MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-438K07
Chromosome	5 (Build37)
Map Location	139,277,428 - 139,277,916
singlet/doublet	singlet
Overlap gene	BC004044
Upstream gene	Pilra, Pilrb1, Pilrb2, LOC100041016, LOC100041027, Cyp3a13, LOC666429, Gje1, Azgp1, EG243302, LOC100041050, Smok3a, Smok3b, Smok3c, Zkscan1, Zscan21, Zfp113, Cops6, Mcm7, Ap4m1, Taf6, 2610019P18Rik, BC038925, Gm454, BC055004, 0910001L09Rik, BC037034, Gal3st4, Gpc2, Stag3, Got2-ps1, 2610020C11Rik, LOC433955, EG666533, 1700123K08Rik, Zfp68, LOC665882, A430033K04Rik
Downstream gene	EG384244, Pdgfa, Prkar1b, Heatr2, Unc84a, 1110007L15Rik, Centa1, Cox19, Cyp2w1, 3110082I17Rik, D830046C22Rik, Gpr146, C130050O18Rik, Gpr30, Zfand2a, Uncx4.1, LOC100041200, LOC100041209, LOC100041217, Micall2, Ints1, Mafk
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pilra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231805 MGI:2450529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170741 MGI:2450532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545812 MGI:2450535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041027 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Cyp3a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13113 MGI:88610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Gje1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118446 MGI:2153041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Azgp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12007 MGI:103163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243302 MGI:3645168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 446 ESTs, 5 Proteins

name	LOC100041050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Smok3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545814 MGI:3693943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 96 Proteins

name	Smok3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622474 MGI:3615348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smok3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622486 MGI:3647925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 100 Proteins

name	Zkscan1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zscan21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22697 MGI:99182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Zfp113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56314 MGI:1929116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cops6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26893 MGI:1349439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17220 MGI:1298398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap4m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11781 MGI:1337063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21343 MGI:109129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610019P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66455 MGI:1913705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038925 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330216 MGI:2679717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243303 MGI:2685300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	BC055004 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381680 MGI:3584036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0910001L09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66096 MGI:1913346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC037034 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231807 MGI:2385896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330217 MGI:1916254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71951 MGI:1919201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50878 MGI:1355311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Got2-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14720 MGI:104721
definition	note : glutamate oxaloacetate transaminase 2, mitochondrial, pseudogene 1 pseudo : _no_value

name	2610020C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72154 MGI:1919404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC433955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins pseudo : _no_value

name	EG666533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666533 MGI:3644505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	1700123K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins pseudo : _no_value

name	A430033K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243308 MGI:3583896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC004044 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80752 MGI:2136853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384244 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Pdgfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18590 MGI:97527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkar1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19085 MGI:97759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Heatr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433956 MGI:3616079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc84a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77053 MGI:1924303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110007L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67604 MGI:1914854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231821 MGI:2442201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68033 MGI:1915283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2w1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins

name	3110082I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73212 MGI:1920462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830046C22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320197 MGI:2443565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr146 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80290 MGI:1933113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C130050O18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76854 MGI:1924104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfand2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100494 MGI:2140729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uncx4.1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22255 MGI:108013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041200 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Micall2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231830 MGI:2444818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ints1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68510 MGI:1915760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mafk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pilra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803285 GeneID:231805 MGI:2450529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor alpha transcript_id : NM_153510.2

name	Pilrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875355 GeneID:170741 MGI:2450532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor beta 1 transcript_id : NM_133209.1

name	Pilrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364171 GeneID:545812 MGI:2450535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired immunoglobin-like type 2 receptor beta 2 transcript_id : NM_001024932.2

name	Cyp3a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380509 GeneID:13113 MGI:88610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 3, subfamily a, polypeptide 13 transcript_id : NM_007819.3

name	Gje1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367828 GeneID:118446 MGI:2153041
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein epsilon 1 transcript_id : NM_080450.3

name	Azgp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304910 GeneID:12007 MGI:103163
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-2-glycoprotein 1, zinc transcript_id : NM_013478.1

name	EG243302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375725 GeneID:243302 MGI:3645168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 446 ESTs, 5 Proteins product : predicted gene, EG243302 transcript_id : XM_144599.7

name	LOC100041050 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149254639 GeneID:100041050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to putative protein kinase transcript_id : XM_001475708.1

name	Smok3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375726 GeneID:545814 MGI:3693943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 96 Proteins product : sperm motility kinase 3A, transcript variant 1 transcript_id : XM_620264.3

name	Smok3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375972 GeneID:622474 MGI:3615348
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm motility kinase 3B transcript_id : NM_001039889.2

name	Smok3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94375729 GeneID:622486 MGI:3647925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 100 Proteins product : sperm motility kinase 3C, transcript variant 2 transcript_id : XM_898397.2

name	Zkscan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68510030 GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 1 transcript_id : NM_133906.4

name	Zkscan1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68510028 GeneID:74570 MGI:1921820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger with KRAB and SCAN domains 1 transcript_id : NM_029869.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374185 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_011757.2

