MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-496P03
Chromosome	5 (Build37)
Map Location	76,425,780 - 76,425,926
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Chic2, Gsh2, LOC100039083, Olfr1401-ps1, Pdgfra, LOC100039125, LOC100039143, LOC100039158, LOC100039169, Kit, EG664874, Kdr
Downstream gene	Gabarapl2-ps5_758.1, Srd5a2l, Tmem165, Apc-ps1, Clock, Ube2n-ps1, EG665055, Pdcl2, Pafah1b1-ps3, Nmu, LOC665065, EG639545, Exoc1, Cep135, LOC100039117, A730089K16Rik, LOC665107, LOC100039299, C530008M17Rik, A230062G08Rik, Ppat, LOC664998, Paics, Srp72
Link	Open Mouse BAC browser

Click to get alignment info.

name	Chic2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74277 MGI:1921527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14843 MGI:95843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039083 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Olfr1401-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404510 MGI:3031235
definition	note : olfactory receptor 1401, pseudogene 1 pseudo : _no_value

name	Pdgfra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18595 MGI:97530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039125 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100039143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100039158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039169 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Kit (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16590 MGI:96677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG664874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664874 MGI:3643740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Kdr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16542 MGI:96683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarapl2-ps5_758.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606516
definition	note : GABA(A) receptor-associated protein-like 2 pseudogene 5_758.1 pseudo : _no_value

name	Srd5a2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57357 MGI:1930252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21982 MGI:894407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apc-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79189 MGI:1930261
definition	note : adenomatosis polyposis coli, pseudogene 1 pseudo : _no_value

name	Clock (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12753 MGI:99698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2n-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12067 MGI:894296
definition	gene_synonym : 1500026J17Rik; Benh-ps1 note : ubiquitin-conjugating enzyme E2N, pseudogene 1 pseudo : _no_value

name	EG665055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665055 MGI:3648350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Pdcl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79455 MGI:1890655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b1-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79458 MGI:1930967
definition	note : platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit, pseudogene 3 pseudo : _no_value

name	Nmu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56183 MGI:1860476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665065 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG639545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639545 MGI:3647743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Exoc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69940 MGI:2445020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381644 MGI:2681869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	A730089K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320411 MGI:2443970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs

name	LOC665107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	C530008M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320827 MGI:2444817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 92 ESTs, 2 Proteins

name	A230062G08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231326 MGI:2442517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231327 MGI:2387203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 253 ESTs, 4 Proteins

name	LOC664998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Paics (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67054 MGI:1914304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srp72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66661 MGI:1333795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chic2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376381 GeneID:74277 MGI:1921527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich hydrophobic domain 2 transcript_id : NM_028850.2

name	Gsh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130994 GeneID:14843 MGI:95843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : genomic screened homeo box 2 transcript_id : NM_133256.2

name	Pdgfra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032049 GeneID:18595 MGI:97530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor receptor, alpha polypeptide transcript_id : NM_011058.2

name	LOC100039125 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253963 GeneID:100039125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039125 transcript_id : XM_001472317.1

name	Pdgfra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032015 GeneID:18595 MGI:97530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor receptor, alpha polypeptide transcript_id : NM_001083316.1

name	LOC100039143 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253965 GeneID:100039143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039143 transcript_id : XM_001472343.1

name	Kit (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947120 GeneID:16590 MGI:96677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kit oncogene transcript_id : NM_021099.2

name	EG664874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374816 GeneID:664874 MGI:3643740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG664874 transcript_id : XM_973184.1

name	Kdr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27777647 GeneID:16542 MGI:96683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinase insert domain protein receptor transcript_id : NM_010612.2

name	Srd5a2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27881426 GeneID:57357 MGI:1930252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : steroid 5 alpha-reductase 2-like transcript_id : NM_020611.3

name	Tmem165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111154066 GeneID:21982 MGI:894407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 165 transcript_id : NM_011626.2

