MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-373L11
Chromosome	5 (Build37)
Map Location	143,675,894 - 143,676,197
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Sdk1, LOC666727, Foxk1, C330006K01Rik, D930005D10Rik, Papolb, Mmd2, Wipi2, Slc29a4, Tnrc18, LOC100038954, LOC100041004, LOC100038972, LOC100038984, LOC100042525, LOC100038888, Zfp469, LOC666788, Fbxl18, D430018E03Rik, LOC100042558, Actb
Downstream gene	Fscn1, 2810055G22Rik, LOC667809, Olfr718-ps1, LOC640324, LOC100042605, Rbak, 4933411G11Rik, Spdyb, Zfp12, Zfp316, Gm792, E130309D02Rik, Zdhhc4, Grid2ip, Kdelr2, LOC231869, LOC670671, Daglb, Rac1, 2810453I06Rik, Pscd3, Usp42, Eif2ak1, 4921520G13Rik, Jtv1, Pms2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sdk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330222 MGI:2444413
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Foxk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17425 MGI:1347488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330006K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231855 MGI:1924908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930005D10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231858 MGI:2443088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Papolb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56522 MGI:1932115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75104 MGI:1922354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wipi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74781 MGI:1923831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc29a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243328 MGI:2385330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381742 MGI:3648294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100038954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041004 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 89 ESTs, 3 Proteins

name	LOC100038972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100038984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100042525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100038888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231861 MGI:2448535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 4 Proteins pseudo : _no_value

name	Fbxl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231863 MGI:2444450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430018E03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442800 MGI:3045245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Actb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11461 MGI:87904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fscn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14086 MGI:1352745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810055G22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108086 MGI:1344349
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	Olfr718-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258006 MGI:3030552
definition	gene_synonym : MOR0-10P note : olfactory receptor 718, pseudogene 1 pseudo : _no_value

name	LOC640324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins pseudo : _no_value

name	LOC100042605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 ESTs

name	Rbak (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57782 MGI:1927369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4933411G11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330228 MGI:3612701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spdyb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74673 MGI:1921923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231866 MGI:99157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54201 MGI:1860402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330230 MGI:2685638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins

name	E130309D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231868 MGI:2442621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72881 MGI:1920131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grid2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170935 MGI:2176213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kdelr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66913 MGI:1914163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC231869 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:231869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 141 ESTs, 28 Proteins pseudo : _no_value

name	LOC670671 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Daglb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231871 MGI:2442032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19353 MGI:97845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810453I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67238 MGI:1914488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pscd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19159 MGI:1335107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76800 MGI:1924050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2ak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15467 MGI:1353448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921520G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66729 MGI:1913979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jtv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231872 MGI:2385237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pms2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18861 MGI:104288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802600 GeneID:330222 MGI:2444413
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sidekick homolog 1 (chicken) transcript_id : NM_177879.4

name	Foxk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546825 GeneID:17425 MGI:1347488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box K1 transcript_id : NM_199068.2

name	C330006K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546848 GeneID:231855 MGI:1924908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330006K01 gene transcript_id : NM_172725.2

name	D930005D10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82546886 GeneID:231858 MGI:2443088
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D930005D10 gene transcript_id : NM_178702.3

name	Papolb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78000206 GeneID:56522 MGI:1932115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (A) polymerase beta (testis specific) transcript_id : NM_019943.2

name	Mmd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379242 GeneID:75104 MGI:1922354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monocyte to macrophage differentiation-associated 2 transcript_id : NM_175217.5

name	Wipi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350392 GeneID:74781 MGI:1923831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain, phosphoinositide interacting 2 transcript_id : NM_178398.3

name	Slc29a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031958 GeneID:243328 MGI:2385330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 29 (nucleoside transporters), member 4 transcript_id : NM_146257.2

name	Tnrc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254658 GeneID:381742 MGI:3648294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : trinucleotide repeat containing 18 transcript_id : XM_355727.5

name	LOC100038954 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254664 GeneID:100038954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100038954 transcript_id : XM_001471975.1

name	LOC100041004 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254668 GeneID:100041004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 89 ESTs, 3 Proteins product : similar to pS2m transcript_id : XM_001475697.1