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374181 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044703.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374183 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044704.1

name	Zscan21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374189 GeneID:22697 MGI:99182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domain containing 21 transcript_id : NM_001044705.1

name	Zfp113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328522 GeneID:56314 MGI:1929116
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 113 transcript_id : NM_019747.3

name	Cops6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377445 GeneID:26893 MGI:1349439
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COP9 (constitutive photomorphogenic) homolog, subunit 6 (Arabidopsis thaliana) transcript_id : NM_012002.2

name	Mcm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130733 GeneID:17220 MGI:1298398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : minichromosome maintenance deficient 7 (S. cerevisiae) transcript_id : NM_008568.2

name	Ap4m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803389 GeneID:11781 MGI:1337063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex AP-4, mu 1 transcript_id : NM_021392.3

name	Taf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130471 GeneID:21343 MGI:109129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_009315.3

name	2610019P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301473 GeneID:66455 MGI:1913705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610019P18 gene transcript_id : NM_178612.3

name	BC038925 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368327 GeneID:330216 MGI:2679717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038925 transcript_id : NM_177878.2

name	BC055004 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625602 GeneID:381680 MGI:3584036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC055004 transcript_id : NM_001013773.2

name	0910001L09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487392 GeneID:66096 MGI:1913346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0910001L09 gene transcript_id : NM_001081108.1

name	BC037034 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346608 GeneID:231807 MGI:2385896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC037034 transcript_id : NM_153161.1

name	Gal3st4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802535 GeneID:330217 MGI:1916254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 4 transcript_id : NM_001033416.2

name	Gpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226221 GeneID:71951 MGI:1919201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 2 (cerebroglycan) transcript_id : NM_172412.2

name	Stag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394369 GeneID:50878 MGI:1355311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal antigen 3 transcript_id : NM_016964.1

name	2610020C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254176 GeneID:72154 MGI:1919404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610020C11 gene transcript_id : NM_028130.2

name	1700123K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802060 GeneID:76658 MGI:1923908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700123K08 gene transcript_id : NM_029693.2

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680983 GeneID:24135 MGI:1344427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_001044747.1

name	Zfp68 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681056 GeneID:24135 MGI:1344427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 68 transcript_id : NM_013844.2

name	A430033K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942099 GeneID:243308 MGI:3583896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430033K04 gene transcript_id : NM_183025.1

name	BC004044 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842825 GeneID:80752 MGI:2136853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004044 transcript_id : NM_030565.5

name	EG384244 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254649 GeneID:384244 MGI:3646467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG384244 transcript_id : XM_357518.6

name	Pdgfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130644 GeneID:18590 MGI:97527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor, alpha transcript_id : NM_008808.3

name	Prkar1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543508 GeneID:19085 MGI:97759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent regulatory, type I beta transcript_id : NM_008923.2

name	Heatr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486914 GeneID:433956 MGI:3616079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HEAT repeat containing 2 transcript_id : NM_001081265.1

name	Unc84a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789242 GeneID:77053 MGI:1924303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-84 homolog A (C. elegans) transcript_id : NM_024451.1

name	1110007L15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312885 GeneID:67604 MGI:1914854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110007L15 gene transcript_id : NM_026269.1

name	Centa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352026 GeneID:231821 MGI:2442201
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, alpha 1 transcript_id : NM_172723.2

name	Cox19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574049 GeneID:68033 MGI:1915283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) transcript_id : NM_197980.1

name	Cyp2w1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149254651 GeneID:545817 MGI:3616076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 106 Proteins product : cytochrome P450, family 2, subfamily w, polypeptide 1 transcript_id : XM_620268.4

name	3110082I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801665 GeneID:73212 MGI:1920462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110082I17 gene transcript_id : NM_028469.2

name	D830046C22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802148 GeneID:320197 MGI:2443565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830046C22 gene transcript_id : NM_177097.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662751 GeneID:80290 MGI:1933113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_030258.3

name	Gpr146 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662746 GeneID:80290 MGI:1933113
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 146 transcript_id : NM_001038703.1

name	C130050O18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301224 GeneID:319772 MGI:2442694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130050O18 gene transcript_id : NM_177000.3

name	Gpr30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378497 GeneID:76854 MGI:1924104
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 30 transcript_id : NM_029771.2

name	Zfand2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475963 GeneID:100494 MGI:2140729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, AN1-type domain 2A transcript_id : NM_133349.2

name	Uncx4.1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982739 GeneID:22255 MGI:108013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Unc4.1 homeobox (C. elegans) transcript_id : NM_013702.2

name	Micall2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341298 GeneID:231830 MGI:2444818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MICAL-like 2 transcript_id : NM_174850.2

name	Ints1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930422 GeneID:68510 MGI:1915760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 1 transcript_id : NM_026748.1

name	Mafk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130123 GeneID:17135 MGI:99951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K (avian) transcript_id : NM_010757.2

name	Pilrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875356 GeneID:170741 MGI:2450532
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : immunoglobulin-like cell surface receptor FDFACT, activating counterpart product : paired immunoglobin-like type 2 receptor beta protein_id : NP_573472.1

