MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-083P10
Chromosome	6 (Build37)
Map Location	57,350,816 - 57,351,972
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG666688, Lsm5, 5830411G16Rik, LOC100042288, Kbtbd2, Fkbp9, Nt5c3, LOC100042327, V1rc21, V1rc19, V1rc20, EG434016, V1rc32, V1rc30, V1rc1, V1rc3, EG626397, V1rc4, V1rc5, V1rc7, V1rc6, LOC100041445, V1r-ps6, V1rc29, V1rc16, V1rc26
Downstream gene	V1rc27, EG434017, LOC666822, Ppm1k, Herc5, Pigy, Lancl2, AW146242, V1rc28, LOC626582, V1rc23, V1rc24, LOC100041514, V1rc18, V1rc8, V1rc17, EG633683, LOC626649, LOC626659, LOC626672, LOC666893, LOC100041571, V1rc33, LOC626724, V1rc25, V1rc2
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG666688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666688 MGI:3644042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Lsm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66373 MGI:1913623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830411G16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78937 MGI:1926187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 141 ESTs, 3 Proteins

name	LOC100042288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein pseudo : _no_value

name	Kbtbd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210973 MGI:2384811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27055 MGI:1350921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nt5c3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107569 MGI:1927186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	V1rc21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171194 MGI:2159457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171192 MGI:2159455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171193 MGI:2159456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434016 MGI:3644380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 Proteins

name	V1rc32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171205 MGI:2159469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171203 MGI:2159466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113858 MGI:2148522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113860 MGI:2148524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626397 MGI:3645555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 Proteins

name	V1rc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113861 MGI:2148525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	V1rc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113862 MGI:2148526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113864 MGI:2148528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113863 MGI:2148527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	V1r-ps6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113874 MGI:2148536
definition	note : vomeronasal 1 receptor, pseudogene 6 pseudo : _no_value

name	V1rc29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171202 MGI:2159465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171189 MGI:2159452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171199 MGI:2159462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171200 MGI:2159463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434017 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434017 MGI:3644381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 Proteins

name	LOC666822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppm1k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243382 MGI:2442111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Herc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 62 ESTs, 3 Proteins

name	Pigy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66459 MGI:1913709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lancl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71835 MGI:1919085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW146242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232023 MGI:2141658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171201 MGI:2159464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626582 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 Proteins

name	V1rc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171196 MGI:2159459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171197 MGI:2159460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	V1rc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171191 MGI:2159454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113865 MGI:2148529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171190 MGI:2159453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG633683 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633683 MGI:3647234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 910 ESTs, 7 Proteins

name	LOC626649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins pseudo : _no_value

name	LOC626659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins pseudo : _no_value

name	LOC626672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC666893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100041571 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041571
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1rc33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171206 MGI:2159470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	V1rc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171198 MGI:2159461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113859 MGI:2148523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377385 GeneID:666688 MGI:3644042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG666688 transcript_id : XM_985410.1

name	Lsm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476201 GeneID:66373 MGI:1913623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_025520.2

name	5830411G16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377387 GeneID:78937 MGI:1926187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 141 ESTs, 3 Proteins product : RIKEN cDNA 5830411G16 gene, transcript variant 1 transcript_id : XM_132538.6

name	Kbtbd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122390 GeneID:210973 MGI:2384811
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch repeat and BTB (POZ) domain containing 2 transcript_id : NM_145958.1

name	Fkbp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532951 GeneID:27055 MGI:1350921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 9 transcript_id : NM_012056.1

name	Nt5c3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348961 GeneID:107569 MGI:1927186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase, cytosolic III transcript_id : NM_026004.2

name	LOC100042327 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255195 GeneID:100042327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042327 transcript_id : XM_001478378.1

name	V1rc21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717672 GeneID:171194 MGI:2159457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C21 transcript_id : NM_134176.1

name	V1rc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922604 GeneID:171192 MGI:2159455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C19 transcript_id : NM_134174.2

name	V1rc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717678 GeneID:171193 MGI:2159456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C20 transcript_id : NM_134175.1

name	EG434016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255142 GeneID:434016 MGI:3644380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 58 Proteins product : predicted gene, EG434016 transcript_id : XM_620311.3

name	V1rc32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821673 GeneID:171205 MGI:2159469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C32 transcript_id : NM_134187.3

name	V1rc30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717698 GeneID:171203 MGI:2159466
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C30 transcript_id : NM_134185.1