name	LOC100038972 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254666 GeneID:100038972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to TMPRSS3 protein transcript_id : XM_001472013.1

name	LOC100038984 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254674 GeneID:100038984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to testis/prostate/placenta-expressed protein, isoform 2 transcript_id : XM_001472041.1

name	LOC100038888 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254671 GeneID:100038888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038888 transcript_id : XM_001471803.1

name	Zfp469 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342462 GeneID:231861 MGI:2448535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 469 transcript_id : NM_178242.2

name	Fbxl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801875 GeneID:231863 MGI:2444450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 18 transcript_id : NM_001033312.2

name	LOC100042558 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254679 GeneID:100042558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042558 transcript_id : XM_001478496.1

name	Actb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378181 GeneID:11461 MGI:87904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, beta, cytoplasmic transcript_id : NM_007393.2

name	Fscn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680347 GeneID:14086 MGI:1352745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fascin homolog 1, actin bundling protein (Strongylocentrotus purpuratus) transcript_id : NM_007984.2

name	2810055G22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391096 GeneID:108086 MGI:1344349
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810055G22 gene transcript_id : NM_080561.3

name	LOC100042605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254682 GeneID:100042605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 55 ESTs product : hypothetical protein LOC100042605, transcript variant 1 transcript_id : XM_001478588.1

name	LOC100042605 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254684 GeneID:100042605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs product : hypothetical protein LOC100042605, transcript variant 2 transcript_id : XM_001478596.1

name	Rbak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865970 GeneID:57782 MGI:1927369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RB-associated KRAB repressor transcript_id : NM_001045482.1

name	Rbak (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865969 GeneID:57782 MGI:1927369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RB-associated KRAB repressor transcript_id : NM_021326.2

name	4933411G11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368861 GeneID:330228 MGI:3612701
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933411G11Rik gene transcript_id : NM_177880.3

name	Spdyb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676390 GeneID:74673 MGI:1921923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : speedy homolog B (Drosophila) transcript_id : NM_029048.3

name	Zfp12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866020 GeneID:231866 MGI:99157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 12 transcript_id : NM_177681.3

name	Zfp316 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227201 GeneID:54201 MGI:1860402
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 316 transcript_id : NM_017467.2

name	Gm792 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254677 GeneID:330230 MGI:2685638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : gene model 792, (NCBI) transcript_id : XM_001472438.1

name	E130309D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354463 GeneID:231868 MGI:2442621
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130309D02 gene transcript_id : NM_172726.3

name	Zdhhc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802824 GeneID:72881 MGI:1920131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 4 transcript_id : NM_028379.2

name	Grid2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19111165 GeneID:170935 MGI:2176213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 transcript_id : NM_133355.1

name	Kdelr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372790 GeneID:66913 MGI:1914163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 transcript_id : NM_025841.2

name	Daglb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032008 GeneID:231871 MGI:2442032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol lipase, beta transcript_id : NM_144915.3

name	Rac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676397 GeneID:19353 MGI:97845
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-related C3 botulinum substrate 1 transcript_id : NM_009007.2

name	2810453I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802312 GeneID:67238 MGI:1914488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810453I06 gene transcript_id : NM_133703.3

name	2810453I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313057 GeneID:67238 MGI:1914488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810453I06 gene transcript_id : NM_026050.1

name	Pscd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802529 GeneID:19159 MGI:1335107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled-coil domains 3 transcript_id : NM_011182.3

name	Usp42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686115 GeneID:76800 MGI:1924050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 42 transcript_id : NM_029749.2

name	Eif2ak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248524 GeneID:15467 MGI:1353448
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 2 alpha kinase 1 transcript_id : NM_013557.2

name	4921520G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349436 GeneID:66729 MGI:1913979
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921520G13 gene transcript_id : NM_025732.2

name	Jtv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122694 GeneID:231872 MGI:2385237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : JTV1 gene transcript_id : NM_146165.1

name	Pms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583909 GeneID:18861 MGI:104288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : postmeiotic segregation increased 2 (S. cerevisiae) transcript_id : NM_008886.2