name	Pilrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701576 GeneID:545812 MGI:2450535
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : paired immunoglobin-like type 2 receptor beta 2 protein_id : NP_001020103.1

name	Cyp3a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681115 CCDS:CCDS19781.1 GeneID:13113 MGI:88610
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence ISS] codon_start : 1 note : cytochrome P450, steroid inducible 3a13 product : cytochrome P450, family 3, subfamily a, polypeptide 13 protein_id : NP_031845.1

name	Gje1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575910 CCDS:CCDS19782.1 GeneID:118446 MGI:2153041
definition	GO_component : GO:0005921 - gap junction [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005243 - gap-junction forming channel activity [Evidence ISS] GO_process : GO:0007267 - cell-cell signaling [Evidence ISS] codon_start : 1 note : connexin 29 product : gap junction membrane channel protein epsilon 1 protein_id : NP_536698.2

name	Azgp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304911 CCDS:CCDS19783.1 GeneID:12007 MGI:103163
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0005504 - fatty acid binding [Evidence ISS]; GO:0030106 - MHC class I receptor activity [Evidence IEA]; GO:0008320 - protein carrier activity [Evidence ISS]; GO:0004540 - ribonuclease activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0016042 - lipid catabolism [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0040014 - regulation of body size [Evidence NAS] codon_start : 1 exception : mismatches in translation note : zinc-alpha2-glycoprotein; major histocompatibility complex class I-like protein product : alpha-2-glycoprotein 1, zinc protein_id : NP_038506.1

name	EG243302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20846986 GeneID:243302 MGI:3645168
definition	codon_start : 1 product : similar to ribosomal protein S25 protein_id : XP_144599.1

name	LOC100041050 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149254640 GeneID:100041050
definition	codon_start : 1 product : similar to putative protein kinase protein_id : XP_001475758.1

name	Smok3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63531706 GeneID:545814 MGI:3693943
definition	codon_start : 1 product : similar to putative protein kinase isoform 1 protein_id : XP_620264.1

name	Smok3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89941468 GeneID:622474 MGI:3615348
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : sperm motility kinase 2B protein_id : NP_001034978.1

name	Smok3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82899729 GeneID:622486 MGI:3647925
definition	codon_start : 1 product : similar to putative protein kinase isoform 2 protein_id : XP_903490.1

name	Zkscan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27804319 CCDS:CCDS19789.1 GeneID:74570 MGI:1921820
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; zinc finger protein 36 (KOX 18) product : zinc finger protein 36 isoform 1 protein_id : NP_598667.2

name	Zkscan1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68510029 CCDS:CCDS19788.1 GeneID:74570 MGI:1921820
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; zinc finger protein 36 (KOX 18) product : zinc finger protein 36 isoform 2 protein_id : NP_084145.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374182 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038168.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374184 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038169.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374190 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_001038170.1

name	Zscan21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374186 CCDS:CCDS19790.1 GeneID:22697 MGI:99182
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 38 product : zinc finger proliferation 1 protein_id : NP_035887.2

name	Zfp113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504487 CCDS:CCDS19791.1 GeneID:56314 MGI:1929116
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045321 - leukocyte activation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 113 protein_id : NP_062721.2

name	Cops6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563284 CCDS:CCDS19792.1 GeneID:26893 MGI:1349439
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0008180 - signalosome complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : COP9 complex S6; COP9 (constitutive photomorphogenic), subunit 6 product : COP9 signalosome subunit 6 protein_id : NP_036132.1

name	Mcm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10242373 CCDS:CCDS19793.1 GeneID:17220 MGI:1298398
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IPI]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003697 - single-stranded DNA binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mini chromosome maintenance deficient 7 product : minichromosome maintenance complex component 7 protein_id : NP_032594.1

name	Ap4m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981143 CCDS:CCDS19794.1 GeneID:11781 MGI:1337063
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : adaptor-related protein complex AP-4 mu4 subunit; adaptor-related protein complex AP-4 mu 1 product : adaptor-related protein complex AP-4, mu 1 protein_id : NP_067367.2

name	Taf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678215 CCDS:CCDS19795.1 GeneID:21343 MGI:109129
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0016986 - transcription initiation factor activity [Evidence IEA] GO_process : GO:0051090 - regulation of transcription factor activity [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : TATA box binding protein (Tbp)-associated factor, RNA polymerase II, E; TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kDa product : TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_033341.1

name	2610019P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519939 GeneID:66455 MGI:1913705
definition	codon_start : 1 product : hypothetical protein LOC66455 protein_id : NP_848727.1

name	BC038925 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244490 CCDS:CCDS19796.1 GeneID:330216 MGI:2679717
definition	codon_start : 1 product : hypothetical protein LOC330216 protein_id : NP_808546.1

name	BC055004 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625603 GeneID:381680 MGI:3584036
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC381680 protein_id : NP_001013795.2

