MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-105I05
Chromosome	6 (Build37)
Map Location	129,753,341 - 129,753,388
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Klrb1d, LOC667706, Clec2i, Clec2g, LOC667715, BC064078, Clec2f, Klrb1f, Clec2e, Klrb1-ps1, Clec2d, Cd69, 4922502D21Rik, Clec12a, 4933425B16Rik, Clec1b, Clec9a, Clec1a, Clec7a, Olr1, D630042F21Rik, Gabarapl1, Klre1, Klrd1, Klrk1, Klrc3, Klrc2, Klrc1, LOC640755, Klri1, Klri2, Gm156
Downstream gene	Klra17, Klra5, LOC667764, Klra6, LOC100038893, LOC100038894, LOC100038895, Klra4, LOC667769, LOC100038897, Klra8, EG654449, Klra9, Klra7, LOC100038898, Klra12, Klra10, Klra13, Klra3, Klra1, LOC100038902, LOC100038903, LOC625436, EG625473, LOC640779, LOC667793, EG667798, EG625558, LOC625566, EG636947
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klrb1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80782 MGI:1931428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Clec2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93675 MGI:2136650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70809 MGI:1918059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	BC064078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408064 MGI:3040692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 39 ESTs

name	Clec2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435921 MGI:3522133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	Klrb1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232408 MGI:2442965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Clec2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232409 MGI:3028921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrb1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:724020 MGI:3624540
definition	gene_synonym : Nkrp1e note : killer cell lectin-like receptor subfamily B member 1, pseudogene 1 pseudo : _no_value

name	Clec2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93694 MGI:2135589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd69 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12515 MGI:88343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4922502D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381816 MGI:2685920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232413 MGI:3040968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933425B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71183 MGI:1918433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	Clec1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56760 MGI:1913287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232414 MGI:2444608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243653 MGI:2444151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56644 MGI:1861431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108078 MGI:1261434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630042F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330428 MGI:2442838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabarapl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57436 MGI:1914980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klre1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243655 MGI:2662547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16643 MGI:1196275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Klrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58179 MGI:1929720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16642 MGI:1336162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klrc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16641 MGI:1336161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Klri1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503550 MGI:3530275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klri2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320407 MGI:2443965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232415 MGI:2685002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170733 MGI:2180674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16636 MGI:101903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Klra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16637 MGI:101902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038894 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16635 MGI:101904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667769 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins pseudo : _no_value

name	LOC100038897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16639 MGI:102968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654449 MGI:3644243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	Klra9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16640 MGI:1321153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16638 MGI:101901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16630 MGI:1321091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16628 MGI:1321093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16631 MGI:1321090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16634 MGI:101905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16627 MGI:101907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038902 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG625473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625473 MGI:3645685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC640779 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG667798 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667798 MGI:3648641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG625558 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625558 MGI:3643376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	LOC625566 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636947 MGI:3648824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Klrb1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328453 GeneID:80782 MGI:1931428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1D transcript_id : NM_030599.3

name	Clec2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9933349 GeneID:93675 MGI:2136650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member i transcript_id : NM_020257.1

name	Clec2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369971 GeneID:70809 MGI:1918059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member g transcript_id : NM_027562.2

name	Clec2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255342 GeneID:435921 MGI:3522133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : C-type lectin domain family 2, member f transcript_id : XM_487967.2

name	Klrb1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379697 GeneID:232408 MGI:2442965
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1F transcript_id : NM_181064.3

name	Klrb1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25092654 GeneID:232408 MGI:2442965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily B member 1F transcript_id : NM_153094.1

name	Clec2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130488530 GeneID:232409 MGI:3028921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member e transcript_id : NM_153506.3

name	Clec2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892677 GeneID:93694 MGI:2135589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 2, member d transcript_id : NM_053109.2

name	Cd69 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372001 GeneID:12515 MGI:88343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD69 antigen transcript_id : NM_001033122.2

name	4922502D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802578 GeneID:381816 MGI:2685920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4922502D21 gene transcript_id : NM_199034.3

name	Clec12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130457 GeneID:232413 MGI:3040968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 12, member a transcript_id : NM_177686.3