name	Sdk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979624 GeneID:330222 MGI:2444413
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : sidekick 1 protein_id : NP_808547.2

name	Foxk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546826 CCDS:CCDS19826.1 GeneID:17425 MGI:1347488
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006777 - Mo-molybdopterin cofactor biosynthesis [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048637 - skeletal muscle development [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : myocyte nuclear factor product : forkhead box K1 protein_id : NP_951031.2

name	C330006K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546849 GeneID:231855 MGI:1924908
definition	codon_start : 1 product : hypothetical protein LOC231855 protein_id : NP_766313.2

name	D930005D10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82546887 CCDS:CCDS19827.1 GeneID:231858 MGI:2443088
definition	GO_component : GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC231858 protein_id : NP_848817.2

name	Papolb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910588 GeneID:56522 MGI:1932115
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0004652 - polynucleotide adenylyltransferase activity [Evidence ISS] [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : testis-specific poly(A) polymerase product : poly (A) polymerase beta (testis specific) protein_id : NP_064327.1

name	Mmd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202005 GeneID:75104 MGI:1922354
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IEA] codon_start : 1 product : monocyte-to-macrophage differentiation factor 2 protein_id : NP_780426.1

name	Wipi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409972 CCDS:CCDS19828.1 GeneID:74781 MGI:1923831
definition	codon_start : 1 product : WD repeat domain, phosphoinositide interacting 2 protein_id : NP_848485.1

name	Slc29a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122849 GeneID:243328 MGI:2385330
definition	codon_start : 1 product : solute carrier family 29 (nucleoside transporters), member 4 protein_id : NP_666369.1

name	Tnrc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254659 GeneID:381742 MGI:3648294
definition	codon_start : 1 product : similar to Tnrc18 protein protein_id : XP_355727.5

name	LOC100038954 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254665 GeneID:100038954
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472025.1

name	LOC100041004 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254669 GeneID:100041004
definition	codon_start : 1 product : similar to pS2m protein_id : XP_001475747.1

name	LOC100038972 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254667 GeneID:100038972
definition	codon_start : 1 product : similar to TMPRSS3 protein protein_id : XP_001472063.1

name	LOC100038984 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254675 GeneID:100038984
definition	codon_start : 1 product : similar to testis/prostate/placenta-expressed protein, isoform 2 protein_id : XP_001472091.1

name	LOC100038888 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254672 GeneID:100038888
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471853.1

name	Zfp469 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142681 CCDS:CCDS19830.1 GeneID:231861 MGI:2448535
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 469 protein_id : NP_839973.1

name	Fbxl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677482 CCDS:CCDS19831.1 GeneID:231863 MGI:2444450
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : F-box and leucine-rich repeat protein 18 protein_id : NP_001028484.1

name	LOC100042558 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254680 GeneID:100042558
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478546.1

name	Actb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671509 CCDS:CCDS19833.1 GeneID:11461 MGI:87904
definition	GO_component : GO:0005884 - actin filament [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : melanoma X-actin; A-X actin-like protein product : actin, beta, cytoplasmic protein_id : NP_031419.1

name	Fscn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680348 CCDS:CCDS19834.1 GeneID:14086 MGI:1352745
definition	GO_component : GO:0030175 - filopodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence IEA] codon_start : 1 note : fascin 1 product : fascin homolog 1, actin bundling protein protein_id : NP_032010.2

name	2810055G22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358407 GeneID:108086 MGI:1344349
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : E3 ubiquitin ligase product : ubiquitin conjugating enzyme 7 interacting protein 1 protein_id : NP_542128.2

name	LOC100042605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254683 GeneID:100042605
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001478638.1

name	LOC100042605 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254685 GeneID:100042605
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001478646.1

name	Rbak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865971 GeneID:57782 MGI:1927369
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RB-associated KRAB repressor protein_id : NP_001038947.1

name	Rbak (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789126 CCDS:CCDS19835.1 GeneID:57782 MGI:1927369
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RB-associated KRAB repressor protein_id : NP_067301.1

name	4933411G11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244494 GeneID:330228 MGI:3612701
definition	codon_start : 1 product : hypothetical protein LOC330228 protein_id : NP_808548.1

