name	Rpo1-3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362039 GeneID:20018 MGI:108403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-3 transcript_id : NM_181730.3

name	Gsh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130916 GeneID:14842 MGI:95842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : genomic screened homeo box 1 transcript_id : NM_008178.2

name	EG666311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487459 GeneID:666311 MGI:3647079
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : predicted gene, EG666311 protein_id : NP_001074900.1

name	EG622127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254741 GeneID:622127 MGI:3646373
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001473145.1

name	Cyp3a16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681117 CCDS:CCDS19862.1 GeneID:13114 MGI:106099
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a16 product : cytochrome P450, family 3, subfamily a, polypeptide 16 protein_id : NP_031846.1

name	LOC100041375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254744 GeneID:100041375
definition	codon_start : 1 product : similar to cytochrome P450 protein_id : XP_001476492.1

name	Cyp3a41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393235 CCDS:CCDS19863.1 GeneID:53973 MGI:1858451
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, steroid inducible 3a41 product : cytochrome P450, family 3, subfamily a, polypeptide 41 protein_id : NP_059092.1

name	Cyp3a44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893549 CCDS:CCDS19864.1 GeneID:337924 MGI:2449818
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 3a44 product : cytochrome P450, family 3, subfamily a, polypeptide 44 protein_id : NP_796354.1

name	Cyp3a11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681113 CCDS:CCDS19865.1 GeneID:13112 MGI:88609
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, steroid inducible 3a11 product : cytochrome P450, family 3, subfamily a, polypeptide 11 protein_id : NP_031844.1

name	Cyp3a25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469131 CCDS:CCDS19866.1 GeneID:56388 MGI:1930638
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 3a25 product : cytochrome P450, family 3, subfamily a, polypeptide 25 protein_id : NP_062766.1

name	LOC100041449 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254754 GeneID:100041449
definition	codon_start : 1 product : similar to cytochrome P450IIIA25 protein_id : XP_001476599.1

name	LOC433961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82899820 GeneID:433961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485697.3

name	EG622306 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899822 GeneID:622306 MGI:3643357
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891827.1

name	1700001J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606117 GeneID:69282 MGI:1916532
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69282 protein_id : NP_001008547.1

name	Rnf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311909 CCDS:CCDS19868.1 GeneID:74132 MGI:1921382
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0030517 - negative regulation of axon extension [Evidence IGI] [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IC]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 product : ring finger protein (C3H2C3 type) 6 protein_id : NP_083050.1

name	Cdk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31652272 CCDS:CCDS19869.1 GeneID:264064 MGI:1196224
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004693 - cyclin-dependent protein kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase 8 protein_id : NP_705827.2

name	Wasf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553113 CCDS:CCDS19870.1 GeneID:245880 MGI:2658986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WAS protein family, member 3 protein_id : NP_660137.1

name	LOC623198 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254756 GeneID:623198
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476844.1

name	LOC622924 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254758 GeneID:622924
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476861.1

name	4930449I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385646 GeneID:67410 MGI:1914660
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67410 protein_id : NP_080412.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254760 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476903.1

name	LOC100041548 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254762 GeneID:100041548
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476914.1

name	LOC100041554 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254764 GeneID:100041554
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476923.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254766 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476937.1

name	LOC100041566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254768 GeneID:100041566
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476951.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254770 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476972.1

name	LOC100041578 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254772 GeneID:100041578
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476991.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331129 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_001010941.1

name	Gpr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680061 CCDS:CCDS19871.1 GeneID:14738 MGI:101909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016526 - G-protein coupled receptor activity, unknown ligand [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G-protein coupled receptor 12 protein_id : NP_032177.1

name	Usp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328057 GeneID:22217 MGI:1270128
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin hydrolyzing enzyme 1 product : ubiquitin specific protease 12 protein_id : NP_035799.1

name	1700041I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254774 GeneID:73273 MGI:1920523
definition	codon_start : 1 product : hypothetical protein LOC73273 protein_id : XP_001477083.1

name	Rpl21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560385 CCDS:CCDS19872.1 GeneID:19933 MGI:1278340
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L21 protein_id : NP_062621.2