name	Clock (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131173 GeneID:12753 MGI:99698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : circadian locomoter output cycles kaput transcript_id : NM_007715.5

name	EG665055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374869 GeneID:665055 MGI:3648350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : predicted gene, EG665055 transcript_id : XM_974212.1

name	Pdcl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801923 GeneID:79455 MGI:1890655
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosducin-like 2 transcript_id : NM_023508.4

name	Nmu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506926 GeneID:56183 MGI:1860476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuromedin U transcript_id : NM_019515.1

name	EG639545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253978 GeneID:639545 MGI:3647743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG639545 transcript_id : XM_974340.2

name	Exoc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89111938 GeneID:69940 MGI:2445020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exocyst complex component 1 transcript_id : NM_027270.1

name	Cep135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373055 GeneID:381644 MGI:2681869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 135 transcript_id : NM_199032.2

name	LOC100039117 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253972 GeneID:100039117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100039117 transcript_id : XM_001472400.1

name	LOC100039299 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149253980 GeneID:100039299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001472627.1

name	C530008M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94374875 GeneID:320827 MGI:2444817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 92 ESTs, 2 Proteins product : RIKEN cDNA C530008M17 gene, transcript variant 1 transcript_id : XM_287460.6

name	A230062G08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351537 GeneID:231326 MGI:2442517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230062G08 gene transcript_id : NM_173765.2

name	Ppat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253975 GeneID:231327 MGI:2387203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 253 ESTs, 3 Proteins product : phosphoribosyl pyrophosphate amidotransferase, transcript variant 5 transcript_id : XM_973973.2

name	Ppat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253976 GeneID:231327 MGI:2387203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 233 ESTs, 2 Proteins product : phosphoribosyl pyrophosphate amidotransferase, transcript variant 4 transcript_id : XM_973937.2

name	Ppat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149253977 GeneID:231327 MGI:2387203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 164 ESTs, 1 Protein product : phosphoribosyl pyrophosphate amidotransferase, transcript variant 3 transcript_id : XM_896000.3

name	LOC664998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94374858 GeneID:664998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC664998 transcript_id : XM_974119.1

name	Paics (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981122 GeneID:67054 MGI:1914304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase transcript_id : NM_025939.2

name	Srp72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118344451 GeneID:66661 MGI:1333795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 72 transcript_id : NM_025691.1

name	Chic2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386358 CCDS:CCDS19349.1 GeneID:74277 MGI:1921527
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005798 - Golgi-associated vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0006893 - Golgi to plasma membrane transport [Evidence TAS] codon_start : 1 product : cysteine-rich hydrophobic domain 2 protein_id : NP_083126.1

name	Gsh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18921210 CCDS:CCDS19350.1 GeneID:14843 MGI:95843
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0048665 - neuron fate specification [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP] [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : genomic screened homeo box 2 protein_id : NP_573555.1

name	LOC100039125 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253964 GeneID:100039125
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472367.1

name	Pdgfra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032016 GeneID:18595 MGI:97530
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0048407 - platelet-derived growth factor binding [Evidence IDA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0030539 - male genitalia development [Evidence IMP]; GO:0009653 - morphogenesis [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : PDGF alpha chain; platelet-derived growth factor receptor alpha product : platelet derived growth factor receptor, alpha polypeptide protein_id : NP_001076785.1

name	Pdgfra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032050 CCDS:CCDS19351.1 GeneID:18595 MGI:97530
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0048407 - platelet-derived growth factor binding [Evidence IDA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0030539 - male genitalia development [Evidence IMP]; GO:0009653 - morphogenesis [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : PDGF alpha chain; platelet-derived growth factor receptor alpha product : platelet derived growth factor receptor, alpha polypeptide protein_id : NP_035188.2

name	LOC100039143 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253966 GeneID:100039143
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472393.1