name	0910001L09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487393 GeneID:66096 MGI:1913346
definition	codon_start : 1 product : hypothetical protein LOC66096 protein_id : NP_001074577.1

name	BC037034 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346609 GeneID:231807 MGI:2385896
definition	codon_start : 1 product : hypothetical protein LOC231807 protein_id : NP_694801.1

name	Gal3st4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370027 CCDS:CCDS19798.1 GeneID:330217 MGI:1916254
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0050694 - galactose 3-O-sulfotransferase activity [Evidence ISS]; GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0009101 - glycoprotein biosynthesis [Evidence ISS] codon_start : 1 product : galactose-3-O-sulfotransferase 4 protein_id : NP_001028588.1

name	Gpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369537 CCDS:CCDS19799.1 GeneID:71951 MGI:1919201
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : glypican 2 (cerebroglycan) protein_id : NP_766000.1

name	Stag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394370 GeneID:50878 MGI:1355311
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000795 - synaptonemal complex [Evidence IDA]; GO:0000802 - transverse filament [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence IEA]; GO:0007066 - female meiosis sister chromatid cohesion [Evidence ISS]; GO:0007065 - male meiosis sister chromatid cohesion [Evidence ISS]; GO:0007126 - meiosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : stromalin 3 product : stromal antigen 3 protein_id : NP_058660.1

name	2610020C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254177 GeneID:72154 MGI:1919404
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72154 protein_id : NP_082406.2

name	1700123K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386432 GeneID:76658 MGI:1923908
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76658 protein_id : NP_083969.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305647 CCDS:CCDS19801.1 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : zinc finger protein 68 isoform a protein_id : NP_038872.1

name	Zfp68 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680984 GeneID:24135 MGI:1344427
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : zinc finger protein 68 isoform b protein_id : NP_001038212.1

name	A430033K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942100 GeneID:243308 MGI:3583896
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243308 protein_id : NP_898846.1

name	BC004044 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385516 GeneID:80752 MGI:2136853
definition	codon_start : 1 note : dentin matrix protein 4 product : cDNA sequence BC004044 protein_id : NP_085042.1

name	EG384244 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254650 GeneID:384244 MGI:3646467
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357518.6

name	Pdgfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6715566 CCDS:CCDS19802.1 GeneID:18590 MGI:97527
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0048286 - alveolus development [Evidence IMP]; GO:0001525 - angiogenesis [Evidence IDA]; GO:0030031 - cell projection biogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IGI] [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : platelet derived growth factor, alpha protein_id : NP_032834.1

name	Prkar1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543509 CCDS:CCDS19803.1 GeneID:19085 MGI:97759
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA]; GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0007611 - learning and/or memory [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein kinase, cAMP dependent regulatory, type I beta protein_id : NP_032949.2

name	Heatr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486915 GeneID:433956 MGI:3616079
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : HEAT repeat containing 2 protein_id : NP_001074734.1

name	Unc84a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789243 CCDS:CCDS19804.1 GeneID:77053 MGI:1924303
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : unc-84 homolog A protein_id : NP_077771.1

name	1110007L15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229052 CCDS:CCDS19805.1 GeneID:67604 MGI:1914854
definition	codon_start : 1 product : hypothetical protein LOC67604 protein_id : NP_080545.2

name	Centa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370052 CCDS:CCDS19806.1 GeneID:231821 MGI:2442201
definition	GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 product : centaurin, alpha 1 protein_id : NP_766311.1

name	Cox19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574050 GeneID:68033 MGI:1915283
definition	codon_start : 1 product : COX19 cytochrome c oxidase assembly homolog protein_id : NP_932097.1

name	Cyp2w1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149254652 GeneID:545817 MGI:3616076
definition	codon_start : 1 product : similar to cytochrome P450, family 2, subfamily W, polypeptide 1 protein_id : XP_620268.4

name	3110082I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312132 GeneID:73212 MGI:1920462
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC73212 protein_id : NP_082745.1

name	D830046C22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893027 GeneID:320197 MGI:2443565
definition	codon_start : 1 product : hypothetical protein LOC320197 protein_id : NP_796071.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662747 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_001033792.1

name	Gpr146 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981402 CCDS:CCDS19809.1 GeneID:80290 MGI:1933113
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 146 protein_id : NP_084534.2

name	C130050O18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301225 GeneID:319772 MGI:2442694
definition	codon_start : 1 product : hypothetical protein LOC319772 protein_id : NP_795974.2

name	Gpr30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037469 CCDS:CCDS19811.1 GeneID:76854 MGI:1924104
definition	GO_function : GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : constitutively expressed peptide-like receptor like product : G protein-coupled receptor 30 protein_id : NP_084047.1

name	Zfand2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111158 CCDS:CCDS19812.1 GeneID:100494 MGI:2140729
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, AN1-type domain 2A protein_id : NP_579927.1

name	Uncx4.1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305613 CCDS:CCDS19813.1 GeneID:22255 MGI:108013
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : Unc4.1 homeobox protein_id : NP_038730.1

name	Micall2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424677 GeneID:231830 MGI:2444818
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MICAL-like 2 protein_id : NP_777275.1

name	Ints1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930423 GeneID:68510 MGI:1915760
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : integrator complex subunit 1 protein_id : NP_081024.1

name	Mafk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754612 CCDS:CCDS19814.1 GeneID:17135 MGI:99951
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear factor, erythroid derived 2, ubiquitous; p18 NF-E2 product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein K protein_id : NP_034887.1

name	LOC100041016 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041016
definition	number : 1 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 1 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 2 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 3 pseudo : _no_value

name	LOC100041027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041027
definition	number : 4 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 1 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 2 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 3 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 4 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 5 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 6 pseudo : _no_value

name	EG666533 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666533
definition	number : 7 pseudo : _no_value