name	Rasl11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625728 GeneID:68895 MGI:1916145
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-like family 11 member A protein_id : NP_081140.1

name	Gtf3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532949 CCDS:CCDS19873.1 GeneID:66596 MGI:1913846
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : general transcription factor III A protein_id : NP_079928.1

name	Mtif3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313176 CCDS:CCDS19874.1 GeneID:76366 MGI:1923616
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2810012L14 protein_id : NP_083857.1

name	Lnx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328411 CCDS:CCDS19875.1 GeneID:140887 MGI:2155959
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0030165 - PDZ domain binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051260 - protein homooligomerization [Evidence IDA] codon_start : 1 exception : mismatches in translation product : PDZ domain containing ring finger 1 protein_id : NP_542985.3

name	Rpo1-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189421 GeneID:20018 MGI:108403
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; snoRNA MBI-50 product : RNA polymerase 1-3 isoform 2 protein_id : NP_859419.1

name	Rpo1-3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677791 CCDS:CCDS19876.1 GeneID:20018 MGI:108403
definition	GO_component : GO:0005736 - DNA-directed RNA polymerase I complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; snoRNA MBI-50 product : RNA polymerase 1-3 isoform 1 protein_id : NP_033113.1

name	Gsh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680113 CCDS:CCDS19877.1 GeneID:14842 MGI:95842
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : genomic screened homeo box 1 protein_id : NP_032204.1

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 2 pseudo : _no_value

name	LOC677270 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677270
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 1 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 2 pseudo : _no_value

name	LOC100039566 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039566
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 15 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 14 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 13 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 12 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 11 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 10 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 9 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 8 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 7 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 6 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 5 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 4 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 3 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 2 pseudo : _no_value

name	LOC667065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667065
definition	number : 1 pseudo : _no_value

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 2 pseudo : _no_value

name	LOC667098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667098
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 1 pseudo : _no_value

name	LOC667104 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667104
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 2 pseudo : _no_value

name	LOC667121 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667121
definition	number : 1 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 1 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 2 pseudo : _no_value

name	LOC100039699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039699
definition	number : 3 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 1 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 2 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 3 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 4 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 5 pseudo : _no_value

name	LOC627218 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627218
definition	number : 6 pseudo : _no_value

name	EG667172 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94375848 GeneID:667172 MGI:3645114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 ESTs, 4 Proteins product : predicted gene, EG667172 pseudo : _no_value transcript_id : XR_001988.1

