MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-037F01
Chromosome	6 (Build37)
Map Location	122,834,411 - 122,835,198
singlet/doublet	singlet
Overlap gene	Necap1
Upstream gene	Mug1, Mug4, Mug2, Mug-ps1, Klrg1, LOC625931, M6pr, Phc1, 1700063H04Rik, LOC677375, 4933426K21Rik, EG667035, Mfap5, Aicda, LOC667105, Apobec1, Gdf3, Dppa3, EG667107, LOC100043805, Nanog, LOC100038891, Slc2a3, LOC100043502, D530008I22, LOC100043505, Foxj2, C3ar1
Downstream gene	EG384482, Clec4a1, Clec4a3, Clec4a4, Clec4b1, Clec4a2, Clec4b2, Ppia-ps6_1344.1, Clec4n, Clec4d, Clec4e, EG232358, EG667180, LOC626436, EG546912, LOC100043511, Vmn2r-ps32, EG546913, LOC100043516, EG435916, EG243628, EG545874
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mug1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17836 MGI:99837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mug4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434083 MGI:101843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins

name	Mug2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17837 MGI:99836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mug-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17835 MGI:99838
definition	gene_synonym : Mug3 note : murinoglobulin, pseudogene 1 pseudo : _no_value

name	Klrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50928 MGI:1355294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 150 ESTs, 5 Proteins pseudo : _no_value

name	M6pr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17113 MGI:96904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700063H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74269 MGI:1921519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC677375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4933426K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108653 MGI:1918325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667035 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667035 MGI:3645406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 730 ESTs, 16 Proteins

name	Mfap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50530 MGI:1354387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aicda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11628 MGI:1342279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Apobec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11810 MGI:103298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14562 MGI:95686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dppa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73708 MGI:1920958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667107 MGI:3646670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 632 ESTs, 5 Proteins pseudo : _no_value

name	LOC100043805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1380 ESTs, 6 Proteins

name	Nanog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71950 MGI:1919200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038891 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20527 MGI:95757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043502 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 76 ESTs, 10 Proteins

name	D530008I22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:330414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC100043505 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Foxj2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60611 MGI:1926805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C3ar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12267 MGI:1097680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Necap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67602 MGI:1914852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384482 MGI:3645576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Clec4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269799 MGI:3036291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73149 MGI:1920399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:474145 MGI:3624119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69810 MGI:1917060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26888 MGI:1349412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381809 MGI:3588267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps6_1344.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545873
definition	note : peptidylprolyl isomerase A pseudogene 6_1344.1 pseudo : _no_value

name	Clec4n (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56620 MGI:1861231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17474 MGI:1298389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56619 MGI:1861232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232358 MGI:3647444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG667180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667180 MGI:3646439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC626436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG546912 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546912 MGI:3647953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100043511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps32 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG546913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546913 MGI:3647952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100043516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG435916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435916 MGI:3646826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG243628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243628 MGI:3647530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG545874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545874 MGI:3644645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 23 Proteins

name	Mug1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982170 GeneID:17836 MGI:99837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : murinoglobulin 1 transcript_id : NM_008645.2

name	Mug2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372249 GeneID:17837 MGI:99836
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : murinoglobulin 2 transcript_id : NM_008646.2

name	Klrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850224 GeneID:50928 MGI:1355294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily G, member 1 transcript_id : NM_016970.1

name	M6pr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087131 GeneID:17113 MGI:96904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-6-phosphate receptor, cation dependent transcript_id : NM_010749.6

name	Phc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835732 GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyhomeotic-like 1 (Drosophila) transcript_id : NM_001042623.1

name	Phc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835730 GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyhomeotic-like 1 (Drosophila) transcript_id : NM_007905.2

name	1700063H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255412 GeneID:74269 MGI:1921519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700063H04 gene transcript_id : XM_001481012.1

name	LOC677375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255298 GeneID:677375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC677375 transcript_id : XM_001480303.1

name	4933426K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134254428 GeneID:108653 MGI:1918325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933426K21 gene transcript_id : NM_027664.1

name	EG667035 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378075 GeneID:667035 MGI:3645406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 730 ESTs, 16 Proteins product : predicted gene, EG667035 transcript_id : XM_001002242.1