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 2 pseudo : _no_value

name	LOC100041200 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041200
definition	number : 1 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 2 pseudo : _no_value

name	LOC100041209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041209
definition	number : 1 pseudo : _no_value

name	LOC100041217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041217
definition	number : 1 pseudo : _no_value

name	LOC666429 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254638 GeneID:666429
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to Zwint protein pseudo : _no_value transcript_id : XR_032379.1

name	Gm454 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149254641 GeneID:243303 MGI:2685300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : gene model 454, (NCBI) transcript_id : XR_032409.1

name	LOC433955 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254642 GeneID:433955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 953 ESTs, 8 Proteins product : similar to HSPC008 pseudo : _no_value transcript_id : XR_033167.1

name	LOC665882 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149254643 GeneID:665882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 7 Proteins product : similar to Ribosomal protein L17 pseudo : _no_value transcript_id : XR_033203.1

clone name	MSMg01-473D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349M10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-431H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293E01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-139E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-438K07.T7 (MSMg01no438_k07.b1)	MSMg01-438K07.TJ (MSMg01no438_k07.g1)
ACC	AG529189	AG529190
length	755	1,510
length of high quality (start - end)	488 (71 - 558)	---
definition	CHROMAT_FILE: MSMg01no438_k07.b1 PHD_FILE: MSMg01no438_k07.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:04:30 2005	CHROMAT_FILE: MSMg01no438_k07.g1 PHD_FILE: MSMg01no438_k07.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:04:30 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXTTCAGAAGATCCGCGGAATTCAG GATGGATCACAAAAAACTGAGCCAAGCTTACAGAAGGCCCATCTGAGCCT GCCCCACCTGGAATGGAGGGCCATGCTCCTCCCTGACTGACCCAGAGCAG AGCTGCTCACAAGTAGAAGGGTGTCTGCTGTGATCAAAGGCTTTCCAGCC GCACTTAGCTCTCAGAAGCAGCAATGGCAAATTTGGCAGCGGAAGGATCT ACAAGCGCAAGCAAAGCAGAAACGGGGAATCTAAACAGACCTGGCTTTCT AAAGTAAGATCAAAGCTGTCTTCAGGGTCCCGTGCTTCAGAGGAAACCAG ACATCTGGAAGGCTCTTGGAAGAAATTGGCTCACAGGGCAGAGTGGTCTG GCAGGGACAGCTACCCGGAGGTGACTGTGTTCAGGAGTGGCCAGTCTGCT TCATGTAAAGAGGGAACCATTTGGGCCACATGAGCCACCCACCTTAGGGG GCCCCTGACAGCCAGGGAAGATTCTTGGGGTTCCTGGGAGCTAACAAATG ACTAGTAACTGACTGGGAGTCTCACCATGAGCTGCAAAAGGGGAGTTGTG GGCTAGCTGATTGGTGCAGCAGTTGTTCGGGGGACATGTATAGGCGAAAT GACAAATGTTGTGTCCCCAGTGTGGGACGTCCATGGGATGTGCTGGTCCA TCCATCTGAATGCCCCCTGCTGAGGATGGTAGTGTATCTCCTCCCATTAT TTGAG	CTTATTCTTTATACAAATATAAAATACATACTAATCAATTTTCTTNTCAC AGTAATATGAGCCGTGTTTTTTTCTCTCACGCAATAATGAGTAGACTGGC GATCGCGGCTACCAGAGTGTTGTCCCCACCCACAAGCACACTCGCTTGGT TTTTNACACGGGTTGAGGTGACCTGTTGTTGCGCCCCATTCCTCATAACT TCATTTTAAATGTCATCTATACATATATTTTGCATCTTAATACGCACGAC GGTTCGCGTTTATCGTGTAAGGGATAAGTTGTTACTCTTTCACTTAGAAT AATCCTCTAAATAATCATACATTAGCTGATCGAATAAGTAGGAACGGCAT CCCTAACAGAAAGACGTACAAAGAACACACATACACACTAATCATACTAC CAAACGCACCACTTACAAATATAATAAAGCGGCTCGACATCACGACCGGT GGCACCTCCACTGTCACCGACTTCGTTCGACACCCGATGTTCGGCTTGTG