name	Kit (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10863917 GeneID:16590 MGI:96677
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005020 - stem cell factor receptor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence TAS]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0050875 - cellular physiological process [Evidence TAS]; GO:0006935 - chemotaxis [Evidence TAS]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0007281 - germ cell development [Evidence TAS]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0048066 - pigmentation during development [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0009314 - response to radiation [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : c-kit proto-oncogene protein; belly-spot; Steel Factor Receptor; Dominant white spotting; dominant spotting; spotted sterile male product : c-kit protein_id : NP_066922.1

name	EG664874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374817 GeneID:664874 MGI:3643740
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978278.1

name	Kdr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777648 GeneID:16542 MGI:96683
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0045165 - cell fate commitment [Evidence IMP]; GO:0016477 - cell migration [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0045446 - endothelial cell differentiation [Evidence IDA]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : vascular endothelial growth factor receptor-2; VEGF receptor-2; vascular endothelial growth factor receptor-3; vascular endothelial growth factor receptor- 2 product : kinase insert domain protein receptor protein_id : NP_034742.2

name	Srd5a2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881427 CCDS:CCDS19358.1 GeneID:57357 MGI:1930252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : steroid 5 alpha-reductase 2 like; H5AR product : steroid 5 alpha-reductase 2-like protein_id : NP_065636.2

name	Tmem165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111154067 CCDS:CCDS19359.1 GeneID:21982 MGI:894407
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 note : transmembrane protein 164 product : TPA regulated locus protein_id : NP_035756.2

name	Clock (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106459 CCDS:CCDS19360.1 GeneID:12753 MGI:99698
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IMP] [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : circadian locomoter output cycles kaput protein_id : NP_031741.1

name	EG665055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374870 GeneID:665055 MGI:3648350
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979306.1

name	Pdcl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937367 GeneID:79455 MGI:1890655
definition	codon_start : 1 note : protein B product : phosducin-like 2 protein_id : NP_075997.1

name	Nmu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506927 CCDS:CCDS19362.1 GeneID:56183 MGI:1860476
definition	GO_function : GO:0042922 - neuromedin U receptor binding [Evidence ISS] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence ISS] [Evidence IEA]; GO:0006940 - regulation of smooth muscle contraction [Evidence IEA] codon_start : 1 function : stimulates the contraction of smooth muscle product : neuromedin U protein_id : NP_062388.1

name	EG639545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149253979 GeneID:639545 MGI:3647743
definition	codon_start : 1 product : similar to hCG2040572 protein_id : XP_979434.2

name	Exoc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111939 GeneID:69940 MGI:2445020
definition	GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SEC3-like 1 protein_id : NP_081546.1

name	Cep135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841057 CCDS:CCDS19365.1 GeneID:381644 MGI:2681869
definition	codon_start : 1 product : centrosomal protein 4 protein_id : NP_950197.1

name	LOC100039117 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253973 GeneID:100039117
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472450.1

name	LOC100039299 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149253981 GeneID:100039299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472677.1

name	C530008M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374876 GeneID:320827 MGI:2444817
definition	codon_start : 1 product : hypothetical protein LOC320827 isoform 1 protein_id : XP_287460.5

name	A230062G08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348962 CCDS:CCDS19366.1 GeneID:231326 MGI:2442517
definition	EC_number : 1.2.1.31 GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0004043 - L-aminoadipate-semialdehyde dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : 2-aminoadipic 6-semialdehyde dehydrogenase product : RIKEN cDNA A230062G08 protein_id : NP_776126.1

name	Ppat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374854 GeneID:231327 MGI:2387203
definition	codon_start : 1 product : phosphoribosyl pyrophosphate amidotransferase isoform 5 protein_id : XP_979067.1

name	Ppat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94374856 GeneID:231327 MGI:2387203
definition	codon_start : 1 product : phosphoribosyl pyrophosphate amidotransferase isoform 4 protein_id : XP_979031.1

name	Ppat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82897714 GeneID:231327 MGI:2387203
definition	codon_start : 1 product : phosphoribosyl pyrophosphate amidotransferase isoform 3 protein_id : XP_901093.1

name	LOC664998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94374859 GeneID:664998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_979213.1