name	4933425B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255442 GeneID:71183 MGI:1918433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : RIKEN cDNA 4933425B16 gene transcript_id : XM_132881.5

name	Clec1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355991 GeneID:56760 MGI:1913287
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 1, member b transcript_id : NM_019985.2

name	Clec9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674802 GeneID:232414 MGI:2444608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 9, member a transcript_id : NM_172732.2

name	Clec1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356146 GeneID:243653 MGI:2444151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 1, member a transcript_id : NM_175526.2

name	Clec7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910159 GeneID:56644 MGI:1861431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 7, member a transcript_id : NM_020008.1

name	Olr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053880 GeneID:108078 MGI:1261434
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidized low density lipoprotein (lectin-like) receptor 1 transcript_id : NM_138648.2

name	D630042F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487150 GeneID:330428 MGI:2442838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630042F21 gene transcript_id : NM_001081186.1

name	Gabarapl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801743 GeneID:57436 MGI:1914980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 transcript_id : NM_020590.4

name	Klre1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30520370 GeneID:243655 MGI:2662547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family E member 1 transcript_id : NM_153590.2

name	Klrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754469 GeneID:16643 MGI:1196275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily D, member 1 transcript_id : NM_010654.1

name	Klrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023657 GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily K, member 1 transcript_id : NM_001083322.1

name	Klrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023659 GeneID:27007 MGI:1196250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily K, member 1 transcript_id : NM_033078.3

name	Klrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946713 GeneID:58179 MGI:1929720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 3 transcript_id : NM_021378.1

name	Klrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386297 GeneID:16642 MGI:1336162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 2 transcript_id : NM_010653.3

name	Klrc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754465 GeneID:16641 MGI:1336161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily C, member 1 transcript_id : NM_010652.1

name	Klri1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593096 GeneID:503550 MGI:3530275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family I member 1 transcript_id : NM_001012520.1

name	Klri2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358946 GeneID:320407 MGI:2443965
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor family I member 2 transcript_id : NM_177155.3

name	Gm156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701511 GeneID:232415 MGI:2685002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 156, (NCBI) transcript_id : NM_001014997.1

name	Klra17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559407 GeneID:170733 MGI:2180674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 17 transcript_id : NM_133203.1

name	Klra5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130769 GeneID:16636 MGI:101903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 5 transcript_id : NM_008463.2

name	Klra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130779 GeneID:16637 MGI:101902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 6 transcript_id : NM_008464.2

name	LOC100038893 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255107 GeneID:100038893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038893 transcript_id : XM_001471782.1

name	LOC100038894 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255109 GeneID:100038894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038894 transcript_id : XM_001471776.1

name	LOC100038895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255111 GeneID:100038895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038895 transcript_id : XM_001471780.1

name	Klra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130091 GeneID:16635 MGI:101904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 4 transcript_id : NM_010649.2

name	LOC100038897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255113 GeneID:100038897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038897 transcript_id : XM_001471777.1

name	Klra8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922594 GeneID:16639 MGI:102968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 8 transcript_id : NM_010650.3

name	Klra9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922570 GeneID:16640 MGI:1321153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 9 transcript_id : NM_010651.3

name	Klra7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355994 GeneID:16638 MGI:101901
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 7 transcript_id : NM_014194.2

name	LOC100038898 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255115 GeneID:100038898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038898 transcript_id : XM_001471682.1

name	Klra12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21327664 GeneID:16630 MGI:1321091
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 12 transcript_id : NM_010646.1

name	Klra10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506838 GeneID:16628 MGI:1321093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 10 transcript_id : NM_008459.2

name	Klra13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581537 GeneID:16631 MGI:1321090
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily A, member 13 transcript_id : NM_010647.2

name	Klra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922592 GeneID:16634 MGI:101905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 3 transcript_id : NM_010648.2

name	Klra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922591 GeneID:16627 MGI:101907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor, subfamily A, member 1 transcript_id : NM_016659.3

name	LOC100038902 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255117 GeneID:100038902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038902 transcript_id : XM_001471779.1

