MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-188I23
Chromosome	6 (Build37)
Map Location	121,556,881 - 121,715,184
singlet/doublet	doublet
Overlap gene	LOC100043486, A2m, EG640530
Upstream gene	Cecr2, Slc25a18, Atp6v1e1, Bcl2l13, Bid, Mical3, LOC100043793, Minpp1-ps, Pex26, Tuba8, Usp18, Slc6a13, Slc6a12, Iqsec3
Downstream gene	Mug1, Mug4, Mug2, Mug-ps1, Klrg1, LOC625931, M6pr, Phc1, 1700063H04Rik, LOC677375, 4933426K21Rik, EG667035, Mfap5, Aicda, LOC667105, Apobec1, Gdf3, Dppa3, EG667107, LOC100043805, Nanog, LOC100038891, Slc2a3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cecr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330409 MGI:1923799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 2 Proteins

name	Slc25a18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71803 MGI:1919053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11973 MGI:894326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94044 MGI:2136959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bid (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12122 MGI:108093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mical3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194401 MGI:2442733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Minpp1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17331 MGI:1336190
definition	note : multiple inositol polyphosphate histidine phosphatase 1, pseudogene pseudo : _no_value

name	Pex26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74043 MGI:1921293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tuba8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53857 MGI:1858225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24110 MGI:1344364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14412 MGI:95629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14411 MGI:95628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqsec3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243621 MGI:2677208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	A2m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232345 MGI:2449119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640530 MGI:3648717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 6 Proteins

name	Mug1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17836 MGI:99837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mug4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434083 MGI:101843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins

name	Mug2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17837 MGI:99836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mug-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17835 MGI:99838
definition	gene_synonym : Mug3 note : murinoglobulin, pseudogene 1 pseudo : _no_value

name	Klrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50928 MGI:1355294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 150 ESTs, 5 Proteins pseudo : _no_value

name	M6pr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17113 MGI:96904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1700063H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74269 MGI:1921519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC677375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4933426K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108653 MGI:1918325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667035 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667035 MGI:3645406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 730 ESTs, 16 Proteins

name	Mfap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50530 MGI:1354387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aicda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11628 MGI:1342279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Apobec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11810 MGI:103298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14562 MGI:95686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dppa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73708 MGI:1920958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667107 MGI:3646670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 632 ESTs, 5 Proteins pseudo : _no_value

name	LOC100043805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1380 ESTs, 6 Proteins

name	Nanog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71950 MGI:1919200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038891 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20527 MGI:95757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cecr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378057 GeneID:330409 MGI:1923799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 120 ESTs, 2 Proteins product : cat eye syndrome chromosome region, candidate 2 homolog (human), transcript variant 1 transcript_id : XM_204234.6

name	Slc25a18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486669 GeneID:71803 MGI:1919053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier), member 18 transcript_id : NM_001081048.1

name	Atp6v1e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504358 GeneID:11973 MGI:894326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : VATPase, H+ transporting, lysosomal V1 subunit E1 transcript_id : NM_007510.2

name	Bcl2l13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404368 GeneID:94044 MGI:2136959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 13 (apoptosis facilitator) transcript_id : NM_153516.2

name	Bid (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404282 GeneID:12122 MGI:108093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BH3 interacting domain death agonist transcript_id : NM_007544.3

name	Mical3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510262 GeneID:194401 MGI:2442733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated monoxygenase, calponin and LIM domain containing 3 transcript_id : NM_153396.1

name	LOC100043793 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255410 GeneID:100043793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043793 transcript_id : XM_001480986.1

name	Pex26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802833 GeneID:74043 MGI:1921293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome biogenesis factor 26 transcript_id : NM_028730.3

name	Tuba8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394492 GeneID:53857 MGI:1858225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 8 transcript_id : NM_017379.1

name	Usp18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755926 GeneID:24110 MGI:1344364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 18 transcript_id : NM_011909.1

name	Slc6a13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130003 GeneID:14412 MGI:95629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, GABA), member 13 transcript_id : NM_144512.2