name	Mfap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131047 GeneID:50530 MGI:1354387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar associated protein 5 transcript_id : NM_015776.2

name	Aicda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940064 GeneID:11628 MGI:1342279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activation-induced cytidine deaminase transcript_id : NM_009645.2

name	Apobec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130296 GeneID:11810 MGI:103298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 1 transcript_id : NM_031159.3

name	Gdf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362178 GeneID:14562 MGI:95686
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 3 transcript_id : NM_008108.3

name	Dppa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21218415 GeneID:73708 MGI:1920958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : developmental pluripotency-associated 3 transcript_id : NM_139218.1

name	LOC100043805 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255415 GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1376 ESTs, 6 Proteins product : similar to ribosomal protein L15, transcript variant 1 transcript_id : XM_001481031.1

name	LOC100043805 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255417 GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1378 ESTs, 6 Proteins product : similar to ribosomal protein L15, transcript variant 2 transcript_id : XM_001481032.1

name	Nanog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625917 GeneID:71950 MGI:1919200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nanog homeobox transcript_id : NM_028016.1

name	LOC100038891 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255105 GeneID:100038891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038891 transcript_id : XM_001471588.1

name	Slc2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377808 GeneID:20527 MGI:95757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 3 transcript_id : NM_011401.3

name	LOC100043502 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255304 GeneID:100043502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 76 ESTs, 10 Proteins product : similar to uridine-cytidine kinase 1 transcript_id : XM_001480323.1

name	D530008I22 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255306 GeneID:330414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : hypothetical protein D530008I22 transcript_id : XM_001480324.1

name	LOC100043505 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255310 GeneID:100043505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043505 transcript_id : XM_001480329.1

name	Foxj2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254530 GeneID:60611 MGI:1926805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box J2 transcript_id : NM_021899.2

name	C3ar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753223 GeneID:12267 MGI:1097680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 3a receptor 1 transcript_id : NM_009779.1

name	Necap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370343 GeneID:67602 MGI:1914852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NECAP endocytosis associated 1 transcript_id : NM_026267.2

name	EG384482 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255419 GeneID:384482 MGI:3645576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG384482 transcript_id : XM_357669.4

name	Clec4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059160 GeneID:269799 MGI:3036291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member a1 transcript_id : NM_199311.1

name	Clec4a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625688 GeneID:73149 MGI:1920399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member a3 transcript_id : NM_153197.3

name	Clec4a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54312069 GeneID:474145 MGI:3624119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member a4 transcript_id : NM_001005860.1

name	Clec4b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368198 GeneID:69810 MGI:1917060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member b1 transcript_id : NM_027218.2

name	Clec4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350032 GeneID:26888 MGI:1349412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member a2 transcript_id : NM_011999.3

name	Clec4b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921312 GeneID:381809 MGI:3588267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member b2 transcript_id : NM_001004159.1

name	Clec4n (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910157 GeneID:56620 MGI:1861231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member n transcript_id : NM_020001.1

name	Clec4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350362 GeneID:17474 MGI:1298389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member d transcript_id : NM_010819.3

name	Clec4e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130533 GeneID:56619 MGI:1861232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member e transcript_id : NM_019948.2

name	EG232358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83029645 GeneID:232358 MGI:3647444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG232358 transcript_id : XM_144965.4

name	EG667180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378087 GeneID:667180 MGI:3646439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667180 transcript_id : XM_988849.1

name	EG546912 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83029647 GeneID:546912 MGI:3647953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG546912 transcript_id : XM_887513.1

name	EG546913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255420 GeneID:546913 MGI:3647952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG546913 transcript_id : XM_621729.4

name	LOC100043516 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255314 GeneID:100043516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to gag transcript_id : XM_001480348.1

name	EG435916 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63548770 GeneID:435916 MGI:3646826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG435916 transcript_id : XM_487960.2

name	EG243628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83029659 GeneID:243628 MGI:3647530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG243628 transcript_id : XM_144968.5

name	EG545874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255422 GeneID:545874 MGI:3644645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 23 Proteins product : predicted gene, EG545874 transcript_id : XM_620361.4

name	Mug1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982171 GeneID:17836 MGI:99837
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 product : murinoglobulin 1 protein_id : NP_032671.2

name	Mug2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678966 GeneID:17837 MGI:99836
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : murinoglobulin 2 protein_id : NP_032672.1