name	LOC100038903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255119 GeneID:100038903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038903 transcript_id : XM_001471680.1

name	EG667798 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255345 GeneID:667798 MGI:3648641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG667798 transcript_id : XM_992538.2

name	EG625558 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378143 GeneID:625558 MGI:3643376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : predicted gene, EG625558 transcript_id : XM_890142.2

name	LOC625566 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255347 GeneID:625566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to novel KRAB box domain containing protein transcript_id : XM_001480523.1

name	EG636947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255349 GeneID:636947 MGI:3648824
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG636947 transcript_id : XM_912516.3

name	Klrb1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328454 GeneID:80782 MGI:1931428
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0045953 - negative regulation of natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 exception : mismatches in translation note : lymphocyte antigen 55 complex, locus D; killer cell lectin-like receptor subfamily A member 1D product : killer cell lectin-like receptor subfamily B member 1D protein_id : NP_085102.3

name	Clec2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9933350 GeneID:93675 MGI:2136650
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0046703 - natural killer cell lectin-like receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0043113 - receptor clustering [Evidence IMP]; GO:0030833 - regulation of actin filament polymerization [Evidence IMP]; GO:0045076 - regulation of interleukin-2 biosynthesis [Evidence IMP]; GO:0042129 - regulation of T cell proliferation [Evidence IMP]; GO:0050852 - T cell receptor signaling pathway [Evidence IMP] codon_start : 1 note : osteoclast inhibitory lectin related protein 2; C-type lectin 1 product : C-type lectin domain family 2, member i protein_id : NP_064653.1

name	Clec2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386236 CCDS:CCDS20578.1 GeneID:70809 MGI:1918059
definition	GO_component : GO:0005615 - extracellular space [Evidence IC] GO_process : GO:0045671 - negative regulation of osteoclast differentiation [Evidence IDA] codon_start : 1 note : osteoclast inhibitory lectin related protein product : C-type lectin domain family 2, member g protein_id : NP_081838.1

name	Clec2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255343 GeneID:435921 MGI:3522133
definition	codon_start : 1 product : C-type lectin domain family 2, member f protein_id : XP_487967.2

name	Klrb1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092655 CCDS:CCDS20579.1 GeneID:232408 MGI:2442965
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : Nkrp1f protein protein_id : NP_694734.1

name	Klrb1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30840996 CCDS:CCDS20579.1 GeneID:232408 MGI:2442965
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : Nkrp1f protein protein_id : NP_851409.1

name	Clec2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130488531 GeneID:232409 MGI:3028921
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : C lectin-related protein A product : C-type lectin domain family 2, member e protein_id : NP_705726.3

name	Clec2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716407 CCDS:CCDS20581.1 GeneID:93694 MGI:2135589
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0046703 - natural killer cell lectin-like receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0006968 - cellular defense response [Evidence TAS]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IDA]; GO:0042270 - protection from natural killer cell mediated cytotoxicity [Evidence IDA] codon_start : 1 note : osteoclast inhibitory lectin product : C-type lectin domain family 2, member d protein_id : NP_444339.1

name	Cd69 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370294 CCDS:CCDS20582.1 GeneID:12515 MGI:88343
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : Very Early Activation Antigen product : CD69 antigen protein_id : NP_001028294.1

name	4922502D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841061 CCDS:CCDS20583.1 GeneID:381816 MGI:2685920
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381816 protein_id : NP_950199.1

name	Clec12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244122 CCDS:CCDS20584.1 GeneID:232413 MGI:3040968
definition	GO_component : GO:0009986 - cell surface [Evidence ISS] GO_function : GO:0019903 - protein phosphatase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0050776 - regulation of immune response [Evidence ISS] codon_start : 1 note : myeloid inhibitory C-type lectin-like receptor product : C-type lectin domain family 12, member a protein_id : NP_808354.1

name	4933425B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20833034 GeneID:71183 MGI:1918433
definition	codon_start : 1 product : macrophage antigen h protein_id : XP_132881.1