name	Spdyb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676391 GeneID:74673 MGI:1921923
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0019901 - protein kinase binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045737 - positive regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 note : ringo B; speedy/ringo; speedy homolog 2 product : speedy B protein_id : NP_083324.3

name	Zfp12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244112 CCDS:CCDS19837.1 GeneID:231866 MGI:99157
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 12 protein_id : NP_808349.1

name	Zfp316 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227202 CCDS:CCDS19838.1 GeneID:54201 MGI:1860402
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : kruppel-related zinc finger protein; transcription factor MZF-3 product : zinc finger protein 316 protein_id : NP_059495.2

name	Gm792 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254678 GeneID:330230 MGI:2685638
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472488.1

name	E130309D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982102 CCDS:CCDS19839.1 GeneID:231868 MGI:2442621
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC231868 protein_id : NP_766314.2

name	Zdhhc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312169 CCDS:CCDS19840.1 GeneID:72881 MGI:1920131
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 4 protein_id : NP_082655.1

name	Grid2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111166 CCDS:CCDS19841.1 GeneID:170935 MGI:2176213
definition	GO_component : GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence TAS] codon_start : 1 note : GluR-delta2 philic-protein; delphilin; L-delphilin product : glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 protein_id : NP_579933.1

name	Kdelr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385318 GeneID:66913 MGI:1914163
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046923 - ER retention sequence binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006621 - protein retention in ER [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 protein_id : NP_080117.1

name	Daglb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559956 GeneID:231871 MGI:2442032
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 product : diacylglycerol lipase, beta protein_id : NP_659164.2

name	Rac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592934 CCDS:CCDS19843.1 GeneID:19353 MGI:97845
definition	GO_component : GO:0042995 - cell projection [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IDA]; GO:0003924 - GTPase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IDA]; GO:0016477 - cell migration [Evidence IDA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0016358 - dendrite development [Evidence IDA]; GO:0006897 - endocytosis [Evidence IDA]; GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence TAS] [Evidence IDA]; GO:0030838 - positive regulation of actin filament polymerization [Evidence IDA]; GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IMP]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 product : RAS-related C3 botulinum substrate 1 protein_id : NP_033033.1

name	2810453I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313058 GeneID:67238 MGI:1914488
definition	codon_start : 1 exception : mismatches in translation note : STAT3-interacting protein as a repressor product : hypothetical protein LOC67238 protein_id : NP_080326.1

name	2810453I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29135344 GeneID:67238 MGI:1914488
definition	codon_start : 1 exception : mismatches in translation note : STAT3-interacting protein as a repressor product : hypothetical protein LOC67238 protein_id : NP_598464.2

name	Pscd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981544 CCDS:CCDS19845.1 GeneID:19159 MGI:1335107
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IPI] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005547 - phosphatidylinositol-3,4,5-triphosphate binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0045785 - positive regulation of cell adhesion [Evidence IDA]; GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytohesin 3 product : pleckstrin homology, Sec7 and coiled-coil domains 3 protein_id : NP_035312.2

name	Usp42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116686116 GeneID:76800 MGI:1924050
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 42 protein_id : NP_084025.2

name	Eif2ak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248525 GeneID:15467 MGI:1353448
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004694 - eukaryotic translation initiation factor 2alpha kinase activity [Evidence ISS]; GO:0020037 - heme binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0046986 - negative regulation of hemoglobin biosynthesis [Evidence IDA]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045993 - negative regulation of translational initiation by iron [Evidence ISS]; GO:0046777 - protein amino acid autophosphorylation [Evidence IEP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IMP]; GO:0009605 - response to external stimulus [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : heme-regulated inhibitor product : eukaryotic translation initiation factor 2 alpha kinase 1 protein_id : NP_038585.2

name	4921520G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385192 GeneID:66729 MGI:1913979
definition	codon_start : 1 product : hypothetical protein LOC66729 protein_id : NP_080008.1

name	Jtv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122695 GeneID:231872 MGI:2385237
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : JTV1 protein_id : NP_666277.1