name	Klrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850225 CCDS:CCDS20492.1 GeneID:50928 MGI:1355294
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence TAS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 product : killer cell lectin-like receptor subfamily G, member 1 protein_id : NP_058666.1

name	M6pr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14916479 CCDS:CCDS20493.1 GeneID:17113 MGI:96904
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA]; GO:0000323 - lytic vacuole [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence IEA]; GO:0015578 - mannose transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015761 - mannose transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mannose-6-phosphate receptor, cation dependent protein_id : NP_034879.2

name	Phc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835733 GeneID:13619 MGI:103248
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; early development regulator1 (homolog of polyhomeotic 1); early development regulator 1 (homolog of polyhomeotic 1) product : polyhomeotic-like 1 isoform b protein_id : NP_001036088.1

name	Phc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835731 CCDS:CCDS20494.1 GeneID:13619 MGI:103248
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; early development regulator1 (homolog of polyhomeotic 1); early development regulator 1 (homolog of polyhomeotic 1) product : polyhomeotic-like 1 isoform a protein_id : NP_031931.2

name	1700063H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255413 GeneID:74269 MGI:1921519
definition	codon_start : 1 product : hypothetical protein LOC74269 protein_id : XP_001481062.1

name	LOC677375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255299 GeneID:677375
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480353.1

name	4933426K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134254429 GeneID:108653 MGI:1918325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006464 - protein modification [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC108653 protein_id : NP_081940.1

name	EG667035 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378076 GeneID:667035 MGI:3645406
definition	codon_start : 1 product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) protein_id : XP_001002242.1

name	Mfap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657329 CCDS:CCDS20496.1 GeneID:50530 MGI:1354387
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0001527 - microfibril [Evidence TAS] GO_function : GO:0030023 - extracellular matrix constituent conferring elasticity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : microfibrillar associated protein 5 protein_id : NP_056591.1

name	Aicda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753018 CCDS:CCDS20497.1 GeneID:11628 MGI:1342279
definition	EC_number : 3.5.4.5 GO_function : GO:0004126 - cytidine deaminase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : activation induced deaminase product : activation-induced cytidine deaminase protein_id : NP_033775.1

name	Apobec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624299 CCDS:CCDS20498.1 GeneID:11810 MGI:103298
definition	GO_function : GO:0004126 - cytidine deaminase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016554 - cytidine to uridine editing [Evidence IMP]; GO:0042157 - lipoprotein metabolism [Evidence IMP]; GO:0006381 - mRNA editing [Evidence IMP]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 1 protein_id : NP_112436.1

name	Gdf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677587 CCDS:CCDS20499.1 GeneID:14562 MGI:95686
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0040007 - growth [Evidence IEA] codon_start : 1 product : growth differentiation factor 3 protein_id : NP_032134.2

name	Dppa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218416 CCDS:CCDS20500.1 GeneID:73708 MGI:1920958
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0001940 - male pronucleus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0040016 - embryonic cleavage [Evidence IMP] codon_start : 1 note : primordial germ cell 7 product : developmental pluripotency-associated 3 protein_id : NP_631964.1

name	LOC100043805 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255416 GeneID:100043805
definition	codon_start : 1 product : similar to ribosomal protein L15 isoform 1 protein_id : XP_001481081.1

name	LOC100043805 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255418 GeneID:100043805
definition	codon_start : 1 product : similar to ribosomal protein L15 isoform 2 protein_id : XP_001481082.1

name	Nanog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625918 GeneID:71950 MGI:1919200
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0009880 - embryonic pattern specification [Evidence IEP]; GO:0008406 - gonad development [Evidence IEP]; GO:0042664 - negative regulation of endodermal cell fate specification [Evidence TAS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0017145 - stem cell division [Evidence IDA] codon_start : 1 note : early embryo specific expression NK family product : homeobox transcription factor Nanog protein_id : NP_082292.1

name	LOC100038891 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255106 GeneID:100038891
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471638.1

name	Slc2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543726 CCDS:CCDS20502.1 GeneID:20527 MGI:95757
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 2 (facilitated glucose transporter), member 3 protein_id : NP_035531.2