name	Clec1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910412 CCDS:CCDS20586.1 GeneID:56760 MGI:1913287
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 note : C-type lectin-like receptor 2 product : C-type lectin domain family 1, member b protein_id : NP_064369.1

name	Clec9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674803 GeneID:232414 MGI:2444608
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : C-type lectin domain family 9, member a protein_id : NP_766320.2

name	Clec1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202063 CCDS:CCDS20587.1 GeneID:243653 MGI:2444151
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-type lectin-like receptor-1 protein_id : NP_780735.1

name	Clec7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910160 GeneID:56644 MGI:1861431
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0001846 - opsonin binding [Evidence IDA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA]; GO:0001874 - zymosan receptor activity [Evidence IDA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0016337 - cell-cell adhesion [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006911 - phagocytosis, engulfment [Evidence IDA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA]; GO:0001878 - response to yeast [Evidence IDA] codon_start : 1 exception : unclassified translation discrepancy function : co-stimulation of T cells note : dectin-1; beta-glucan receptor; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 12 product : dendritic cell-associated C-type lectin 1 protein_id : NP_064392.1

name	Olr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053881 CCDS:CCDS20588.1 GeneID:108078 MGI:1261434
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 note : oxidised low density lipoprotein (lectin-like) receptor 1 product : oxidized low density lipoprotein (lectin-like) receptor 1 protein_id : NP_619589.2

name	D630042F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487151 GeneID:330428 MGI:2442838
definition	codon_start : 1 product : hypothetical protein LOC330428 protein_id : NP_001074655.1

name	Gabarapl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181206 GeneID:57436 MGI:1914980
definition	GO_component : GO:0005776 - autophagic vacuole [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008092 - cytoskeletal protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : GABA(A) receptor-associated protein like 1 product : gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 protein_id : NP_065615.1

name	Klre1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520371 CCDS:CCDS20589.1 GeneID:243655 MGI:2662547
definition	GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family E member 1 protein_id : NP_705818.2

name	Klrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754470 GeneID:16643 MGI:1196275
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor, subfamily D, member 1 protein_id : NP_034784.1

name	Klrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14861840 GeneID:27007 MGI:1196250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : isoform a is encoded by transcript variant 1; natural killer cell group 2D product : NKG2-D isoform a protein_id : NP_149069.1

name	Klrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134023658 GeneID:27007 MGI:1196250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0045233 - natural killer cell receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; natural killer cell group 2D product : NKG2-D isoform b protein_id : NP_001076791.1

name	Klrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946714 CCDS:CCDS20591.1 GeneID:58179 MGI:1929720
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : natural killer cell group 2E cell receptor product : killer cell lectin-like receptor subfamily C, member 3 protein_id : NP_067353.1

name	Klrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842374 GeneID:16642 MGI:1336162
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily C, member 2 protein_id : NP_034783.2

name	Klrc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754466 GeneID:16641 MGI:1336161
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily C, member 1 protein_id : NP_034782.1

name	Klri1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593097 CCDS:CCDS20593.1 GeneID:503550 MGI:3530275
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family I member 1 protein_id : NP_001012538.1

name	Klri2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893135 CCDS:CCDS20594.1 GeneID:320407 MGI:2443965
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : killer cell lectin-like receptor family I member 2 protein_id : NP_796129.1

name	Gm156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701512 CCDS:CCDS20595.1 GeneID:232415 MGI:2685002
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily H, member 1 protein_id : NP_001014997.1

name	Klra17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559408 GeneID:170733 MGI:2180674
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : NK receptor Ly-49Q product : killer cell lectin-like receptor, subfamily A, member 17 protein_id : NP_573466.1

name	Klra5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680590 CCDS:CCDS20596.1 GeneID:16636 MGI:101903
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : Ly49E receptor; class I MHC receptor KLRA5 product : killer cell lectin-like receptor, subfamily A, member 5 protein_id : NP_032489.1

name	LOC100038893 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255108 GeneID:100038893
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471832.1

name	Klra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680592 CCDS:CCDS20597.1 GeneID:16637 MGI:101902
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor, subfamily A, member 6 protein_id : NP_032490.1