name	V1rc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200346 GeneID:113858 MGI:2148522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C1 transcript_id : NM_053231.2

name	V1rc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716548 GeneID:113860 MGI:2148524
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C3 transcript_id : NM_053233.1

name	EG626397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82901075 GeneID:626397 MGI:3645555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 52 Proteins product : predicted gene, EG626397 transcript_id : XM_890986.1

name	V1rc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611162 GeneID:113862 MGI:2148526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C5 transcript_id : NM_053235.2

name	V1rc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611160 GeneID:113864 MGI:2148528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C7 transcript_id : NM_053237.2

name	V1rc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716554 GeneID:113863 MGI:2148527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C6 transcript_id : NM_053236.1

name	V1rc29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611911 GeneID:171202 MGI:2159465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C29 transcript_id : NM_134184.2

name	V1rc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717670 GeneID:171189 MGI:2159452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C16 transcript_id : NM_134171.1

name	V1rc26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717690 GeneID:171199 MGI:2159462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C26 transcript_id : NM_134181.1

name	V1rc27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717684 GeneID:171200 MGI:2159463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C27 transcript_id : NM_134182.1

name	EG434017 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51711991 GeneID:434017 MGI:3644381
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 Proteins product : predicted gene, EG434017 transcript_id : XM_485760.1

name	Ppm1k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130282 GeneID:243382 MGI:2442111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1K (PP2C domain containing) transcript_id : NM_175523.4

name	Herc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255197 GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 61 ESTs, 3 Proteins product : hect domain and RLD 5, transcript variant 1 transcript_id : XM_001478484.1

name	Herc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255199 GeneID:67138 MGI:1914388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 1 Protein product : hect domain and RLD 5, transcript variant 2 transcript_id : XM_001478497.1

name	Pigy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133930791 GeneID:66459 MGI:1913709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class Y transcript_id : NM_025574.3

name	Lancl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526935 GeneID:71835 MGI:1919085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LanC (bacterial lantibiotic synthetase component C)-like 2 transcript_id : NM_133737.1

name	AW146242 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122698 GeneID:232023 MGI:2141658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW146242 transcript_id : NM_146168.1

name	V1rc28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717694 GeneID:171201 MGI:2159464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C28 transcript_id : NM_134183.1

name	LOC626582 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255147 GeneID:626582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 Proteins product : similar to vomeronasal receptor V1RC18 transcript_id : XM_001476469.1

name	V1rc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717676 GeneID:171196 MGI:2159459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C23 transcript_id : NM_134178.1

name	V1rc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717686 GeneID:171197 MGI:2159460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C24 transcript_id : NM_134179.1

name	V1rc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717674 GeneID:171191 MGI:2159454
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C18 transcript_id : NM_134173.1

name	V1rc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110611164 GeneID:113865 MGI:2148529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C8 transcript_id : NM_053238.2

name	V1rc17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717664 GeneID:171190 MGI:2159453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C17 transcript_id : NM_134172.1

name	EG633683 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377389 GeneID:633683 MGI:3647234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 909 ESTs, 7 Proteins product : predicted gene, EG633683 transcript_id : XM_986705.1

name	V1rc33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717792 GeneID:171206 MGI:2159470
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C33 transcript_id : NM_134436.1

name	V1rc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717680 GeneID:171198 MGI:2159461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C25 transcript_id : NM_134180.1

name	V1rc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716546 GeneID:113859 MGI:2148523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, C2 transcript_id : NM_053232.1

name	EG666688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377386 GeneID:666688 MGI:3644042
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990504.1

name	Lsm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384942 GeneID:66373 MGI:1913623
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM5 homolog, U6 small nuclear RNA associated protein_id : NP_079796.1

name	5830411G16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377388 GeneID:78937 MGI:1926187
definition	codon_start : 1 product : hypothetical protein LOC78937 isoform 1 protein_id : XP_132538.5

name	Kbtbd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122391 GeneID:210973 MGI:2384811
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : BTB and kelch domain containing 1 product : kelch repeat and BTB (POZ) domain containing 2 protein_id : NP_666070.1

name	Fkbp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532952 GeneID:27055 MGI:1350921
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA] [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] [Evidence IDA] codon_start : 1 exception : mismatches in translation product : FK506 binding protein 9 protein_id : NP_036186.1