clone name	MSMg01-309O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-343J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335E12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-534E20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-132A04.T7 (MSMg01no132_a04.b1)	MSMg01-132A04.TJ (MSMg01no132_a04.g1)
ACC	AG339362	AG339363
length	702	696
length of high quality (start - end)	629 (74 - 702)	620 (71 - 690)
definition	CHROMAT_FILE: MSMg01no132_a04.b1 PHD_FILE: MSMg01no132_a04.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:46:24 2005	CHROMAT_FILE: MSMg01no132_a04.g1 PHD_FILE: MSMg01no132_a04.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:46:24 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NAAATCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCG CGGAATTCCAGGATAGTTCCGGCTACACAGAGAAACCCTGTCTCGAAAGA AAAAAAATTGGGAATTTTTCTCCTGTGATTTTATTGGAAAGGTTTTCTAT GCTTTTGACTTGGAATTCATTTCTTCTCCCCCACCCCCACCCTCACTGTC TGTAATTTATAGTTTCAATTTCTATGATGGTTTCCAAAGATCCTACAAGT CTGCTCATGCTTTTTTTTTTTTTTATTTTTCGTTTCTAGTTTTCTTTGAG TGGGTGGTCCAATTCCTCTACCCTGCCTTCAAGTCCTGATATTACCGTAG TCTTGTCCAAATGATCTACTCTGATTGTGAGGCTTCCCACCGAGCTTTTA TTTAACTACCTCTTCATTGCCAGCTTCATTTCAGATTAGATTTTGTTTAC TCTTCTGTCTCTTTTTTAGATTCTATTCTCCTTTGTTTCATTTAGCTGTG TGATTGTGTCTTCTGGGGCTTCTGTTTATTCCTGCTGCCACCAGTTCATT CAAGTATTTATCATTGTTCTCTTGAAATTCTTTTTGTTTTGTTTTGTTTT TTTTCAAGACATTATCTCTTTAAAATCTTTGAACTCTTTGATTGTGTTTA ATTCTTTAGACATTTGTGCCTGAAAATGGTTCTCCTTGGAACCATTGCAC TG	CGATGAAGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXCTGATCTTTCCAAACTTTTATCATGAATGG GTGTTGGATCTTGTCAAATGCTTTTTCTGCATCTAACGAGATGATCATGT GGTTTTTGTCTTTGAGTTTGTTTATATAATGGATTACATTGATGGATTTT CGTATATTAAACCATCCCTGCATCCCTGGAATAAAACCTACTTGGTCAGG ATGGATGATTGCTTTAATGTGTTCTTGGATTCGGTTAGCGAGAATTTTAT TAAGGATTTTTGCATCGATATTCATAAGAGAAATTGGTCTGAAGTTCTCT ATCTTTGTTGGATCTTTCTGTGGTTTAGGTATCAGAGTAATAGTGGCTTC ATAAAATGAGTTGGGTAGAGTACCTTCTACTTCTATCTTGTGAAATAGTT TGTGCAGAACTGGAATTAGATCTTCTTTGAAGGTCTGATAGAACTCTGCA CTAAACCCATCTGGTCCTGGGCTTTTTTTGGTTGGGAGACTATTAATAAC TGCTTCTATTTCTTTAGGGGATATGGGACTGTTTAGAAGGTCAACTTGAT CCTGATTCAACTTTGGTACCTGGTATCTGTCCAGAAATTTGTCCATTTCG TCCAGGTTTTCCAGTTTTGTTGAGTATAAGCTTTTGTAGAAGGATC
quality values	Open. Hide. 0 3 6 6 8 8 8 8 8 10 8 15 28 24 30 30 30 27 19 19 8 8 8 19 19 33 43 37 27 20 24 24 24 25 28 22 13 11 12 11 9 9 12 10 10 10 16 17 21 31 32 32 36 36 36 44 48 31 31 31 31 31 33 22 19 9 9 6 8 6 8 8 8 21 25 33 31 31 31 31 31 53 48 57 48 48 47 47 47 53 47 47 57 48 48 57 57 57 57 57 68 68 68 68 68 68 42 42 42 42 54 50 68 68 68 68 53 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 51 50 50 50 50 50 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 68 57 57 57 57 57 50 50 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 62 62 62 52 52 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 52 52 62 62 43 43 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 23 39 43 62 62 52 52 62 62 62 62 62 62 62 52 52 52 52 52 52 52 52 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 52 52 43 62 43 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 31 35 35 43 43 31 31 31 44 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 39 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 57 59 59 59 59 57 57 52 57 52 59 57 57 57 57 57 57 59 59 57 57 57 52 43 57 43 52 43 44 44 59 57 44 44 43 52 52 57 59 59 59 59 59 57 52 52 57 57 52 54 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 57 57 57 59 59 59 59 57 57 57 57 57 57 44 43 41 41 41 50 50 57 57 57 57 57 54 54 54 57 59 59 59 57 57 57 59 57 43 43 43 57 57 48 48 48 59 59 68 59 44 44 37 37 35 39 39 43 43 48 44 59 47 47 43 43 41 46 46 48 53 46 43 43 43 43 59 59 59 59 47 43 35 39 39 59 43 57 48 37 37 28 28 28 37 37 48 48 39 39 36 39 37 28 28 13 13 13 28 28 39 37 59 31 31 31 31 31 41 41 47 37 37 39 38 31 30 38 23 32 32 36 36 30 30 26 31 39 32 31 31 35 39 39 47 39 26 26 18 14	Open. Hide. 8 8 8 11 8 8 8 8 17 10 8 8 10 19 22 33 33 33 48 26 23 11 10 10 26 32 34 23 23 14 13 9 8 8 8 8 11 12 19 19 14 21 26 21 21 10 11 11 24 21 36 38 42 21 21 11 13 21 23 31 33 24 27 32 29 42 42 48 50 41 42 42 51 51 50 68 68 35 32 17 17 15 32 32 68 68 68 68 68 51 50 48 48 48 48 57 57 57 46 48 41 47 48 48 50 48 50 50 50 50 50 57 50 50 50 50 50 50 57 57 57 57 59 59 68 57 57 46 46 46 48 50 50 57 57 59 68 68 68 50 50 50 50 50 50 50 50 68 68 50 50 50 50 68 50 50 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 41 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 52 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 68 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 43 39 39 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 57 43 43 42 43 43 59 59 59 59 57 57 57 57 57 57 59 59 68 68 59 59 57 57 57 57 57 68 59 59 57 57 59 57 68 57 57 57 57 57 57 57 59 54 47 57 59 59 59 59 59 68 68 57 57 57 57 57 57 44 44 44 44 57 57 54 54 59 59 57 54 54 48 48 48 48 57 57 57 57 48 54 54 43 43 48 48 48 59 59 54 54 57 59 59 59 59 59 59 59 57 57 59 59 59 57 57 59 59 59 59 59 59 59 59 59 59 59 59 39 37 37 39 39 39 43 59 40 41 41 47 33 33 32 32 32 32 39 44 44 59 59 47 47 48 48 48 48 50 48 48 48 48 48 43 43 48 48 48 43 43 25 33 33 43 40 43 43 43 43 46 57 57 46 46 43 43 43 59 59 54 54 54 54 48 48 57 57 57 57 57 57 57 57 57 48 33 33 30 30 30 37 41 59 59 46 39 37 30 37 37 32 31 34 39 39 47 47 46 46 40 39 37 36 26 27 18 22 24 27 30 37 32 31 31 37 37 37 41 36 36 36 39 40 41 36 37 37 37 43 41 37 31 37 32 31 36 39 39 32 28 28 39 37 32 32 23 28 28 29 22 28 37 37 37 31 29 25 14 14 19 28 16 20 24 26 20