name	LOC100043502 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255305 GeneID:100043502
definition	codon_start : 1 product : similar to uridine-cytidine kinase 1 protein_id : XP_001480373.1

name	D530008I22 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255307 GeneID:330414
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480374.1

name	LOC100043505 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255311 GeneID:100043505
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480379.1

name	Foxj2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230810 CCDS:CCDS20503.1 GeneID:60611 MGI:1926805
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box J2 protein_id : NP_068699.1

name	C3ar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753224 CCDS:CCDS20504.1 GeneID:12267 MGI:1097680
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004942 - anaphylatoxin receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006956 - complement activation [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : anaphylatoxin C3a receptor product : complement component 3a receptor 1 protein_id : NP_033909.1

name	Necap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229051 CCDS:CCDS20505.1 GeneID:67602 MGI:1914852
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IDA]; GO:0005905 - coated pit [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA] [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : snoRNA MBI-129; brain enriched NECAP2 similar protein; clathrin-coated vesicle coat protein product : adaptin-ear-binding coat-associated protein 1 protein_id : NP_080543.2

name	EG384482 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085129 GeneID:384482 MGI:3645576
definition	codon_start : 1 product : similar to mitochondrial ribosomal protein S21 protein_id : XP_357669.1

name	Clec4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059161 CCDS:CCDS20507.1 GeneID:269799 MGI:3036291
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : dendritic cell inhibitory receptor 4 product : C-type lectin domain family 4, member a1 protein_id : NP_955015.1

name	Clec4a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54291706 CCDS:CCDS20508.1 GeneID:73149 MGI:1920399
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : dendritic cell inhibitory receptor 3 protein_id : NP_694877.2

name	Clec4a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312070 CCDS:CCDS20509.1 GeneID:474145 MGI:3624119
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : dendritic cell inhibitory receptor 2 protein_id : NP_001005860.1

name	Clec4b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386214 GeneID:69810 MGI:1917060
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : antigen presenting cell lectin-like receptor A2 product : dendritic cell immunoactivating receptor protein_id : NP_081494.1

name	Clec4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753442 CCDS:CCDS20510.1 GeneID:26888 MGI:1349412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005529 - sugar binding [Evidence TAS] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : dendritic cell immunoreceptor; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 6 product : C-type lectin domain family 4, member a2 protein_id : NP_036129.1

name	Clec4b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921313 CCDS:CCDS20511.1 GeneID:381809 MGI:3588267
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : antigen presenting cell lectin-like receptor A1 protein_id : NP_001004159.1

name	Clec4n (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910158 CCDS:CCDS20512.1 GeneID:56620 MGI:1861231
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 10 product : C-type lectin domain family 4, member n protein_id : NP_064385.1

name	Clec4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098075 CCDS:CCDS20513.1 GeneID:17474 MGI:1298389
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : macrophage C-type lectin; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 8; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 9 product : C-type lectin, superfamily member 8 protein_id : NP_034949.2

name	Clec4e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910162 CCDS:CCDS20514.1 GeneID:56619 MGI:1861232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 9 product : C-type lectin, superfamily member 9 protein_id : NP_064332.1

name	EG232358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029646 GeneID:232358 MGI:3647444
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_144965.4

name	EG667180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378088 GeneID:667180 MGI:3646439
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_993943.1

name	EG546912 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029648 GeneID:546912 MGI:3647953
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_892606.1

name	EG546913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255421 GeneID:546913 MGI:3647952
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_621729.4

name	LOC100043516 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255315 GeneID:100043516
definition	codon_start : 1 product : similar to gag protein_id : XP_001480398.1

name	EG435916 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63548771 GeneID:435916 MGI:3646826
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_487960.2

name	EG243628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029660 GeneID:243628 MGI:3647530
definition	codon_start : 1 product : similar to putative pheromone receptor V2R1b protein_id : XP_144968.5

name	EG545874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029664 GeneID:545874 MGI:3644645
definition	codon_start : 1 product : similar to Vomeronasal type-2 receptor 1b precursor (Putative pheromone receptor V2R1b) protein_id : XP_620361.2

name	LOC667105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667105
definition	number : 2 pseudo : _no_value

name	LOC667105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667105
definition	number : 1 pseudo : _no_value

name	LOC626436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626436
definition	number : 1 pseudo : _no_value