name	Klra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754462 GeneID:16635 MGI:101904
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : killer cell lectin-like receptor subfamily A member 32 product : killer cell lectin-like receptor, subfamily A, member 4 protein_id : NP_034779.1

name	LOC100038895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255112 GeneID:100038895
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471830.1

name	LOC100038894 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255110 GeneID:100038894
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471826.1

name	Klra8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426879 GeneID:16639 MGI:102968
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0009615 - response to virus [Evidence IDA] codon_start : 1 note : cytomegalovirus resistance 1 product : killer cell lectin-like receptor, subfamily A, member 8 protein_id : NP_034780.1

name	LOC100038897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255114 GeneID:100038897
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471827.1

name	Klra9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922571 GeneID:16640 MGI:1321153
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : Ly49I receptor product : killer cell lectin-like receptor subfamily A, member 9 protein_id : NP_034781.2

name	Klra7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355995 GeneID:16638 MGI:101901
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : killer cell lectin-like receptor 7 product : killer cell lectin-like receptor, subfamily A, member 7 protein_id : NP_055009.2

name	Klra12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327665 GeneID:16630 MGI:1321091
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : killer cell lectin-like receptor subfamily A, member 12 protein_id : NP_034776.1

name	Klra10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506839 CCDS:CCDS20600.1 GeneID:16628 MGI:1321093
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : killer cell lectin-like receptor subfamily A, member 10 protein_id : NP_032485.2

name	Klra13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31581538 GeneID:16631 MGI:1321090
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : killer cell lectin-like receptor subfamily A, member 13 protein_id : NP_034777.2

name	LOC100038898 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255116 GeneID:100038898
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471732.1

name	Klra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922593 CCDS:CCDS20601.1 GeneID:16634 MGI:101905
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : natural killer cell-associated antigen 2 product : killer cell lectin-like receptor, subfamily A, member 3 protein_id : NP_034778.2

name	LOC100038902 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255118 GeneID:100038902
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471829.1

name	LOC100038903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255120 GeneID:100038903
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471730.1

name	Klra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607449 CCDS:CCDS20602.1 GeneID:16627 MGI:101907
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : natural killer cell receptor Ly49A; class I MHC receptor KLRA22 product : killer cell lectin-like receptor, subfamily A, member 1 protein_id : NP_057868.2

name	EG667798 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255346 GeneID:667798 MGI:3648641
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_997632.2

name	EG625558 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029991 GeneID:625558 MGI:3643376
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_895235.1

name	LOC625566 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255348 GeneID:625566
definition	codon_start : 1 product : similar to novel KRAB box domain containing protein protein_id : XP_001480573.1

name	EG636947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255350 GeneID:636947 MGI:3648824
definition	codon_start : 1 product : similar to novel KRAB box containing protein protein_id : XP_917609.3

name	LOC640755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640755
definition	number : 1 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 7 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 6 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 5 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 4 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 3 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 2 pseudo : _no_value

name	LOC667764 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667764
definition	number : 1 pseudo : _no_value

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 8

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 7

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 6

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 5

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 4

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 3

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 2

name	EG654449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:654449
definition	number : 1

name	LOC625436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625436
definition	number : 4 pseudo : _no_value

name	LOC625436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625436
definition	number : 3 pseudo : _no_value

name	LOC625436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625436
definition	number : 2 pseudo : _no_value

name	LOC625436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625436
definition	number : 1 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 6 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 5 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 4 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 3 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 2 pseudo : _no_value

name	EG625473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625473
definition	number : 1 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 5 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 4 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 3 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 2 pseudo : _no_value

name	LOC640779 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640779
definition	number : 1 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 1 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 2 pseudo : _no_value

name	LOC667793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667793
definition	number : 3 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130893
definition	standard_name : D6Mit338.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130679
definition	standard_name : D6Mit135

name	(CDS detail)
type	STS
link
xref	UniSTS:130892
definition	standard_name : D6Mit338

name	(CDS detail)
type	STS
link
xref	UniSTS:130836
definition	standard_name : D6Mit289

name	(CDS detail)
type	STS
link
xref	UniSTS:208037
definition	standard_name : BE692208