name	Slc6a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802667 GeneID:14411 MGI:95628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 transcript_id : NM_133661.2

name	Iqsec3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131079 GeneID:243621 MGI:2677208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif and Sec7 domain 3 transcript_id : NM_001033354.2

name	A2m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342256 GeneID:232345 MGI:2449119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-2-macroglobulin transcript_id : NM_175628.2

name	EG640530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255292 GeneID:640530 MGI:3648717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 6 Proteins product : predicted gene, EG640530 transcript_id : XM_001480274.1

name	Mug1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982170 GeneID:17836 MGI:99837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : murinoglobulin 1 transcript_id : NM_008645.2

name	Mug2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372249 GeneID:17837 MGI:99836
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : murinoglobulin 2 transcript_id : NM_008646.2

name	Klrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850224 GeneID:50928 MGI:1355294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell lectin-like receptor subfamily G, member 1 transcript_id : NM_016970.1

name	M6pr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087131 GeneID:17113 MGI:96904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-6-phosphate receptor, cation dependent transcript_id : NM_010749.6

name	Phc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835732 GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyhomeotic-like 1 (Drosophila) transcript_id : NM_001042623.1

name	Phc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110835730 GeneID:13619 MGI:103248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyhomeotic-like 1 (Drosophila) transcript_id : NM_007905.2

name	1700063H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255412 GeneID:74269 MGI:1921519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700063H04 gene transcript_id : XM_001481012.1

name	LOC677375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255298 GeneID:677375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC677375 transcript_id : XM_001480303.1

name	4933426K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134254428 GeneID:108653 MGI:1918325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933426K21 gene transcript_id : NM_027664.1

name	EG667035 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94378075 GeneID:667035 MGI:3645406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 730 ESTs, 16 Proteins product : predicted gene, EG667035 transcript_id : XM_001002242.1

name	Mfap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131047 GeneID:50530 MGI:1354387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microfibrillar associated protein 5 transcript_id : NM_015776.2

name	Aicda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940064 GeneID:11628 MGI:1342279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activation-induced cytidine deaminase transcript_id : NM_009645.2

name	Apobec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130296 GeneID:11810 MGI:103298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 1 transcript_id : NM_031159.3

name	Gdf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362178 GeneID:14562 MGI:95686
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 3 transcript_id : NM_008108.3

name	Dppa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21218415 GeneID:73708 MGI:1920958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : developmental pluripotency-associated 3 transcript_id : NM_139218.1

name	LOC100043805 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255415 GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1376 ESTs, 6 Proteins product : similar to ribosomal protein L15, transcript variant 1 transcript_id : XM_001481031.1

name	LOC100043805 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255417 GeneID:100043805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1378 ESTs, 6 Proteins product : similar to ribosomal protein L15, transcript variant 2 transcript_id : XM_001481032.1

name	Nanog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625917 GeneID:71950 MGI:1919200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nanog homeobox transcript_id : NM_028016.1

name	LOC100038891 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255105 GeneID:100038891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038891 transcript_id : XM_001471588.1

name	Slc2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377808 GeneID:20527 MGI:95757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 2 (facilitated glucose transporter), member 3 transcript_id : NM_011401.3

name	Cecr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029810 GeneID:330409 MGI:1923799
definition	codon_start : 1 product : cat eye syndrome chromosome region, candidate 2 homolog isoform 1 protein_id : XP_204234.5

name	Slc25a18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486670 GeneID:71803 MGI:1919053
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25 (mitochondrial carrier), member 18 protein_id : NP_001074517.1

name	Atp6v1e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504359 CCDS:CCDS20484.1 GeneID:11973 MGI:894326
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IMP]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015991 - ATP hydrolysis coupled proton transport [Evidence IMP]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting lysosomal (vacuolar proton pump), 32 kDa; H(+)-ATPase E-like protein; H+ ATPase subunit E; lysosomal 31kDa; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E; ATPase, H+ transporting, V1 subunit E product : vacuolar H+ ATPase E1 protein_id : NP_031536.2