TGCTGTGTGCGCGGATACGCGGGCGCGTATTTAACGCGTGGAACGCGACA AAAGATGAATTTCACTTACCAGGAGCGCTACCACCTCCCACCAACCCACC CACACCACAAACAAACAAAGGAAGACACGCGCCACGCTAGAATAGACACA CACCACACAAAATTCGAGTACACACAATCTGACAATATCCTAGGCACGTT TATCTCCTCGTCTATGCTGACTGTGGAAGATCATTATTAGTACTACTGTA TAACGTGTATGATACACAACCACTTCATCATTACAAATACAAATATATCC ACAACATCANACACCAACACATCATCATAATCTAATATCTNTTCACACCC ATACACTATATCACTCACCTTAATTCCTAATCATGCTGCTACACACTCNT ACGATAATAATCATGTGATATGCCCTACAACGCCGCGCCGCCAAGCATAT CTCGATATCGCACGCTCTCACACCCCATCGTATCATGCTATTGTGACAGA GCGCGTGTCTNCATTTACTTCTCTTCTCAATCATATTACACCTCATCAAT AGCATATCATCACTACCTCGACACCAGATCCATACACACATACTCACTGA ACGATCTACCACATTACCATCAATCTCCATCTCACCGAGATACCGCAGCG CGTTATCGCCAACCTTCCTCCGCTGTCTATGTCGCTCATCCTCCACGCTC CTATATATGTTTTATGACTCCGTGTAATAGCCTCTATTAATGGATCTCTC TACGTCAATACTCGAGCAGACATACAGACTACAGAGATATAGCGTACGTA TATATAGACGCNGGCTCACACCACATACGCACTCATCAACTCTACTAGTC GAATCGCAGCTCTCGNGTACATGAGATCATATCTCACGAGCTCTCATCCC ATCTATTCTATGTGCTAATCTCTCTGNGTATCTACTCTCATCGCCTACCT TCTCGTTTATCTCCGTATCGAGACTCCCGACGTGCCCACAACATCAGCTC GATTCCGACN
quality values	Open. Hide. 14 15 25 25 30 30 25 19 12 17 10 9 9 19 19 41 44 48 28 28 24 22 20 19 27 9 9 9 12 9 9 9 9 9 9 9 11 16 16 19 27 25 30 30 31 31 33 33 37 37 26 23 18 9 9 9 9 9 9 9 10 12 14 17 15 14 12 11 15 15 18 23 33 33 33 36 59 59 53 53 50 50 50 53 53 53 57 57 59 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 39 37 46 42 42 37 30 32 30 32 44 48 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 68 68 57 57 48 48 48 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 51 51 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 54 54 54 59 59 59 59 54 54 54 57 59 59 59 59 57 54 50 50 53 53 43 43 28 32 37 43 43 57 48 48 48 57 57 53 43 43 43 33 33 33 33 19 19 8 8 8 13 22 39 41 40 46 47 59 48 48 48 57 47 47 40 40 47 59 47 43 43 43 43 42 47 48 48 57 57 59 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 57 57 59 57 50 50 50 50 50 59 59 28 22 10 10 9 8 8 8 8 10 13 25 36 43 46 50 59 59 59 59 59 57 57 57 57 57 57 59 59 57 43 48 43 43 40 48 48 54 57 57 59 59 48 43 43 43 41 41 41 37 39 41 41 20 28 31 39 43 48 57 57 57 57 54 46 57 43 43 48 57 43 57 48 48 48 48 48 47 57 43 43 40 39 39 37 37 41 41 39 37 37 28 28 30 22 31 12 11 7 7 8 8 16 16 30 34 34 36 36 37 37 39 39 43 40 39 43 43 47 47 47 48 46 42 33 33 28 33 42 43 42 42 42 42 46 42 39 32 28 23 26 30 33 36 37 48 43 39 28 28 23 29 29 30 30 30 34 31 19 17 14 18 23 23 20 32 28 24 10 10 8 8 10 16 26 30 36 36 39 41 34 28 28 28 30 28 32 23 25 33 33 43 40 40 43 43 43 37 32 22 17 17 17 17 16 29 29 40 29 39 29 28 15 14 19 20 37 33 37 39 32 22 14 14 14 17 17 31 31 31 25 25 25 28 33 37 39 37 32 30 25 25 18 25 15 23 24 28 24 16 10 10 8 8 8 8 8 12 17 23 18 15 21 15 21 14 17 17 18 28 18 20 20 31 26 23 14 14 13 10 10 10 8 8 6 6 6 6 11 8 8 9 10 17 19 13 20 23 18 16 14 16 15 11 11 11 11 10 10 13 13 12 10 10 10 10 10 10 11 11 15 15 19 16 13 10 10 9 12 10 10 9 9 9 9 9 8 10 10 12 8 8 10 15 13 10 10 10 11 11 19 25 26 15 10 10 10 10 10 10 8 8 8 8 8 10 10 9 13 10 9 8 8 8 8 8 8 8 9 8 8 8 8 8 9 10 13 11 9 10 9 10 10 10 10 7 7 8 6 10 10 10 9 10 10 8 8 8 11 9 8 8 10 8 8 8 8 6 6 6 8 12 8 8 8 8 8 8 10 10 10 10 8 8 8 8 8 8 11 11 11	Open. Hide. 6 6 6 8 6 6 6 8 8 8 8 8 8 12 8 10 6 6 6 6 8 10 9 9 9 9 9 8 8 6 6 8 8 11 13 8 10 8 8 8 8 8 8 8 3 0 3 8 8 8 10 12 10 10 10 11 11 11 11 11 11 10 6 6 6 6 8 6 10 13 9 11 11 8 8 8 8 9 9 10 10 8 10 8 8 8 9 10 10 9 9 10 9 8 6 8 8 6 7 6 6 6 6 6 6 6 6 8 8 10 10 