name	Nt5c3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229034 CCDS:CCDS20171.1 GeneID:107569 MGI:1927186
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS] GO_function : GO:0008665 - 2'-phosphotransferase activity [Evidence ISS]; GO:0008253 - 5'-nucleotidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006213 - pyrimidine nucleoside metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : uridine monophosphatase 1; 5'-nucleotidase, pyrimidine product : 5'-nucleotidase, cytosolic III protein_id : NP_080280.2

name	LOC100042327 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255196 GeneID:100042327
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478428.1

name	V1rc21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717673 CCDS:CCDS20172.1 GeneID:171194 MGI:2159457
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C21 protein_id : NP_598937.1

name	V1rc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922605 GeneID:171192 MGI:2159455
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C19 protein_id : NP_598935.2

name	V1rc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717679 CCDS:CCDS20173.1 GeneID:171193 MGI:2159456
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C20 protein_id : NP_598936.1

name	EG434016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255143 GeneID:434016 MGI:3644380
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC31 protein_id : XP_620311.3

name	V1rc32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717693 CCDS:CCDS20174.1 GeneID:171205 MGI:2159469
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal 1 receptor, C30 product : vomeronasal 1 receptor, C32 protein_id : NP_598948.1

name	V1rc30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717699 GeneID:171203 MGI:2159466
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C30 protein_id : NP_598946.1

name	V1rc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200347 GeneID:113858 MGI:2148522
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C1 protein_id : NP_444461.2

name	V1rc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716549 CCDS:CCDS20175.1 GeneID:113860 MGI:2148524
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C3 protein_id : NP_444463.1

name	EG626397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901076 GeneID:626397 MGI:3645555
definition	codon_start : 1 product : similar to vomeronasal 1 receptor, C7 protein_id : XP_896079.1

name	V1rc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611163 CCDS:CCDS20176.1 GeneID:113862 MGI:2148526
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C5 protein_id : NP_444465.2

name	V1rc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611161 CCDS:CCDS20177.1 GeneID:113864 MGI:2148528
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C7 protein_id : NP_444467.2

name	V1rc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716555 CCDS:CCDS20178.1 GeneID:113863 MGI:2148527
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C6 protein_id : NP_444466.1

name	V1rc29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611912 CCDS:CCDS20179.1 GeneID:171202 MGI:2159465
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C29 protein_id : NP_598945.2

name	V1rc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717671 CCDS:CCDS20180.1 GeneID:171189 MGI:2159452
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C16 protein_id : NP_598932.1

name	V1rc26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717691 CCDS:CCDS20181.1 GeneID:171199 MGI:2159462
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C26 protein_id : NP_598942.1

name	V1rc27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717685 CCDS:CCDS20182.1 GeneID:171200 MGI:2159463
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C27 protein_id : NP_598943.1

name	EG434017 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82901084 GeneID:434017 MGI:3644381
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC33 protein_id : XP_485760.3

name	Ppm1k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425290 CCDS:CCDS20183.1 GeneID:243382 MGI:2442111
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] codon_start : 1 product : protein phosphatase 1K (PP2C domain containing) protein_id : NP_780732.1

name	Herc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255198 GeneID:67138 MGI:1914388
definition	codon_start : 1 product : hect domain and RLD 5 isoform 1 protein_id : XP_001478534.1

name	Herc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255200 GeneID:67138 MGI:1914388
definition	codon_start : 1 product : hect domain and RLD 5 isoform 2 protein_id : XP_001478547.1

name	Pigy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313456 CCDS:CCDS20184.1 GeneID:66459 MGI:1913709
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000506 - glycosylphosphatidylinositol-N- acetylglucosaminyltransferase (GPI-GnT) complex [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0009893 - positive regulation of metabolism [Evidence ISS] codon_start : 1 note : phosphatidylinositol glycan, class Y product : pre-Y homolog protein_id : NP_079850.1

name	Lancl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526936 CCDS:CCDS20185.1 GeneID:71835 MGI:1919085
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005525 - GTP binding [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0031179 - peptide modification [Evidence ISS] codon_start : 1 product : LanC (bacterial lantibiotic synthetase component C)-like 2 protein_id : NP_598498.1

name	AW146242 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122699 GeneID:232023 MGI:2141658
definition	codon_start : 1 product : hypothetical protein LOC232023 protein_id : NP_666280.1

name	V1rc28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717695 CCDS:CCDS20186.1 GeneID:171201 MGI:2159464
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C28 protein_id : NP_598944.1

name	LOC626582 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255148 GeneID:626582
definition	codon_start : 1 product : similar to vomeronasal receptor V1RC18 protein_id : XP_001476519.1