name	(CDS detail)
type	STS
link
xref	UniSTS:91341
definition	standard_name : RH93287

name	(CDS detail)
type	STS
link
xref	UniSTS:161003
definition	standard_name : RH124109

name	(CDS detail)
type	STS
link
xref	UniSTS:185686
definition	standard_name : BB178967

name	(CDS detail)
type	STS
link
xref	UniSTS:125410
definition	standard_name : MHAa87a3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179473
definition	standard_name : AI646108

name	(CDS detail)
type	STS
link
xref	UniSTS:141293
definition	standard_name : Cd69

name	(CDS detail)
type	STS
link
xref	UniSTS:208039
definition	standard_name : BE691651

name	(CDS detail)
type	STS
link
xref	UniSTS:208038
definition	standard_name : BE447139

name	(CDS detail)
type	STS
link
xref	UniSTS:159576
definition	standard_name : AI196471

name	(CDS detail)
type	STS
link
xref	UniSTS:39952
definition	standard_name : U70176

name	(CDS detail)
type	STS
link
xref	UniSTS:143719
definition	standard_name : Klrd1

name	(CDS detail)
type	STS
link
xref	UniSTS:142578
definition	standard_name : D6H12S2489E

name	(CDS detail)
type	STS
link
xref	UniSTS:125146
definition	standard_name : MHAa34f7.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179474
definition	standard_name : AI451035

name	(CDS detail)
type	STS
link
xref	UniSTS:179474
definition	standard_name : AI451035

name	(CDS detail)
type	STS
link
xref	UniSTS:166302
definition	standard_name : G54770

name	(CDS detail)
type	STS
link
xref	UniSTS:166316
definition	standard_name : G54759

name	(CDS detail)
type	STS
link
xref	UniSTS:143713
definition	standard_name : Klra5

name	(CDS detail)
type	STS
link
xref	UniSTS:62323
definition	standard_name : U70177

name	(CDS detail)
type	STS
link
xref	UniSTS:143714
definition	standard_name : Klra6

name	(CDS detail)
type	STS
link
xref	UniSTS:142643
definition	standard_name : D6Uwa4

name	(CDS detail)
type	STS
link
xref	UniSTS:28477
definition	standard_name : U89890

name	(CDS detail)
type	STS
link
xref	UniSTS:143712
definition	standard_name : Klra4

name	(CDS detail)
type	STS
link
xref	UniSTS:166300
definition	standard_name : G54772

name	(CDS detail)
type	STS
link
xref	UniSTS:143711
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143717
definition	standard_name : Klra7

name	(CDS detail)
type	STS
link
xref	UniSTS:143715
definition	standard_name : Klra7

name	(CDS detail)
type	STS
link
xref	UniSTS:166301
definition	standard_name : G54756

name	(CDS detail)
type	STS
link
xref	UniSTS:143711
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143709
definition	standard_name : Klra3

name	(CDS detail)
type	STS
link
xref	UniSTS:143706
definition	standard_name : Klra1

name	(CDS detail)
type	STS
link
xref	UniSTS:143704
definition	standard_name : Klra1

name	(CDS detail)
type	STS
link
xref	UniSTS:143705
definition	standard_name : Klra1

name	(CDS detail)
type	STS
link
xref	UniSTS:143708
definition	standard_name : Klra1

name	(CDS detail)
type	STS
link
xref	UniSTS:132208
definition	standard_name : G54856

name	(CDS detail)
type	STS
link
xref	UniSTS:166312
definition	standard_name : G54773

name	(CDS detail)
type	STS
link
xref	UniSTS:166311
definition	standard_name : G54763

name	(CDS detail)
type	STS
link
xref	UniSTS:142655
definition	standard_name : D6Wum15

name	(CDS detail)
type	STS
link
xref	UniSTS:166305
definition	standard_name : G54757

name	(CDS detail)
type	STS
link
xref	UniSTS:208040
definition	standard_name : C86350

name	(CDS detail)
type	STS
link
xref	UniSTS:166315
definition	standard_name : G54767