name	Bcl2l13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943828 CCDS:CCDS20485.1 GeneID:94044 MGI:2136959
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008656 - caspase activator activity [Evidence ISS] GO_process : GO:0006919 - caspase activation [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS] codon_start : 1 note : mitochondria located 1 homolog product : BCL2-like 13 protein_id : NP_705736.1

name	Bid (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542228 CCDS:CCDS20486.1 GeneID:12122 MGI:108093
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 product : BH3 interacting domain death agonist protein_id : NP_031570.2

name	Mical3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510263 CCDS:CCDS20487.1 GeneID:194401 MGI:2442733
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : flavoprotein oxidoreductase MICAL3 product : microtubule associated monoxygenase, calponin and LIM domain containing 3 protein_id : NP_700445.1

name	LOC100043793 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255411 GeneID:100043793
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481036.1

name	Pex26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311973 CCDS:CCDS20488.1 GeneID:74043 MGI:1921293
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005779 - integral to peroxisomal membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0045046 - protein import into peroxisome membrane [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : peroxisome biogenesis factor 26 protein_id : NP_083006.1

name	Tuba8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394493 GeneID:53857 MGI:1858225
definition	GO_component : GO:0005874 - microtubule [Evidence ISS] [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence ISS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, alpha 8 protein_id : NP_059075.1

name	Usp18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755927 CCDS:CCDS20489.1 GeneID:24110 MGI:1344364
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0019785 - ISG15-specific protease activity [Evidence IMP]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IMP]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ubiquitin specific protease 15 product : ubiquitin specific protease 18 protein_id : NP_036039.1

name	Slc6a13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362295 CCDS:CCDS20490.1 GeneID:14412 MGI:95629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma-aminobutyric acid (GABA-A) transporter 3 product : solute carrier family 6 (neurotransmitter transporter, GABA), member 13 protein_id : NP_653095.1

name	Slc6a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92110009 GeneID:14411 MGI:95628
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma-aminobutyric acid (GABA-A) transporter 2 product : solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 protein_id : NP_598422.2

name	Iqsec3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781690 CCDS:CCDS20491.1 GeneID:243621 MGI:2677208
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : IQ motif and Sec7 domain 3 protein_id : NP_001028526.1

name	A2m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28274695 GeneID:232345 MGI:2449119
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0030414 - protease inhibitor activity [Evidence TAS] codon_start : 1 exception : unclassified translation discrepancy product : alpha-2-macroglobulin protein_id : NP_783327.1

name	EG640530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255293 GeneID:640530 MGI:3648717
definition	codon_start : 1 product : similar to Murinoglobulin 1 protein_id : XP_001480324.1

name	Mug1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982171 GeneID:17836 MGI:99837
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 product : murinoglobulin 1 protein_id : NP_032671.2

name	Mug2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678966 GeneID:17837 MGI:99836
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0017114 - wide-spectrum protease inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : murinoglobulin 2 protein_id : NP_032672.1

name	Klrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850225 CCDS:CCDS20492.1 GeneID:50928 MGI:1355294
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence TAS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS] codon_start : 1 product : killer cell lectin-like receptor subfamily G, member 1 protein_id : NP_058666.1

name	M6pr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14916479 CCDS:CCDS20493.1 GeneID:17113 MGI:96904
definition	GO_component : GO:0005768 - endosome [Evidence ISS]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA]; GO:0000323 - lytic vacuole [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence IEA]; GO:0015578 - mannose transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015761 - mannose transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mannose-6-phosphate receptor, cation dependent protein_id : NP_034879.2

name	Phc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835733 GeneID:13619 MGI:103248
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; early development regulator1 (homolog of polyhomeotic 1); early development regulator 1 (homolog of polyhomeotic 1) product : polyhomeotic-like 1 isoform b protein_id : NP_001036088.1

name	Phc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835731 CCDS:CCDS20494.1 GeneID:13619 MGI:103248
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; early development regulator1 (homolog of polyhomeotic 1); early development regulator 1 (homolog of polyhomeotic 1) product : polyhomeotic-like 1 isoform a protein_id : NP_031931.2