name	Paics (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385434 CCDS:CCDS19367.1 GeneID:67054 MGI:1914304
definition	GO_component : GO:0009320 - phosphoribosylaminoimidazole carboxylase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004638 - phosphoribosylaminoimidazole carboxylase activity [Evidence IEA]; GO:0004639 - phosphoribosylaminoimidazolesuccinocarboxamide synthase activity [Evidence IEA] GO_process : GO:0006189 - 'de novo' IMP biosynthesis [Evidence IEA]; GO:0006164 - purine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase protein_id : NP_080215.1

name	Srp72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118344452 GeneID:66661 MGI:1333795
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006614 - SRP-dependent cotranslational protein targeting to membrane [Evidence ISS] codon_start : 1 note : signal recognition particle 72 kDa product : signal recognition particle 72 protein_id : NP_079967.1

name	LOC100039083 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039083
definition	number : 1 pseudo : _no_value

name	LOC100039158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039158
definition	number : 2 pseudo : _no_value

name	LOC100039158 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039158
definition	number : 1 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 1 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 2 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 3 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 4 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 5 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 6 pseudo : _no_value

name	LOC100039169 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039169
definition	number : 7 pseudo : _no_value

name	LOC665065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665065
definition	number : 2 pseudo : _no_value

name	LOC665065 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665065
definition	number : 1 pseudo : _no_value

name	LOC665107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665107
definition	number : 1 pseudo : _no_value

name	A730089K16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149253974 GeneID:320411 MGI:2443970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs product : RIKEN cDNA A730089K16 gene transcript_id : XR_035181.1