name	V1rc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717677 CCDS:CCDS20187.1 GeneID:171196 MGI:2159459
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C23 protein_id : NP_598939.1

name	V1rc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717687 GeneID:171197 MGI:2159460
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C24 protein_id : NP_598940.1

name	V1rc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717675 CCDS:CCDS20188.1 GeneID:171191 MGI:2159454
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C18 protein_id : NP_598934.1

name	V1rc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110611165 CCDS:CCDS20189.1 GeneID:113865 MGI:2148529
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C8 protein_id : NP_444468.2

name	V1rc17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717665 CCDS:CCDS20190.1 GeneID:171190 MGI:2159453
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C17 protein_id : NP_598933.1

name	EG633683 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377390 GeneID:633683 MGI:3647234
definition	codon_start : 1 product : similar to insulinoma protein (rig) protein_id : XP_991799.1

name	V1rc33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717793 CCDS:CCDS20192.1 GeneID:171206 MGI:2159470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, C33 protein_id : NP_602318.1

name	V1rc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717681 CCDS:CCDS20193.1 GeneID:171198 MGI:2159461
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, C25 protein_id : NP_598941.1

name	V1rc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716547 CCDS:CCDS20194.1 GeneID:113859 MGI:2148523
definition	GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007606 - sensory perception of chemical stimulus [Evidence TAS] codon_start : 1 product : vomeronasal 1 receptor, C2 protein_id : NP_444462.1

name	V1rc4 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:113861
definition	number : 1 pseudo : _no_value

name	V1rc4 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:113861
definition	number : 2 pseudo : _no_value

name	LOC100041445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041445
definition	number : 1 pseudo : _no_value

name	LOC100041445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041445
definition	number : 2 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 3 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 2 pseudo : _no_value

name	LOC666822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666822
definition	number : 1 pseudo : _no_value

name	LOC100041514 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041514
definition	number : 1 pseudo : _no_value

name	LOC626649 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626649
definition	number : 1 pseudo : _no_value

name	LOC626659 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626659
definition	number : 1 pseudo : _no_value

name	LOC626672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626672
definition	number : 1 pseudo : _no_value

name	LOC626672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626672
definition	number : 2 pseudo : _no_value

name	LOC666893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666893
definition	number : 1 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 1 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 2 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 3 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 4 pseudo : _no_value

name	LOC100041571 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041571
definition	number : 5 pseudo : _no_value

name	LOC626724 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626724
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130790
definition	standard_name : D6Mit241

name	(CDS detail)
type	STS
link
xref	UniSTS:224848
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210588
definition	standard_name : RH136608

name	(CDS detail)
type	STS
link
xref	UniSTS:185668
definition	standard_name : AU041156

name	(CDS detail)
type	STS
link
xref	UniSTS:20125
definition	standard_name : WI-11592

name	(CDS detail)
type	STS
link
xref	UniSTS:261562
definition	standard_name : AA819232

name	(CDS detail)
type	STS
link
xref	UniSTS:179379
definition	standard_name : AW549641

name	(CDS detail)
type	STS
link
xref	UniSTS:207965
definition	standard_name : AW742329

name	(CDS detail)
type	STS
link
xref	UniSTS:164325
definition	standard_name : AI842776

name	(CDS detail)
type	STS
link
xref	UniSTS:207964
definition	standard_name : BB491051

name	(CDS detail)
type	STS
link
xref	UniSTS:207966
definition	standard_name : AW556929

name	(CDS detail)
type	STS
link
xref	UniSTS:495076
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493139
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495562
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484925
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491562
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489279
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494240
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492639
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492639
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487396
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495552
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488214
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494018
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:490618
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495553
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487397
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:493142
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494239
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484927
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492638
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484926
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495563
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492643
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159512
definition	standard_name : AI451296

name	(CDS detail)
type	STS
link
xref	UniSTS:130870
definition	standard_name : D6Mit317

name	(CDS detail)
type	STS
link
xref	UniSTS:179380
definition	standard_name : AI847956

name	(CDS detail)
type	STS
link
xref	UniSTS:179381
definition	standard_name : AW146242

name	(CDS detail)
type	STS
link
xref	UniSTS:235454
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:491563
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130937
definition	standard_name : D6Mit385

name	(CDS detail)
type	STS
link
xref	UniSTS:494238
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495334
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489277
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492637
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:152622
definition	standard_name : D11S3380