name	LOC100043511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043511
definition	number : 3 pseudo : _no_value

name	LOC100043511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043511
definition	number : 2 pseudo : _no_value

name	LOC100043511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043511
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps32 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043512
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:159566
definition	standard_name : MHAa82c12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:159566
definition	standard_name : MHAa82c12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:160950
definition	standard_name : RH118304

name	(CDS detail)
type	STS
link
xref	UniSTS:185684
definition	standard_name : AF097357

name	(CDS detail)
type	STS
link
xref	UniSTS:179456
definition	standard_name : AW557034

name	(CDS detail)
type	STS
link
xref	UniSTS:235548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235549
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:225109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179455
definition	standard_name : AI325948

name	(CDS detail)
type	STS
link
xref	UniSTS:224890
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:209818
definition	standard_name : RH127292

name	(CDS detail)
type	STS
link
xref	UniSTS:179458
definition	standard_name : C78318

name	(CDS detail)
type	STS
link
xref	UniSTS:496657
definition	standard_name : Gdf3

name	(CDS detail)
type	STS
link
xref	UniSTS:498798
definition	standard_name : Nanog

name	(CDS detail)
type	STS
link
xref	UniSTS:163064
definition	standard_name : RH126356

name	(CDS detail)
type	STS
link
xref	UniSTS:124798
definition	standard_name : D19270

name	(CDS detail)
type	STS
link
xref	UniSTS:161573
definition	standard_name : RH124751

name	(CDS detail)
type	STS
link
xref	UniSTS:159568
definition	standard_name : AU040424

name	(CDS detail)
type	STS
link
xref	UniSTS:235551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162343
definition	standard_name : RH125527

name	(CDS detail)
type	STS
link
xref	UniSTS:235552
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125668
definition	standard_name : U11853

name	(CDS detail)
type	STS
link
xref	UniSTS:271942
definition	standard_name : PMC20520P1

name	(CDS detail)
type	STS
link
xref	UniSTS:144424
definition	standard_name : Slc2a3

name	(CDS detail)
type	STS
link
xref	UniSTS:144425
definition	standard_name : Slc2a3

name	(CDS detail)
type	STS
link
xref	UniSTS:144426
definition	standard_name : Slc2a3

name	(CDS detail)
type	STS
link
xref	UniSTS:130697
definition	standard_name : D6Mit151

name	(CDS detail)
type	STS
link
xref	UniSTS:144729
definition	standard_name : Umpk

name	(CDS detail)
type	STS
link
xref	UniSTS:208029
definition	standard_name : AU022706

name	(CDS detail)
type	STS
link
xref	UniSTS:159569
definition	standard_name : AF053757

name	(CDS detail)
type	STS
link
xref	UniSTS:164679
definition	standard_name : C3ar1

name	(CDS detail)
type	STS
link
xref	UniSTS:179457
definition	standard_name : AI747569

name	(CDS detail)
type	STS
link
xref	UniSTS:16987
definition	standard_name : D12S1331

name	(CDS detail)
type	STS
link
xref	UniSTS:130851
definition	standard_name : D6Mit300

name	(CDS detail)
type	STS
link
xref	UniSTS:235554
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:209815
definition	standard_name : RH127282

name	(CDS detail)
type	STS
link
xref	UniSTS:159567
definition	standard_name : C86253

name	(CDS detail)
type	misc_feature
link
xref
definition	function : clone overlap note : overlaps bases 1..54896 of clone AC153579

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : variable size of repeat between subclones gene_synonym : Mug3 note : variable size of repeat (polyAGGCAG) in subclone, size 23-25, deletion at 77806 pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : pcr product sequence only gene_synonym : Mug3 note : PCR product sequence only pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : unsure gene_synonym : Mug3 note : unsure base: C/T pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : single clone coverage gene_synonym : Mug3 note : single subclone pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : variable size of repeat between subclones gene_synonym : Mug3 note : variable size of repeat (polyGA) in subclone, size 27-28, deletion at 88510 pseudo : _no_value

name	Mug4 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255294 GeneID:434083 MGI:101843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : murinoglobulin 4 transcript_id : XR_035731.1

name	LOC625931 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255295 GeneID:625931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 150 ESTs, 5 Proteins product : similar to nuclear protein-NHP2-like protein pseudo : _no_value transcript_id : XR_034615.1