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no132_a04.b1 MSMg01no132_a04.b1 CHROMAT_FILE:
MSMg01no132_a04.b1 PHD_FILE: MSMg01no132_a04.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:46:24 2005
         (629 letters)



>mm_chr5_147023691_147024719
          Length = 1029

 Score =  801 bits (414), Expect = 0.0
 Identities = 420/422 (99%)
 Strand = Plus / Minus

                                                                        
Query: 208  cgtttctagttttctttgagtgggtggtccaattcctctaccctgccttcaagtcctgat 267
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1029 cgtttctagttttctttgagtgggtggtccaattcctctaccctgccttcaagtcctgat 970

                                                                        
Query: 268  attaccgtagtcttgtccaaatgatctactctgattgtgaggcttcccaccgagctttta 327
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 969  attaccgtagtcttgtccaaatgatctactctgattgtgaggcttcccaccgagctttta 910

                                                                        
Query: 328  tttaactacctcttcattgccagcttcatttcagattagattttgtttactcttctgtct 387
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 909  tttaactacctcttcattgccagcttcatttcagattagattttgtttactcttctgtct 850

                                                                        
Query: 388  cttttttagattctattctcctttgtttcatttagctgtgtgattgtgtcttctggggct 447
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 849  cttttttagattctattctcctttgtttcatttagctgtgtgattgtgtcttctggggct 790

                                                                        
Query: 448  tctgtttattcctgctgccaccagttcattcaagtatttatcattgttctcttgaaattc 507
            |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||
Sbjct: 789  tctgtttattcctgctgctaccagttcattcaagtatttatcattgtcctcttgaaattc 730

                                                                        
Query: 508  tttttgttttgttttgttttttttcaagacattatctctttaaaatctttgaactctttg 567
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 729  tttttgttttgttttgttttttttcaagacattatctctttaaaatctttgaactctttg 670

                                                                        
Query: 568  attgtgtttaattctttagacatttgtgcctgaaaatggttctccttggaaccattgcac 627
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 669  attgtgtttaattctttagacatttgtgcctgaaaatggttctccttggaaccattgcac 610

              
Query: 628  tg 629
            ||
Sbjct: 609  tg 608


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 30
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 629
Length of database: 1029
Length adjustment: 10
Effective length of query: 619
Effective length of database: 1019
Effective search space:   630761
Effective search space used:   630761
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information