name	(CDS detail)
type	STS
link
xref	UniSTS:494019
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:487437
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488215
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:495561
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488286
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:489276
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:479302
definition	standard_name : V1rc17

name	(CDS detail)
type	STS
link
xref	UniSTS:125061
definition	standard_name : MHAa15b9.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:236108
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:492643
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:484926
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:494017
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:488213
definition

name	LOC100042288 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255194 GeneID:100042288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : similar to 2855 is the position of the first start codon in ORF 2; putative pseudo : _no_value transcript_id : XR_033632.1

clone name	MSMg01-131A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381P24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-373E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130C24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-442A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-334D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-540D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-533F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-189P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-391F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407F13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-153L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-367M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367M08
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-203L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175M20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-083P10.b	B6Ng01-083P10.g
ACC	DH898066	DH898067
length	1,210	1,141
definition	DH898066\|Mus musculus domesticus DNA, BAC clone: B6Ng01-083P10, 5' end.	DH898067\|Mus musculus domesticus DNA, BAC clone: B6Ng01-083P10, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttaacagagcaatctcatgtggccaggaatcacttaaagaaatg gtcaatgtccttagtcatcagggaaatacaaatcaaaacgatcctgatat tccatcttatgacagtcagaatgtttaaattcaaaacttaagggatagta cattacatgctggtgaggatagggagaatggaaggaaacactctttcatt actggtgggactgcaaactggtacatccaaccaggaaataaatctggcga tttctcagaaaattggaaatagttctagctgaagacccagttatacaact cctgggcatatgcccaaaatatactgcatcatactataataacatatact ccaatatgttcatggcagctttatgcataatagccataaactgaaagcaa accagatgttcatcaactgaagaatggatacagaaaatgtggttcacaat ggaatagtccttagctattaaaaacaaagacatcatgaattttgcaggca aacagatggaactagaaaatatcctaagtgaggtaacccagatctaaaag ggtaagtatgttatgtgcccactgataaatttatattaattataaagtct tgcccaagctagtatcttgctggcaagaattcactcagacaaccggatcc ttctacagtaaagcttttattgcttcaacataaggaagaccccaatcccg gaaaatggtgctgcttatatagccctcaccgtgacgtttcaatacctgag gtggcatgacagcacctgattagttgctcgcccatcaccccattactacg ccccgagatgggcggtgactgggcgtgaatacactcttgcgcttgcgcat aaggcttgtttactagttaggcacagtggaagccagcgccatcttataat ggcaattgctcacgacatggctctccacatctcccctttttattttatta aaatttgagttggtctagcctctgcagtcgtgtccatctgctgtgctctg tcttagtcattctcatgtcacagcttttctgtcataggtacctatcgcca ccaggcccgtgtcttagtgatcgtgcatgaggaagttgccgtctctgata ccacatgctatgtgacagtactactatgaactaggcgactctacaaaagg cagcaaacaaatgtaactcacaagggcaagtgcgaatacatgagctggaa ttttctgtca	gaattcattttcattgaaacactcaattatctactgaagcttatacagtt cacctgtttgtaaggttaaattttcatgaatttaatagataagcgacatg agattttcagatacttttgaaatacatagaaaagatttcctttattagaa atctttgcaacagaataaacaaatctctcaaaaattttaaagaaattatc atataaagtgaaaatgtcttctaatttcttaggccttgaattgaaacttt tctaattattcccaagtatacaaaacttatcaaactagaaattattgatt aacactaaagtagttaatatttcttgtctatccctagcattagtttcatt gtattaaatgcatacagtcagatatctggataaagaagtaaaatgaaaaa ttacaaagtacaatttaaatgtagctgaaaactatgaatgcactcctgca caccaataaatgtgtgttctttgtttttaccctctaaggtatttcagtgt tttgttaaaggaattgaaaactaacagagttggcaattggaattcataga gtacacgctcaggagaatactgtgccagatttgatctctaaaatattgca ttcggaataactttttacaggaatattcattgtaaaaataatgggtttta tggtatgttcattcaaaatataataaccattgatgaacttcacccttcac cctttaaccttctctctctctctctctctccctctctctctcagtcaatc aatcaatcaatcagtcaatcaatcaatcaatcattctgctacacccatgt actctttccaaaaaccccattctagtgccatatagataaacagagatcac attgagtgaaacctatgttgtttataaatgtttacagctggtaccttcgt gtctacaagtatctgttgaaggcttactacacagtatggcacaaaagtat atttctaaatagagacttctctaatcctttagacagaatattctgctctt ctacactacttacagctctactataatgaagagaacagaaacaactcaca ggcttgctttgacaacattcttgtagaatgtggcttgaagtagttataat gagaaatgtcatcagttaatctctgatgtctcatacatgtc