name	(CDS detail)
type	STS
link
xref	UniSTS:186751
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142655
definition	standard_name : D6Wum15

name	LOC667706 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255435 GeneID:667706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to ATP binding protein associated with cell differentiation pseudo : _no_value transcript_id : XR_035006.1

name	LOC667715 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255440 GeneID:667715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to interferon stimulated exonuclease gene 20-like 2 pseudo : _no_value transcript_id : XR_035010.1

name	BC064078 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255441 GeneID:408064 MGI:3040692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 39 ESTs product : cDNA sequence BC064078 transcript_id : XR_035011.1

name	LOC667769 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255344 GeneID:667769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins product : similar to killer cell lectin-like receptor subfamily A member 29 pseudo : _no_value transcript_id : XR_002073.2

clone name	MSMg01-099J21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-090N10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-132D08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409L15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-046H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-155G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-344K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-199I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232K15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167G19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-313G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171K06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-172A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-045J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-323O19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-507K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-209J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-182G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-288B21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206H20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454D11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197K15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301D07
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-005L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325L07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-105I05.b	B6Ng01-105I05.g
ACC	DH913516	DH913517
length	347	1,151
definition	DH913516\|Mus musculus domesticus DNA, BAC clone: B6Ng01-105I05, 5' end.	DH913517\|Mus musculus domesticus DNA, BAC clone: B6Ng01-105I05, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ttaagaagcaaatgaaagtgaaacagattggtcagctactggacaaccgg gtagttgcacatatggcctgacatttgctgtgactgcatgcacaaatcct gcccaccgtcaagccagacataaatcctagcatcgagtgagaggatggtt ggtaaattctacccccatatgaacaactattggaaactgatggctgtagg aagagagtcggttttcttcaagaatgtgatagatccctgcaagactgccc acactccagtagatgctcctatacctgtgcatacactggacacactaggt ggactccatgtggaatatgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcaggaaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc aaatgctggcgaggatgtggagaaagaggaacactcctctattgttggtg ggattgcaggcttgtacaaccactccggaaatcagtctggcagttcctca gaaaattgctcatagtactactggaggatccagcaatacctctcctgggc atatatctagaagatgtcccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccaggctggaaagaacccagatgc ccctcaacagaggaatggatacagaaaatgtggtacatttacacaatgga gtactactcagctattaaaaagaatgaatttataaaattcctaggcaaat ggatggacctagagggcatcatcctgagtgaggtaacacattcacaaagg aactcacacaatatgtactcactgataagtggatattagcccaaaaccta ggatacccaagatgtaagatacaatttgctaaacacatgaaactcaagaa gaatgaagagtgaagtgtggacactatgtccctccttagaattgggaacc aaacacccaaggaaggagttacagagccaaagtttggagctgagacgaaa ggatggaccatctagagactgccatatccagggatcaaccccataatcag cttcaaaacctgacaccattgcatacactagcaagattttgttgaaagga ccagatgtagctgtctcttgtgagactatgccggggcctagcaaacacag aagtagatgctcacagtcagctattggatggatcacaggacttcccctgg aagagctgaaaaaagtacccaagagctaaaggatctgtaccctttagtgg aaaaacaatatgaataaccagtacccggagtctgactctgatgcatatgt tcaaaaaaatgccaatcggcctcatggaaaagagtcaatgtcacgcaact atatgccagtaaggaaggccagccagaagataggatggtgtgtaggagtg c