clone name	MSMg01-164E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476N05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-448C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-496P03.T7 (MSMg01no496_p03.b1)	MSMg01-496P03.TJ (MSMg01no496_p03.g1)
ACC	AG573631	AG573632
length	795	901
length of high quality (start - end)	148 (74 - 221)	---
definition	CHROMAT_FILE: MSMg01no496_p03.b1 PHD_FILE: MSMg01no496_p03.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:22:27 2005	CHROMAT_FILE: MSMg01no496_p03.g1 PHD_FILE: MSMg01no496_p03.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 20:22:27 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NNNNGGGATCAAAATTGCGGTCCNAAACGACTCACATCGGATCGCAGCGC GGAATCTTNATTCANTATCAGGCTATGTAAGGAATTTCAGTCCTGAGCCC AGTTTCTTAGGTCTAAGATCTCTTAAGGGTCTACCTTCTCCTATTTTTCT GTATTTGTTTCATATGACATTTTGGGCAGGATTTGGGGCGAGGGTGGGAG TGGGAATGGGGGTGAGGGTGCCCNCNCCCCCCCCCGCCCCCTTTTTTTTT TTGCCGCNNTTCCCCCCCCCCCCCCAGCCCCCTCTCGCCNCNCCCCACCN GCCCCGCGTTTCCCTGCCTTTACACCNCCCCCCCCCCCCCCCCCCCCCCT TATCTCTTCTCCCCCACTTTAAACTCAGCTTTTTTCTTATTTCTTTTTTT TGTTTGACCAACATTCTTCCCAAANAATNAAAANTAAAAAGTAGAAGATT ATCAATTTTTTGCCTTTCCACTTATTACTTGGGTATTTTTCTTTTTTTCT CTTCCCATTTAAAACCTCCCTATCAGCTTTCCTTTTACCTCCTCACCATC CCCCCATCACTTTTTTTTTTATTTTTTTTTCCCCCCCCTCCTCTTTTTTT TTTTTCTCAATATCACTTCACTTTTTTTAGCATCTTTGTATCTCTTACAC CAAAACCCCCCTTAACTGTTACTCCCCCTCCACTTTATTTTTCTTCTCCT ATTTTTTTTTTGCCCGACTAATGTTTACATTTTTATTTCCCCCGGCTTAT TTTCTATACTTTCTTATTTTTATCCTCTTTTCTACATCCTGTTTN	GAGGGAAAGAAAAAGAGGGGGGATAAGAGAAGAGGAGGGGAAAACAAAAA AAAAGAAGAAGGAAAAAAACCNGGGTAAGGGGAAGAGGGGAGGGAAAAGG AAAAGAGAGGGGGAGAGAGAAAAAAAAGAAAGGGGAGAAAAAGAAAAAGA GGGGGTGAGAAAAAAAAAATGAAAAAAAGGGAGAAAAGAAGAAAAAGAAA ANAACGAAAAAGGGAGAGAGGAAAGGGAGAGGATGAGAAAGAGAAGAAGA GAAAAAATAAAGAGAGAATTNCAAAACAAGGAAAAACATNGTTGGGAAAA ATTAGGGAGAAAGAGNNCCCAACCAAAAAAGTGAAAAAGAGGGGGGAAAG GGACAGGAGNGGGGNNCGGNNTNGGTTTCAAGGGACCCAGAANGGGNAGG GNGGNACACNNAANATTTAATCGCACAAGAGAAAGAAAAGGGGNAAANNN GGNAGNAAAAAANGGAAGAAAGGGGGAAGANNGGGGNNGGGGANGGAAAA ANNNGGGAAANTAAAANAANNAAAAGGAGAGGGGGGGGGGGGAANCCCNG GGGGAAAAAANAAAAAAGGAAGNNNCAAAGGAAAAAGAAAGAAGAGGGNN NNNNNNNGGGAAAAAAAGAAAAGAGGGGGGGGGGGGGGGAAAAAAACANG NGGGGGGGGAGGGGAGAAAANNAAAAAAAAAAAAAAAAAAAAAAAGGGGG GGANAGGGGGGAAAGGAAAAAAAAAAGAAGAGCCCCCACAAAAAAAAAGG GGGAAACCCCGGGGAATAAAAAAAGGGGGAAAGACGACACAAAAACCGCG GGGGGAAAAAAAAGGGGGGAAAAANAAAGGGGGGACCAAGAGGGGGGGGA AGAAAAAAAAGGGGAGAAGAAAAAAAAAAGAGGAGGGTTTGTGTTTTTTT T