name	Pms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583910 GeneID:18861 MGI:104288
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0007126 - meiosis [Evidence TAS]; GO:0006298 - mismatch repair [Evidence ISS] [Evidence TAS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : mismatch repair; DNA mismatch repair product : postmeiotic segregation increased 2 protein_id : NP_032912.2

name	LOC666727 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666727
definition	number : 1 pseudo : _no_value

name	LOC666727 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666727
definition	number : 2 pseudo : _no_value

name	LOC100042525 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042525
definition	number : 1 pseudo : _no_value

name	LOC640324 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640324
definition	number : 2 pseudo : _no_value

name	LOC640324 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640324
definition	number : 1 pseudo : _no_value

name	LOC670671 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670671
definition	number : 1 pseudo : _no_value

name	LOC666788 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254676 GeneID:666788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs, 4 Proteins product : similar to Mitochondrial ribosomal protein L12 pseudo : _no_value transcript_id : XR_030621.1

name	D430018E03Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254673 GeneID:442800 MGI:3045245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430018E03 gene transcript_id : XR_035135.1

name	LOC667809 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254681 GeneID:667809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to rat ribosomal protein L9 homologue pseudo : _no_value transcript_id : XR_033764.1

name	LOC231869 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254686 GeneID:231869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 141 ESTs, 28 Proteins product : similar to cyclin B1 pseudo : _no_value transcript_id : XR_033857.1