name	EG667107 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255414 GeneID:667107 MGI:3646670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 632 ESTs, 5 Proteins product : predicted gene, EG667107 pseudo : _no_value transcript_id : XR_001974.2

clone name	MSMg01-422L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190E11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-467G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-380L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197M10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526L13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338J02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110E07
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-082K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209G17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name		B6Ng01-037F01.g
ACC		DH865230
length		781
definition		DH865230\|Mus musculus domesticus DNA, BAC clone: B6Ng01-037F01, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence		gaattcactagatactagaccaggctggccttgaatttagagcagtctgc ctgcctctgcctctcgagagctggaaataaaggtgtgccagtacttatgg cttaaattgaactctttataaaattgttcttagcagatttggttttatgt gcatgcgttttgtttgcacgcctatttgtgctgcatgtgtttgcagtgcc cttggccagaagagagcgttagattggaaggaggaactggaagtggaagt gtagatgactttgagccatcatgtgggccctgggaactgaccctggaccc tctggaaaaggagccatctctccaagctcccctcccactacctttgacac agtatctcctgtaacctaggctggcctcaaacttgttatgtagctgagga ttgctttgaactcttgatcttcctaccttccttgtgcagagataccatgt gtgggccactgtgcttgtatttcttatatgattacttttttaaaataatt ttttaaaagatttatttatttatgtaatgtatatgagtacattatgagta ctgatggttgtgagccatcatgtggttgctggaaatttgatttcaggacc ccgcttgctctggcctaaagattatttattatatgtacatacactgaagg ctgtcttcagacacacagagaggatgtcagatctcattacggatggttga gagcacatgtgggtgctaggatttgacctagaacttcaaagagtagtctg tgtcctaaccgctgaggcatctctccagcct
quality values		Open. Hide. 52 30 52 49 61 49 14 31 21 11 9 12 18 15 59 59 59 52 59 59 59 59 52 59 49 59 59 59 45 59 61 59 59 59 59 61 61 61 59 59 61 59 59 59 44 59 59 59 59 59 52 28 30 44 44 45 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 50 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 47 55 61 61 61 61 61 61 61 61 61 55 61 55 61 61 50 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 53 53 53 61 53 47 61 53 53 61 61 61 61 61 61 61 61 61 61 53 61 52 61 61 61 43 61 53 61 61 61 61 61 61 61 53 61 61 52 57 57 53 53 47 42 57 53 45 47 53 53 57 47 41 16 57 37 27 57 57 53 57 57 57 53 57 57 53 53 57 53 53 57 43 53 45 53 53 50 53 37 43 43 53 53 52 50 57 50 53 57 34 53 42 52 50 57 52 39 50 33 53 39 38 47 53 42 52 40 52 57 41 38 38 38 41 52 52 18 37 45 40 32 37 33 52 52 52 53 52 38 53 47 42 42 31 39 50 20 36 39 50 50 57 57 57 57 31 25 57 57 37 33 37 53 38 52 57 57 46 41 25 57 57 40 25 42 37 57 31 37 37 57 36 37 33 57 53 39 39 53 30 37 41 30 46 14 30 40 34 40 53 48 37 29 31 48 25 32 32 40 29 37 53 30 37 33 34 29 31 29 18 33 33 28 32 29 19 30 47 14 24 48 25 31 31 23 33 48 30 44 15 8 31 25 31 35 33 29 34 36 22 10 44 25 12 29 31 48 32 27 12 20 23 28 21 51 51 31 21 20 24 29 29 20 29 29 23 24 29 15 31 11 10 46 28 15 31 31 33 27 39 51 34 29 34 21 25 23 11 19 29 23 23 27 12 30 12 27 22 29 27 27 14 15 36 28 24 27 7 5 10 13 23 28 20 10 30 16 14 15 5 8 15 5 16 5 32 8 24 14 11 29 22 34 14 8 24 8 20 21 23 19 16 38 16 16 20 19 24 6 17 29 22 13 15 20 13 19 12 38 7 17 8 21 19 19 31 38 9 13 14 20 11 19 17 17 11 17 35 30 20 28 10 5 21 7 5 5 13 34 21 38 7 4 4 9 5 25 7 32 12 8 19 14 9 6 5 10 6 10 5 20 6 16 15 19 14 9 17 7 5 5 6 16 5 10 6 4 4 5 20 11 8 9 15 22 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_122834411_122835198
seq2: B6Ng01-037F01.g_68_847