quality values	Open. Hide. 0 0 0 0 3 7 6 6 8 10 8 9 11 11 14 24 19 23 11 8 8 7 3 0 3 21 19 26 17 32 17 19 8 6 6 6 7 6 6 6 6 6 6 6 6 9 10 10 12 33 34 28 19 14 14 19 18 3 0 3 6 7 6 3 0 3 8 8 8 8 8 8 13 13 22 27 32 59 59 59 59 53 53 50 50 50 36 42 43 43 43 43 50 53 53 50 50 42 50 43 42 42 50 57 57 53 53 50 50 30 28 21 21 15 21 12 11 11 19 22 34 43 47 42 47 48 44 53 53 53 53 53 53 53 57 53 53 53 53 53 53 57 59 59 59 59 57 53 48 48 42 43 43 53 53 68 68 68 48 57 47 47 47 48 48 54 54 54 68 68 68 68 59 59 59 59 59 57 47 47 47 48 48 68 59 59 59 57 50 50 68 50 50 57 59 57 57 57 57 57 57 57 57 50 50 53 53 50 47 48 48 48 47 47 34 34 23 24 15 8 7 8 3 0 3 0 3 7 9 9 9 9 11 10 8 6 6 8 8 10 10 10 12 12 14 14 14 27 11 10 10 10 10 8 6 6 3 0 0 3 13 9 10 8 8 13 12 16 14 10 11 10 10 11 11 11 11 8 8 6 6 8 8 7 9 8 6 7 3 0 3 0 3 9 10 10 11 11 3 0 3 10 11 11 8 6 8 6 6 7 6 3 3 3 9 8 8 8 8 7 6 6 6 6 6 3 0 3 9 9 9 9 16 13 19 27 26 39 35 32 17 17 9 8 8 8 12 9 8 8 6 6 6 6 9 10 9 9 8 8 8 8 10 8 9 8 8 10 8 6 6 8 8 9 9 8 7 7 8 8 9 10 10 11 12 10 10 10 15 15 15 10 10 11 9 8 13 12 13 11 9 11 8 8 8 7 8 7 9 9 9 9 7 6 6 6 7 6 6 8 11 12 12 3 0 3 7 3 0 3 8 6 3 0 3 10 10 10 8 8 8 8 10 10 10 11 15 11 11 9 9 9 8 8 6 7 7 9 7 15 10 10 10 13 15 15 10 8 8 8 8 8 8 8 8 8 9 11 9 10 10 8 8 8 10 10 14 12 13 9 9 9 10 10 13 10 16 10 10 10 11 8 8 8 8 6 6 8 10 8 9 8 8 8 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 9 11 11 10 13 6 6 8 6 8 8 8 8 8 6 8 6 6 8 6 8 8 8 8 8 8 8 6 6 6 8 7 9 12 14 16 20 13 12 8 8 8 12 19 13 12 10 11 16 21 22 18 18 21 12 10 10 10 10 11 12 14 10 11 13 10 10 15 17 30 24 16 15 19 10 10 8 8 8 8 11 8 8 10 8 8 8 8 8 8 8 10 16 13 13 10 12 10 8 8 8 8 8 8 8 10 8 6 6 6 6 8 9 8 8 8 9 9 9 9 9 10 13 11 11 9 10 10 10 9 9 10 10 8 8 8 8 8 8 8 8 8 8 10 13 8 8 6 6 8 8 9 8 8 8 7 7 7 11 14 11 11 11 10 10 10 8 8 6 6 8 8 12 9 13 13 13 16 10 10 10 10 10 8 10 10 8 8 6 6 8 8 6 6 10 8 10 10 10 10 12 16 12 8 8 8 10 8 8 8 10 10 6 6 8 8 8 6 6 6 10 10 10 11 11 11 12 11 11 10 11 12 14 8 8 6 6 12 12 13 9 9 9 10 10 10 10 11 22 13 8 8 8 8 8 8 8 8 10 7 7 8 8 3 0	Open. Hide. 6 6 8 8 6 6 7 6 6 10 12 8 11 8 8 8 8 15 22 25 18 18 13 13 8 10 6 6 6 6 7 6 11 8 8 8 8 10 8 8 8 6 6 6 6 6 6 10 21 15 10 7 6 9 6 8 8 10 10 9 9 9 10 23 22 23 19 17 9 9 3 0 3 12 10 10 11 11 15 12 9 11 8 11 10 6 6 6 7 8 10 8 6 6 7 10 10 8 8 8 12 12 8 10 6 6 8 6 8 8 8 12 10 10 10 8 8 8 8 8 10 8 9 8 8 8 10 8 8 8 7 7 8 6 6 6 6 8 10 10 10 14 8 10 10 8 10 8 6 6 8 8 10 8 7 7 7 8 8 8 8 8 13 15 20 25 19 15 9 9 9 9 9 17 11 8 6 6 6 6 6 8 13 8 10 10 9 7 10 10 9 6 8 8 8 8 8 8 8 8 3 0 3 6 6 8 8 16 12 10 8 8 10 8 9 8 8 8 6 8 7 6 10 11 8 8 8 7 7 6 6 8 8 8 8 10 10 14 15 13 8 7 8 8 9 9 10 10 12 12 12 12 12 11 11 11 6 6 6 8 8 6 6 8 8 9 9 9 9 3 0 3 11 14 15 11 9 9 12 12 13 21 21 22 13 9 9 10 3 0 3 9 14 8 8 8 8 8 8 9 9 6 8 6 6 8 8 12 11 8 8 7 6 8 3 0 0 3 11 19 9 9 9 9 9 12 14 17 7 8 6 6 11 15 19 15 12 9 9 9 11 15 21 27 11 11 