quality values	Open. Hide. 61 47 43 38 61 61 61 61 61 61 38 38 61 61 61 52 61 61 61 61 61 59 49 61 61 61 61 59 59 59 37 59 28 34 59 59 61 59 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 44 59 61 61 61 55 44 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 59 59 55 59 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 50 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 53 50 61 61 61 61 46 61 61 61 61 57 57 53 57 57 57 57 57 53 53 53 53 57 46 53 57 57 47 57 57 53 57 47 47 46 53 57 57 57 57 57 53 57 53 57 53 53 57 57 57 57 53 53 53 57 57 53 57 53 53 53 57 39 47 53 43 47 47 57 43 57 53 57 53 52 57 57 57 57 50 57 57 46 52 52 57 53 57 39 37 57 53 52 57 57 52 38 50 52 45 31 53 43 46 52 53 52 53 34 53 52 53 52 53 45 53 41 50 43 53 57 57 50 53 53 57 57 41 50 47 57 53 37 57 39 38 40 43 53 42 52 38 52 21 35 25 57 36 52 24 41 38 46 24 52 52 28 38 38 38 47 52 57 57 53 30 57 46 40 53 40 53 53 37 53 52 40 44 47 53 52 37 41 41 43 52 35 37 52 52 37 36 44 33 37 35 44 57 23 31 12 47 48 41 46 44 44 53 33 10 37 33 44 37 28 36 40 53 35 33 36 36 53 29 29 51 29 45 44 32 39 43 32 30 47 48 34 30 30 38 44 47 45 27 30 36 34 23 45 45 41 30 32 32 30 30 30 33 44 25 29 30 31 47 23 32 25 30 21 28 46 37 30 28 46 18 36 34 23 33 36 45 37 38 29 31 30 25 31 32 29 30 19 29 41 33 29 31 29 33 28 29 29 29 29 28 27 32 21 25 15 12 11 21 13 30 26 40 21 46 31 23 31 33 28 17 30 28 21 23 28 15 15 29 28 23 23 46 28 31 31 22 29 29 28 28 29 29 27 27 18 36 28 29 24 29 25 23 22 27 38 39 34 27 27 29 39 28 23 29 25 21 31 14 35 22 17 21 22 26 28 29 25 29 19 23 17 29 21 35 26 31 33 32 28 38 27 51 44 51 33 31 19 51 44 19 28 22 30 23 51 51 25 12 51 31 13 5 7 5 14 19 36 26 34 28 4 7 5 5 23 25 22 27 24 26 22 15 30 19 17 30 21 25 28 23 27 28 27 28 29 25 27 17 26 7 13 31 10 21 6 9 5 14 18 24 12 21 20 19 8 6 6 5 4 4 10 14 20 12 16 13 1 4 3 30 33 5 30 11 18 16 25 11 10 7 18 22 15 27 15 29 15 29 16 14 9 8 16 11 17 21 14 10 11 25 24 25 6 5 5 5 12 11 14 19 27 12 7 13 11 27 6 4 8 16 10 23 11 23 5 6 3 18 9 9 12 7 12 21 8 5 7 8 8 14 13 3 4 3 8 6 5 7 7 3 9 14 7 4 5 4 4 6 4 5 4 7 8 12 9 8 4 21 6 9 2 3 6 4 18 10 6 13 11 4 4 10 5 9 5 12 3 5 17 24 14 5 4 6 10 4 6 6 3 9 16 3 5 19 3 9 4 3 4 9 3 4 4 3 5 4 6 6 5 7 10 5 7 7 7 5 15 8 4 3 7 2 4 5 3 5 5 3 2 2 2 5 1 10 9 27 20 4 6 4 6 4 20 4	Open. Hide. 61 61 59 59 61 16 18 24 24 24 23 12 14 22 23 44 37 52 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 49 41 37 44 36 52 59 61 61 55 37 59 61 59 59 59 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 52 61 61 61 61 61 59 55 61 61 61 59 61 61 61 59 61 61 61 61 61 59 59 61 61 59 55 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 59 59 61 61 61 61 61 61 55 59 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 59 55 61 59 61 61 61 59 61 59 55 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 61 61 61 61 61 61 61 52 50 47 38 47 52 61 53 39 61 57 50 57 53 52 57 53 57 53 52 57 57 53 53 52 42 30 57 57 57 53 53 53 57 53 47 53 57 57 57 43 50 57 53 57 53 52 53 57 53 53 37 53 57 45 42 53 47 53 53 57 46 53 50 53 45 37 41 47 57 53 53 39 43 53 50 43 53 57 42 53 57 57 57 37 45 31 37 35 57 57 53 52 36 36 41 53 52 46 41 31 57 53 57 52 45 52 42 36 52 50 33 57 57 52 53 53 53 42 57 52 57 50 57 52 28 57 53 57 52 52 47 38 47 47 39 53 50 33 53 57 53 52 52 40 37 43 53 52 47 57 30 41 35 37 57 45 53 53 53 53 53 53 53 37 34 52 53 52 37 33 52 41 53 38 33 24 41 38 39 38 25 33 53 48 40 53 53 53 40 29 44 47 33 33 44 53 47 57 44 44 36 57 40 48 41 41 27 24 18 10 8 21 18 39 29 25 29 41 48 32 18 44 32 30 29 33 31 28 30 38 48 30 39 37 30 29 29 30 28 22 45 32 29 27 48 29 37 29 29 39 36 45 39 29 11 14 46 46 39 21 14 36 27 30 23 23 22 23 25 28 33 35 36 13 29 22 31 29 29 29 28 29 25 31 46 33 29 25 18 41 23 28 34 27 28 29 14 30 31 29 29 24 24 26 21 51 12 12 30 21 21 26 31 23 28 22 21 39 41 23 19 29 43 38 29 43 29 51 19 22 26 12 29 27 20 18 25 11 26 29 32 25 23 28 20 12 32 28 34 30 23 20 6 36 14 28 33 28 25 30 31 12 39 30 25 21 19 22 13 9 7 9 29 31 20 29 14 24 23 31 12 11 6 6 19 16 21 22 22 51 38 32 28 28 38 19 12 6 38 7 27 20 27 38 20 10 9 13 23 10 26 26 16 30 23 28 28 29 21 19 27 19 19 13 35 14 15 13 28 13 5 8 33 29 16 18 18 21 32 10 27 9 17 7 4 7 16 8 7 30 7 17 4 12 17 20 15 14 16 7 8 19 9 5 22 13 29 12 21 11 12 19 15 30 30 18 18 20 34 17 8 7 29 16 22 42 10 5 6 6 5 8 13 10 21 12 14 21 14 21 10 3 4 4 20 10 16 7 4 16 25 10 20 10 5 23 7 4 5 5 11 4 5 23 5 11 5 12 5 16 4 23 8 9 3 3 3 4 8 13 10 4 4 4 3 5 11 6 5 18 19 5 4 4 3 7 4 21 6 8 5 5 9 16 12 6 5 7 14 2 2 2 4 5 6 5 5 5 6 5 4 13 6 4 5 10 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_57350816_57351972
seq2: B6Ng01-083P10.g_70_1210 (reverse)