10 10 10 10 9 9 9 11 10 10 10 10 13 13 12 10 11 11 8 8 9 8 10 8 9 9 9 10 10 11 11 12 12 11 10 8 8 8 9 9 8 8 3 0 3 6 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 6 8 8 8 8 8 8 8 8 8 12 9 10 10 8 8 6 7 6 10 9 8 8 8 8 8 8 6 6 8 6 12 11 11 11 12 11 11 8 8 8 8 8 8 10 8 8 6 6 8 8 8 8 10 11 10 10 9 9 9 9 10 9 8 8 8 8 8 8 8 6 6 6 6 7 6 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 6 6 6 8 8 8 8 8 8 8 6 6 8 8 13 13 11 11 8 8 6 6 8 8 8 8 8 8 8 8 8 8 11 8 8 8 8 8 8 8 8 6 6 6 8 12 10 10 8 8 6 7 6 6 8 8 6 7 6 6 8 8 8 8 8 11 11 13 18 21 10 10 10 13 8 8 8 6 6 8 8 8 8 8 8 8 8 10 8 8 8 8 8 6 8 6 6 6 6 6 6 6 6 8 10 8 8 8 8 8 8 12 10 10 6 6 6 6 6 8 6 8 9 9 19 13 13 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 10 8 8 8 8 8 8 9 10 10 11 11 11 10 9 8 8 8 8 8 8 8 8 8 7 7 8 7 8 8 10 8 8 8 8 8 6 6 8 8 8 8 8 10 8 8 10 8 8 8 8 8 12 8 8 8 8 8 8 8 9 9 8 8 10 8 10 8 10 6 6 8 8 6 6 8 8 8 9 9 8 8 8 8 8 6 6 11 7 7 8 8 8 10 10 8 6 6 6 6 8 8 10 8 8 8 8 8 8 10 13 13 12 6 6 6 10 8 8 8 6 8 8 8 10 10 8 9 10 10 12 8 8 8 8 8 7 7 9 8 10 13 8 8 8 8 8 6 6 6 6 6 8 6 9 9 11 9 9 10 10 9 9 9 6 6 6 6 6 6 8 9 10 13 11 13 12 12 8 8 8 8 8 8 10 10 8 8 8 8 8 9 11 8 10 8 8 8 8 8 8 11 8 9 9 8 8 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 6 6 8 8 8 8 8 6 6 8 6 6 8 8 8 8 8 8 8 10 8 8 8 8 9 9 6 10 6 7 8 8 10 10 8 8 8 8 8 8 6 8 8 8 7 7 8 8 9 10 10 9 6 6 6 6 6 6 8 11 11 11 11 11 11 9 9 9 8 8 8 8 8 8 9 9 10 8 8 6 6 8 8 8 8 8 8 8 11 8 8 8 8 10 8 8 8 8 8 8 8 8 8 11 11 13 9 8 8 8 8 8 9 10 8 8 8 8 8 8 12 13 16 8 10 8 8 8 8 8 8 11 14 13 16 10 10 15 12 12 8 9 9 8 8 8 8 8 8 8 8 9 9 6 6 6 6 8 8 6 6 6 8 12 10 10 10 3 0 3 9 10 10 11 10 9 10 9 10 8 12 8 8 8 8 8 8 10 9 9 9 12 8 8 8 8 8 8 3 0 3 10 8 8 10 8 8 10 10 13 13 12 8 8 8 8 8 8 8 10 10 10 15 13 8 8 8 8 8 8 8 8 8 8 8 11 8 8 8 8 8 8 12 11 11 11 8 8 7 9 9 9 6 6 8 8 3 0 3 6 8 6 6 8 10 10 10 8 10 6 6 8 8 13 14 14 13 8 8 8 6 6 8 6 8 8 6 6 6 6 6 6 8 8 8 8 8 8 8 8 8 6 8 6 7 8 8 8 8 8 8 11 11 18 18 11 10 8 8 10 8 8 8 8 10 8 9 10 10 10 11 8 8 8 8 8 8 8 10 14 18 13 8 7 7 7 8 8 10 9 8 10 9 9 10 11 12 12 8 8 7 9 9 8 8 8 8 8 3 0 3 12 8 13 11 13 8 8 8 10 8 8 8 8 8 6 6 6 8 8 9 13 13 12 8 8 6 6 6 7 8 8 10 8 8 7 7 8 12 8 8 8 8 8 8 8 9 10 10 12 10 6 6 6 8 8 10 8 8 8 8 10 11 11 8 8 8 8 8 8 8 8 10 13 13 17 13 17 17 22 17 22 22 21 12 10 8 6 6 6 6 11 10 9 8 8 6 6 8 6 8 8 8 8 8 8 6 8 8 8 6 8 6 6 6 6 6 6 8 8 10 11 8 7 6 6 6 6 8 10 10 8 8 8 8 8 7 6 6 6 7 10 8 8 8 8 8 8 8 9 7 10 6 6 6 6 8 10 12 9 8 8 8 8 6 6 8 8 9 8 8 8 8 8 10 15 11 10 9 9 12 7 6 7 6 6 6 11 7 9 6 6 6 6 8 8 8 8 8 12 13 8 8 8 8 8 8 8 8 11 13 8 8 8 8 8 8 6 8 8 6 6 8 13 13 11 19 8 8 8 8 8 8 15 13 15 13 11 11 10 11 11 11 9 6 8 6 6 6 6 6 8 8 8 7 6 6 6 6 8 8 8 8 8 8 9 9 9 9 9 8 8 8 8 8 8 8 8 10 10 10 10 10 13 10 10 10 9 13 11 11 8 8 8 8 10 8 9 9 3 0 3 8 6 6 6 8 8 8 8 8 8 8 8 6 6 6 6 8 8 9 6 6 6 6 6 6 6 6 7 7 8 8 10 8 7 9 9 11 9 9 9 11 10 10 10 10 8 8 10 12 13 8 3 0 3 6 6 6 6 6 7 6 8 6 8 8 8 10 10 10 10 10 6 6 6 6 6 6 7 10 6 6 6 6 6 6 7 6 6 6 9 9 8 6 6 6 6 6 6 8 8 8 10 8 6 7 7 6 6 8 8 8 8 3 0 3 6 8 8 6 6 6 6 8 9 10 11 11 17 17 10 7 6 6 6 8 8 11 9 9 10 8 8 8 8 8 8 8 10 12 10 9 9 9 10 12 10 8 7 7 7 7 8 8 13 8 8 8 8 8 6 6 6 8 6 10 8 6 6 6 8 8 6 6 6 7 6 6 8 10 8 8 8 8 7 7 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no438_k07.b1 MSMg01no438_k07.b1 CHROMAT_FILE:
MSMg01no438_k07.b1 PHD_FILE: MSMg01no438_k07.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:04:30 2005
         (488 letters)