10 10 10 10 9 9 12 10 9 6 6 6 3 0 3 18 18 3 0 0 3 7 3 0 0 3 0 3 6 6 7 6 6 6 6 9 9 9 9 9 7 7 7 7 7 3 0 3 19 3 0 3 15 12 3 0 3 3 0 3 9 9 3 0 0 3 3 0 3 6 7 6 6 6 6 6 6 6 7 7 7 6 9 9 9 9 10 9 9 9 9 9 9 9 9 11 3 0 3 21 3 0 0 0 3 3 0 3 3 0 3 8 8 8 8 3 0 3 12 12 10 10 11 10 11 12 13 12 9 8 8 8 8 3 0 0 3 19 17 3 0 0 3 7 7 7 3 0 3 13 13 19 12 10 3 0 0 0 3 12 9 11 11 3 0 3 8 8 8 3 0 3 3 0 0 3 12 14 10 9 9 8 8 8 8 8 8 12 15 11 16 16 14 9 9 10 6 3 0 3 7 3 0 3 12 19 27 18 18 18 21 19 14 3 0 3 15 12 15 10 9 12 10 10 9 3 0 0 0 3 8 8 8 6 8 8 10 18 15 11 9 9 8 8 7 7 7 7 9 10 10 3 0 0 0 0 0 0 0 0 0 3 12 11 12 12 21 21 11 11 8 8 8 13 10 10 6 6 6 7 13 12 12 11 12 12 14 19 28 25 19 11 11 9 9 9 9 8 7 9 9 3 0 3 0 3 8 17 32 30 19 8 6 6 6 9 9 6 6 6 8 7 13 3 0 0 3 11 20 11 13 10 12 12 13 26 30 28 28 32 12 13 13 15 11 11 8 8 13 10 25 23 25 9 8 8 3 0 3 9 8 7 9 9 9 8 7 6 6 6 7 10 10 11 13 19 19 8 7 6 6 6 6 8 8 8 10 16 10 13 11 9 9 9 10 10 11 11 9 14 8 6 6 8 8 9 6 6 8 6 6 6 6 8 8 11 10 10 8 8 8 8 14 16 14 13 12 12 12 11 13 21 12 9 8 8 8 8 6 6 6 8 8 8 8 25 13 10 8 8 6 6 6 6 15 7 14 13 9 9 9 11 8 10 10 11 10 15 12 15 11 11 12 10 12 10 10 3 0 3 8 8 8 8 11 8 8 8 8 8 8 12 6 6 6 6 6 8 10 19 20 14 8 8 8 8 9 12 12 12 12 9 8 9 9 12 9 7 7 6 8 6 6 6 9 17 22 30 30 30 15 15 6 6 6 8 6 7 7 9 17 9 8 8 6 6 6 6 8 17 9 9 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no496_p03.b1 MSMg01no496_p03.b1 CHROMAT_FILE:
MSMg01no496_p03.b1 PHD_FILE: MSMg01no496_p03.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 20:22:27 2005
         (148 letters)



>mm_chr5_76425619_76426166
          Length = 548

 Score =  277 bits (143), Expect = 3e-79
 Identities = 146/147 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   tatgtaaggaatttcagtcctgagcccagtttcttaggtctaagatctcttaagggtcta 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 308 tatgtaaggaatttcagtcctgagcccagtttcttaggtctaagatctcttaagggtcta 249

                                                                       
Query: 61  ccttctcctatttttctgtatttgtttcatatgacattttgggcaggatttggggcgagg 120
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 248 ccttctcctatttttctgtatttgtttcatatgacattttgggcaggagttggggcgagg 189

                                      
Query: 121 gtgggagtgggaatgggggtgagggtg 147
           |||||||||||||||||||||||||||
Sbjct: 188 gtgggagtgggaatgggggtgagggtg 162


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 148
Length of database: 548
Length adjustment: 8
Effective length of query: 140
Effective length of database: 540
Effective search space:    75600
Effective search space used:    75600
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information