quality values	Open. Hide. 61 61 55 55 52 61 61 49 52 52 61 61 59 59 59 61 61 43 59 12 15 13 10 26 8 8 14 13 13 37 25 30 59 59 52 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 55 59 61 61 61 61 61 59 45 52 37 35 43 30 36 30 41 45 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 59 55 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 31 19 19	Open. Hide. 61 61 52 49 37 15 11 14 9 14 12 18 20 17 12 43 30 41 43 43 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 61 61 59 59 52 49 59 44 28 30 35 59 52 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 59 55 59 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 55 61 61 61 61 61 61 55 55 55 50 50 55 61 61 61 55 61 50 61 55 43 55 55 49 34 55 50 55 50 50 55 55 55 61 50 55 55 55 34 55 38 55 55 50 50 55 50 53 50 53 53 43 43 61 50 50 61 50 61 50 61 47 43 50 50 50 47 50 50 43 50 43 50 35 50 50 61 53 53 43 50 50 47 50 43 50 50 50 43 32 50 47 50 61 43 29 61 61 61 61 35 52 45 39 50 50 47 39 61 61 32 61 47 53 50 61 42 50 42 45 43 50 50 61 35 50 50 53 53 50 50 50 38 47 47 43 39 47 47 39 38 53 34 53 61 24 47 53 45 43 53 47 47 50 53 53 50 52 61 47 35 61 17 43 52 47 45 53 42 53 38 38 27 42 24 33 47 39 53 50 32 38 45 53 42 46 50 45 39 47 53 53 53 53 53 45 53 50 52 34 50 47 53 47 50 35 53 45 53 53 47 42 28 45 39 47 39 33 50 52 53 38 50 47 47 26 47 45 40 31 47 52 30 50 37 43 41 18 35 21 53 26 43 38 30 57 30 57 30 52 31 42 47 35 52 45 38 34 43 38 53 47 33 45 50 36 52 47 53 47 53 35 53 37 25 42 17 53 46 13 52 52 29 31 24 39 23 41 25 45 47 38 53 45 50 53 36 53 53 33 28 35 38 45 45 53 45 50 30 43 47 32 27 31 34 52 40 23 52 45 22 53 45 53 50 30 53 23 31 27 45 53 45 30 50 38 38 14 45 34 46 18 43 16 53 42 32 23 41 26 53 42 30 53 26 24 27 11 32 30 28 36 57 39 50 57 50 30 50 50 28 35 17 38 24 36 52 57 17 7 23 28 25 50 47 34 16 30 30 42 38 28 27 29 50 24 29 38 29 48 29 37 24 37 33 30 31 45 23 40 52 57 26 24 30 19 31 29 45 39 34 18 37 32 40 37 37 35 31 30 30 30 30 24 40 41 23 22 30 20 43 37 24 25 16 40 14 33 57 41 23 22 24 34 37 28 37 37 37 28 36 27 30 23 25 20 48 48 33 14 5 15 13 30 47 44 18 18 25 31 26 15 18 29 13 28 28 18 15 17 39 36 29 22 29 27 31 15 19 9 14 25 10 44 10 11 16 27 25 24 29 11 44 47 26 15 14 16 34 18 24 27 46 28 15 23 23 27 11 29 29 11 16 26 22 21 15 22 22 27 22 8 29 19 28 16 23 12 7 22 20 16 9 29 12 16 22 18 21 19 11 21 18 12 13 9 20 10 8 10 14 7 11 29 7 10 14 28 23 20 14 6 21 7 19 19 8 9 5 5 22 20 12 8 10 7 17 20 23 7 6 19 8 16 20 23 6 32 9 12 28 8 7 7 17 13 7 8 6 32 17 5 5 6 6 9 7 10 28 19 15 5 11 6 11 5 5 16 11 6 12 28 10 8 12 21 8 17 6 21 8 9 38 33 17 12 7 7 5 7 7 6 16 8 6 9 6 5 5 8 4 6 15 7 13 16 7 15 10 7 8 12 9 25 14 24 32 19 8 6 4 4 5 6 5 7 9 11 17 4 4 6 5 7 5 5 10 14 16 12 5 15 4 1 9 8 5 14 9 5 13 8 9 12 4 4 6 4 3 3 8 8 11 4 13 25 4 4 8 4 1 4 1 21 20 11 5 9 11 9 20 5 7 14 6 13 22 5 11 7 5 11 9 12 4 18 16 5 10 4 17 4 5 13 8 16 12 3 5 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_129753341_129753388
seq2: B6Ng01-105I05.b_358_398 (reverse)

seq1  CACACACACACACACACACACACACACACATATTCAAGTAAACACATG  48
      |||||||||||||||||||||||||||||||||||       ||||||
seq2  CACACACACACACACACACACACACACACATATTC-------CACATG  41

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information