>mm_chr5_139277228_139278116
          Length = 889

 Score =  868 bits (449), Expect = 0.0
 Identities = 479/489 (97%), Gaps = 1/489 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   gccaagcttacagaaggcccatctga-gcctgccccacctggaatggagggccatgctcc 59
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 689 gccaagcttacagaaggcccatctgaggcctgccccacctggaatggagggccatgctcc 630

                                                                       
Query: 60  tccctgactgacccagagcagagctgctcacaagtagaagggtgtctgctgtgatcaaag 119
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 629 tccctgactgacccagggcagagctgctcacaagtagaagggtgtctgctgtgatcaaag 570

                                                                       
Query: 120 gctttccagccgcacttagctctcagaagcagcaatggcaaatttggcagcggaaggatc 179
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 gctttccagccgcacttagctctcagaagcagcaatggcaaatttggcagcggaaggatc 510

                                                                       
Query: 180 tacaagcgcaagcaaagcagaaacggggaatctaaacagacctggctttctaaagtaaga 239
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 509 tagaagcgcaagcaaagcagaaacggggaatctaaacagacctggctttctaaagtaaga 450

                                                                       
Query: 240 tcaaagctgtcttcagggtcccgtgcttcagaggaaaccagacatctggaaggctcttgg 299
           ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 449 tcaaagctgcctccagggtcccgtgcttcagaggaaaccagacatctggaaggctcttgg 390

                                                                       
Query: 300 aagaaattggctcacagggcagagtggtctggcagggacagctacccggaggtgactgtg 359
           |||||||||||||||||||||||||||||||||||||| |||||   |||||||||||||
Sbjct: 389 aagaaattggctcacagggcagagtggtctggcagggatagctaggtggaggtgactgtg 330

                                                                       
Query: 360 ttcaggagtggccagtctgcttcatgtaaagagggaaccatttgggccacatgagccacc 419
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 329 ttcaggagtggccagtctgcttcatgtaaagagggaaccatttgggccacatgagccacc 270

                                                                       
Query: 420 caccttagggggcccctgacagccagggaagattcttggggttcctgggagctaacaaat 479
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 269 caccttagggggcccctgacagccagggaagactcttggggttcctgggagctaacaaat 210

                    
Query: 480 gactagtaa 488
           |||||||||
Sbjct: 209 gactagtaa 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 488
Length of database: 889
Length adjustment: 10
Effective length of query: 478
Effective length of database: 879
Effective search space:   420162
Effective search space used:   420162
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information