clone name	MSMg01-536B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-268O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-201O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-198H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054I17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-373L11.T7 (MSMg01no373_l11.b1)	MSMg01-373L11.TJ (MSMg01no373_l11.g1)
ACC	AG479680	AG479681
length	723	722
length of high quality (start - end)	415 (37 - 451)	243 (56 - 298)
definition	CHROMAT_FILE: MSMg01no373_l11.b1 PHD_FILE: MSMg01no373_l11.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:12:44 2005	CHROMAT_FILE: MSMg01no373_l11.g1 PHD_FILE: MSMg01no373_l11.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:12:44 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ATTCCAGAGATCCGNGGAATTCCAGAGATTTCGCCTGCCTCTGCCTCCTA AGACCTAGGACTCAAGGTGTGTCCTGCTCAGCCATGCAGCCTGCTGGGAC ATCTTGTTGGCTGCTTCTGTCTGAGCTGTTCTAGCTAATAGGCCACATCA GGTCTCCAAACAGTATTATTCCAGAAGATTCTTCGGCATCCTCCAGCTCT TACATTTTTTTCCCTTCTCTTTTCTGGTATGTTCTCTGACTTTTAGAAGG TGGGATGAGTCAGGCAGTGGTGGCGCATGCCTTTAATCTCTCTTTTATTT GGGAGGCAGAGGGCAGGTGGATCTCTGAGTTTGAGGCCAGCCTGGTCTAC AGAGTGAGTTCCAGGACAGCCACCTGGACAGAAACCCTGTCTCGAAAAAC AAAAAACAACAACAACTAAAAAGAAGGTGGGGTGGGAATTTGATATAGAT GTCTCATTTTTAAAAATACCTTACTATTTATTTTTATTCCGTGTGCACTG GCATTCCGCCTCCCTGCATGTCTGTGTGAAGGGGCCAGGTCCCCTGCAAC TGTATAGCTACCAATAATTACTTTTGTTTCTGTCTATTTTTCTTCTATAT TTTTGTACTTTATCTATTTCGCCCATGTCCCTTACTATTTACTTGCGTGG GGGGTGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGCCCATAATATAAAAA TNANTTTTTTTTGACCGGGGGGG	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXTTCCCGGTTACAGTCCCCAGTTCTGGTGACAATTTAGAGACATCT TCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCT TCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCTTCTCT TCTCTTCTCTTCTCTTCTCTCTCTCCCTCCCCTCCCCTCCCCTCCCCTCC TTTTCTCTTCTCTCTCTCTCTCTCTGTGTGTGTGTGTGCACATGCGCGTG TTTGTTTGGTGACAATTTAGAGACATATTCTCTCTCTCCCTGTGTGGCGT TGCTGTGTGTGAGCATGTGTGTGCGGTGTGCGCTTGTGTGTTCCACACCA ACAAGACAACCAATGTGCATTATGACTACAGCATCTTGTAACAACTAATC TGCCCCTAACATTTACTATATACTGGTTGGACGGAGAGAACCGGGAATCC AGCTGTTATCAGGCCCGCGTGGCGTAGGGAGGGCTAAAGAGAGGTGGGGG GATGCGAAGTGGGGTTTGGTGTTTGTATTAGTGATGGGTGACATACGTAG AGTACTTAACTTACGTAGAAAAAGCATGAATGAGAAGTTATTTAAATTAA AGAAAAGGGAAAGAGAAAGGAGGAAATGAAAAGTAGAGGGGGGGACGGGG GAAGAGGGTATGAGTGATCGGG
quality values	Open. Hide. 6 6 10 9 9 8 8 8 8 8 10 10 13 3 0 3 21 16 19 17 10 10 10 17 17 8 9 9 11 10 10 10 10 9 13 18 23 23 23 32 32 37 41 59 59 59 53 53 53 53 53 53 57 57 50 50 57 57 53 50 42 42 42 42 42 48 59 68 68 68 68 68 68 68 68 68 50 50 50 47 47 50 46 46 44 44 44 44 47 59 57 59 57 59 59 68 68 68 68 68 57 68 68 57 59 59 59 59 57 57 68 57 57 57 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 59 59 59 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 47 32 27 10 10 8 8 11 8 8 13 12 11 13 12 27 27 59 47 50 50 50 50 48 59 57 57 59 59 59 59 59 59 59 59 50 50 50 53 50 50 59 68 59 68 68 59 59 48 48 48 48 48 57 48 48 48 59 48 59 57 57 59 59 57 57 57 57 57 68 68 68 68 68 68 54 48 48 48 54 54 48 48 54 48 48 57 48 48 48 57 57 50 48 48 48 48 48 47 47 47 37 37 22 24 14 18 21 34 38 39 37 29 29 32 37 36 36 39 43 41 37 37 32 28 28 28 28 35 35 26 26 13 13 13 28 28 37 37 32 32 20 24 24 37 29 31 37 37 37 31 31 35 37 37 37 37 37 37 37 37 30 37 30 32 24 28 13 13 12 12 12 12 12 15 22 13 14 14 26 22 19 9 9 9 14 14 25 21 26 14 14 14 10 13 10 10 10 19 24 23 15 15 15 18 22 24 19 23 23 15 15 8 8 8 10 8 8 12 11 10 10 8 10 10 9 18 32 26 22 11 11 9 9 10 13 16 16 21 17 12 8 8 8 11 8 9 9 10 9 9 8 9 9 8 8 8 11 9 9 10 10 8 8 8 6 6 8 8 8 8 8 8 8 8 8 8 10 10 12 12 16 13 13 10 10 10 10 10 10 11 9 9 9 9 8 8 8 8 8 8 8 8 10 18 15 14 14 8 8 8 8 8 8 7 7 8 8 8 12 6 6 8 8 10 10 8 8 8 8 7 8 8 8 8 8 6 6 8 8 8 8 8 8 10 12 8 9 10 17 11 12 8 8 8 8 6 7 7 8 9 9 7 8 11 11 8 8 13 10 8 8 8 10 10 15 15 19 16 10 6 6 6 6 7 9 24 12 11 8 8 8 12 14 28 20 22 30 28 17 16 10 7 8 7 7 7 9 9 10 8 8 6 6 8 8 9 3 0 3 0 3 13 14 21 12 9 7 6 6 6 8 9 9 9 8 13 13 16 14	Open. Hide. 28 32 32 33 37 39 37 37 44 59 27 27 18 22 8 8 8 8 10 12 24 28 24 22 37 37 37 27 26 11 18 15 32 36 53 53 53 47 27 28 15 18 20 14 19 19 30 30 37 42 42 48 48 54 54 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 52 52 52 57 44 35 35 35 44 44 52 45 45 57 57 57 57 57 57 57 52 52 52 57 59 52 52 52 59 59 52 52 52 59 59 52 52 52 59 59 52 52 52 59 59 68 68 68 68 68 68 59 59 59 57 57 57 59 57 57 57 54 54 54 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 59 59 59 57 54 54 59 59 44 43 43 43 43 57 57 57 54 54 54 57 57 57 57 59 59 54 54 54 59 57 57 54 54 54 57 59 59 59 59 59 59 59 59 59 59 59 59 59 57 48 48 43 43 43 43 43 43 43 43 47 43 43 43 43 46 47 47 35 39 35 32 32 15 15 10 10 10 10 10 12 11 16 20 23 11 23 23 37 37 37 41 48 48 59 59 59 59 59 57 57 57 59 59 59 59 59 59 59 59 59 59 47 43 43 43 41 39 28 26 12 12 11 12 12 11 11 18 18 23 25 28 28 23 23 18 18 15 15 14 15 15 29 19 23 23 28 28 28 20 8 8 6 6 8 8 9 11 10 10 11 18 28 34 16 13 11 11 11 10 8 7 7 7 6 15 8 9 9 9 13 15 15 16 16 14 12 12 12 12 12 12 9 9 9 10 14 16 19 12 11 11 12 21 15 11 6 6 8 8 18 16 20 20 22 19 18 13 10 9 9 9 9 11 11 11 11 17 11 13 8 8 8 8 8 8 10 8 8 8 10 11 11 9 9 9 9 10 9 9 8 14 10 9 9 13 7 6 8 6 8 8 8 10 8 11 12 12 11 11 11 14 12 10 16 10 9 9 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 6 6 6 6 8 8 8 8 8 8 8 7 7 10 8 8 8 10 10 13 10 10 9 9 10 10 12 11 14 9 8 8 8 8 8 8 6 6 6 8 8 10 9 10 9 9 9 13 9 10 10 10 11 15 12 13 8 8 8 8 8 8 8 8 8 10 9 8 9 8 8 10 8 9 8 9 8 8 8 8 8 13 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 8 10 11 9 9 11 11 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 9 7 12 10 15 17 18 15 12 10 10 10 11 11 13 15 17 10 12 13 8 8 8 10 9 11 19 12 10 8 8 8 8 8 8 8 10 9 11 11 11 11 12 12 10 11 10 10 15 13