seq1  GACATG-ATGAGACTACAGGGAGATTAACTGATGACATTTCTTCCATATA  49
      |||||| |||||||  ||  ||||||||||||||||||||| ||  ||||
seq2  GACATGTATGAGACATCA--GAGATTAACTGATGACATTTC-TCATTATA  47

seq1  ACTACTTCCAAGGGCCACATTCTACAAGGATGTTTGTCAAAGGCCAAGCC  99
      |||||||| |   ||||||||||||||| ||| |||||||||  ||||||
seq2  ACTACTTCAA---GCCACATTCTACAAGAATG-TTGTCAAAG--CAAGCC  91

seq1  TGGTGAG-TGTTTCTTGTTCCTCTTCATTATAGTAAGAGCTGTAAGTAGG  148
      | ||||| |||||| |||| |||||||||||||| |||||||||||||| 
seq2  T-GTGAGTTGTTTC-TGTT-CTCTTCATTATAGT-AGAGCTGTAAGTAG-  136

seq1  TGGTAGAAGGAAGCAGAATATTCTGTCTAAAGGATTAGAGAAGTCTCTAT  198
        |||||||  |||||||||||||||||||||||||||||||||||||||
seq2  -TGTAGAAG--AGCAGAATATTCTGTCTAAAGGATTAGAGAAGTCTCTAT  183