seq1  GAATTCACTAGATACTAGACCAGGCTGGCCTTGAATTTAGAGCAGTCTGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTAGATACTAGACCAGGCTGGCCTTGAATTTAGAGCAGTCTGC  50

seq1  CTGCCTCTGCCTCTCGAGAGCTGGAAATAAAGGTGTGCCAGTACTTATGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTCTGCCTCTCGAGAGCTGGAAATAAAGGTGTGCCAGTACTTATGG  100

seq1  CTTAAATTGAACTCTTTATAAAATTGTTCTTAGCAGATTTGGTTTTATGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAATTGAACTCTTTATAAAATTGTTCTTAGCAGATTTGGTTTTATGT  150

seq1  GCATGCGTTTTGTTTGCACGCCTATTTGTGCTGCATGTGTTTGCAGTGCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCGTTTTGTTTGCACGCCTATTTGTGCTGCATGTGTTTGCAGTGCC  200

seq1  CTTGGCCAGAAGAGAGCGTTAGATTGGAAGGAGGAACTGGAAGTGGAAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGCCAGAAGAGAGCGTTAGATTGGAAGGAGGAACTGGAAGTGGAAGT  250

seq1  GTAGATGACTTTGAGCCATCATGTGGGCCCTGGGAACTGACCCTGGACCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGATGACTTTGAGCCATCATGTGGGCCCTGGGAACTGACCCTGGACCC  300

seq1  TCTGGAAAAGGAGCCATCTCTCCAAGCTCCCCTCCCACTACCTTTGACAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAAAGGAGCCATCTCTCCAAGCTCCCCTCCCACTACCTTTGACAC  350

seq1  AGTATCTCCTGTAACCTAGGCTGGCCTCAAACTTGTTATGTAGCTGAGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATCTCCTGTAACCTAGGCTGGCCTCAAACTTGTTATGTAGCTGAGGA  400

seq1  TTGCTTTGAACTCTTGATCTTCCTACCTTCCTTGTGCAGAGATACCATGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTTGAACTCTTGATCTTCCTACCTTCCTTGTGCAGAGATACCATGT  450

seq1  GTGGGCCACTGTGCTTGTATTTCTTATATGATTACTTTTTTAAAATAATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGCCACTGTGCTTGTATTTCTTATATGATTACTTTTTTAAAATAATT  500

seq1  TTTTAAAAGATTTATTTATTTATGTAATGTATATGAGTACATTATGAGTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAAAAGATTTATTTATTTATGTAATGTATATGAGTACATTATGAGTA  550

seq1  CTGATGGTTGTGAGCCATCATGTGGTTGCTGGAAATTTGATTTCAGGACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGGTTGTGAGCCATCATGTGGTTGCTGGAAATTTGATTTCAGGACC  600

seq1  CCGCTTGCTCTGGCCTAAAGATTTATTTATTATATGTACATACACTG-AG  649
      ||||||||||||||||||||| ||||||||||||||||||||||||| ||
seq2  CCGCTTGCTCTGGCCTAAAGA-TTATTTATTATATGTACATACACTGAAG  649

seq1  GCTGTCTTCAGACACACCAGAAGAGGATGTCAGATCTCATTACGGATGGT  699
      |||||||||||||||| ||| |||||||||||||||||||||||||||||
seq2  GCTGTCTTCAGACACA-CAG-AGAGGATGTCAGATCTCATTACGGATGGT  697

seq1  TGAGAGCCACCATGTGGGTGCTAGGATTTGAACTTAGGACCTTCAGAAGA  749
      |||||||   ||||||||||||||||||||| ||   || ||||| ||||
seq2  TGAGAGC--ACATGTGGGTGCTAGGATTTGACCT--AGAACTTCA-AAGA  742

seq1  GTAGTCTGTGCTCTTAACCGCTGAGCCATCTCTCCAGCC  788
      |||||||||| || ||||||||||| |||||||||||||
seq2  GTAGTCTGTG-TCCTAACCGCTGAGGCATCTCTCCAGCC  780

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information