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no373_l11.b1 MSMg01no373_l11.b1 CHROMAT_FILE:
MSMg01no373_l11.b1 PHD_FILE: MSMg01no373_l11.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:12:44 2005
         (415 letters)



>mm_chr5_143675894_143676708
          Length = 815

 Score =  538 bits (278), Expect = e-157
 Identities = 299/308 (97%), Gaps = 5/308 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   gcctctgcctcctaagacctaggactcaaggtgtgtcctgctcagccatgcagcctgctg 60
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 304 gcctctgcctcctaagtcctaggactcaaggtgtgtcctgctcagccatgcagcctgctg 245

                                                                       
Query: 61  ggacatcttgttggctgcttctgtctgagctgttctagctaataggccacatcaggtctc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 244 ggacatcttgttggctgcttctgtctgagctgttctagctaataggccacatcaggtctc 185

                                                                       
Query: 121 caaacagtattattccagaagattcttcggcatcctccagctcttacatttttttccctt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 184 caaacagtattattccagaagattcttcggcatcctccagctcttacatttttttccctt 125

                                                                       
Query: 181 ctcttttctggtatgttctctgacttttagaaggtgggatgagtcaggcagtggtggcgc 240
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 ctcttttctggtgtgttctctgacttttagaaggtgggatgagtcaggcagtggtggcgc 65

                                                                       
Query: 241 atgcctttaatctc-tcttttatttgggaggcagagggcaggtggatctctgagtttgag 299
           |||||||||||| |  |    |||||||||||||||||||||||||||||||||||||||
Sbjct: 64  atgcctttaatcccagc----atttgggaggcagagggcaggtggatctctgagtttgag 9

                   
Query: 300 gccagcct 307
           ||||||||
Sbjct: 8   gccagcct 1


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 415
Length of database: 815
Length adjustment: 9
Effective length of query: 406
Effective length of database: 806
Effective search space:   327236
Effective search space used:   327236
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information