seq1  TTAGAATATTACTTTTGTGCCATACTGTGTAGTAAGCCTTCAACAGATAC  248
      ||||||   |||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAATATACTTTTGTGCCATACTGTGTAGTAAGCCTTCAACAGATAC  233

seq1  TTGTAGACACGAAGGTACCAGCTGTAAACATTTATAAAACAACATAGGTT  298
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TTGTAGACACGAAGGTACCAGCTGTAAACATTTAT-AAACAACATAGGTT  282

seq1  TCACTCAATGTGATCTCTGTTTATCTATATGGCACTAGAATGGGGTTTTT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTCAATGTGATCTCTGTTTATCTATATGGCACTAGAATGGGGTTTTT  332

seq1  GGAAAGAGTACATGGGTGTAGCAGAATGATTGATTGATTGATTGACTGAT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGAGTACATGGGTGTAGCAGAATGATTGATTGATTGATTGACTGAT  382

seq1  TGATTGATTGATTGACTGAGAGAGAGAGGGAGAGAGAGAGAGAGAGAGAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGATTGATTGACTGAGAGAGAGAGGGAGAGAGAGAGAGAGAGAGAA  432

seq1  GGTTAAAGGGTGAAGGGTGAAGTTCATCAATGGTTATTATATTTTGAATG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAAAGGGTGAAGGGTGAAGTTCATCAATGGTTATTATATTTTGAATG  482

seq1  AACATACCATAAAACCCATTATTTTTACAATGAATATTCCTGTAAAAAGT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATACCATAAAACCCATTATTTTTACAATGAATATTCCTGTAAAAAGT  532

seq1  TATTCCGAATGCAATATTTTAGAGATCAAATCTGGCACAGTATTCTCCTG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCCGAATGCAATATTTTAGAGATCAAATCTGGCACAGTATTCTCCTG  582

seq1  AGCGTGTACTCTATGAATTCCAATTGCCAACTCTGTTAGTTTTCAATTCC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGTGTACTCTATGAATTCCAATTGCCAACTCTGTTAGTTTTCAATTCC  632

seq1  TTTAACAAAACACTGAAATACCTTAGAGGGTAAAAACAAAGAACACACAT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAACAAAACACTGAAATACCTTAGAGGGTAAAAACAAAGAACACACAT  682

seq1  TTATTGGTGTGCAGGAGTGCATTCATAGTTTTCAGCTACATTTAAATTGT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTGGTGTGCAGGAGTGCATTCATAGTTTTCAGCTACATTTAAATTGT  732

seq1  ACTTTGTAATTTTTCATTTTACTTCTTTATCCAGATATCTGACTGTATGC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTGTAATTTTTCATTTTACTTCTTTATCCAGATATCTGACTGTATGC  782

seq1  ATTTAATACAATGAAACTAATGCTAGGGATAGACAAGAAATATTAACTAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAATACAATGAAACTAATGCTAGGGATAGACAAGAAATATTAACTAC  832

seq1  TTTAGTGTTAATCAATAATTTCTAGTTTGATAAGTTTTGTATACTTGGGA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGTGTTAATCAATAATTTCTAGTTTGATAAGTTTTGTATACTTGGGA  882

seq1  ATAATTAGAAAAGTTTCAATTCAAGGCCTAAGAAATTAGAAGACATTTTC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATTAGAAAAGTTTCAATTCAAGGCCTAAGAAATTAGAAGACATTTTC  932

seq1  ACTTTATATGATAATTTCTTTAAAATTTTTGAGAGATTTGTTTATTCTGT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTATATGATAATTTCTTTAAAATTTTTGAGAGATTTGTTTATTCTGT  982

seq1  TGCAAAGATTTCTAATAAAGGAAATCTTTTCTATGTATTTCAAAAGTATC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAAGATTTCTAATAAAGGAAATCTTTTCTATGTATTTCAAAAGTATC  1032

seq1  TGAAAATCTCATGTCGCTTATCTATTAAATTCATGAAAATTTAACCTTAC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAATCTCATGTCGCTTATCTATTAAATTCATGAAAATTTAACCTTAC  1082

seq1  AAACAGGTGAACTGTATAAGCTTCAGTAGATAATTGAGTGTTTCAATGAA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAGGTGAACTGTATAAGCTTCAGTAGATAATTGAGTGTTTCAATGAA  1132

seq1  AATGAATTC  1157
      |||||||||
seq2  AATGAATTC  1141

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information