name	1700063H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255413 GeneID:74269 MGI:1921519
definition	codon_start : 1 product : hypothetical protein LOC74269 protein_id : XP_001481062.1

name	LOC677375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255299 GeneID:677375
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480353.1

name	4933426K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134254429 GeneID:108653 MGI:1918325
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006464 - protein modification [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC108653 protein_id : NP_081940.1

name	EG667035 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94378076 GeneID:667035 MGI:3645406
definition	codon_start : 1 product : similar to fusion protein: ubiquitin (bases 43_513); ribosomal protein S27a (bases 217_532) protein_id : XP_001002242.1

name	Mfap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657329 CCDS:CCDS20496.1 GeneID:50530 MGI:1354387
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0001527 - microfibril [Evidence TAS] GO_function : GO:0030023 - extracellular matrix constituent conferring elasticity [Evidence TAS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : microfibrillar associated protein 5 protein_id : NP_056591.1

name	Aicda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753018 CCDS:CCDS20497.1 GeneID:11628 MGI:1342279
definition	EC_number : 3.5.4.5 GO_function : GO:0004126 - cytidine deaminase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : activation induced deaminase product : activation-induced cytidine deaminase protein_id : NP_033775.1

name	Apobec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624299 CCDS:CCDS20498.1 GeneID:11810 MGI:103298
definition	GO_function : GO:0004126 - cytidine deaminase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016554 - cytidine to uridine editing [Evidence IMP]; GO:0042157 - lipoprotein metabolism [Evidence IMP]; GO:0006381 - mRNA editing [Evidence IMP]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 1 protein_id : NP_112436.1

name	Gdf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677587 CCDS:CCDS20499.1 GeneID:14562 MGI:95686
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0040007 - growth [Evidence IEA] codon_start : 1 product : growth differentiation factor 3 protein_id : NP_032134.2

name	Dppa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218416 CCDS:CCDS20500.1 GeneID:73708 MGI:1920958
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0001940 - male pronucleus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0040016 - embryonic cleavage [Evidence IMP] codon_start : 1 note : primordial germ cell 7 product : developmental pluripotency-associated 3 protein_id : NP_631964.1

name	LOC100043805 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255416 GeneID:100043805
definition	codon_start : 1 product : similar to ribosomal protein L15 isoform 1 protein_id : XP_001481081.1

name	LOC100043805 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255418 GeneID:100043805
definition	codon_start : 1 product : similar to ribosomal protein L15 isoform 2 protein_id : XP_001481082.1

name	Nanog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625918 GeneID:71950 MGI:1919200
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0009880 - embryonic pattern specification [Evidence IEP]; GO:0008406 - gonad development [Evidence IEP]; GO:0042664 - negative regulation of endodermal cell fate specification [Evidence TAS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0017145 - stem cell division [Evidence IDA] codon_start : 1 note : early embryo specific expression NK family product : homeobox transcription factor Nanog protein_id : NP_082292.1

name	LOC100038891 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255106 GeneID:100038891
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471638.1

name	Slc2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543726 CCDS:CCDS20502.1 GeneID:20527 MGI:95757
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0008643 - carbohydrate transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 2 (facilitated glucose transporter), member 3 protein_id : NP_035531.2

name	LOC100043486 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043486
definition	number : 1 pseudo : _no_value

name	LOC100043486 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043486
definition	number : 2 pseudo : _no_value

name	LOC667105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667105
definition	number : 2 pseudo : _no_value

name	LOC667105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667105
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:142945
definition	standard_name : EC100RL

name	(CDS detail)
type	STS
link
xref	UniSTS:130923
definition	standard_name : D6Mit369

name	(CDS detail)
type	STS
link
xref	UniSTS:235544
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165487
definition	standard_name : AW125787

name	(CDS detail)
type	STS
link
xref	UniSTS:167485
definition	standard_name : RH127114

name	(CDS detail)
type	STS
link
xref	UniSTS:249716
definition	standard_name : AA818483

name	(CDS detail)
type	STS
link
xref	UniSTS:208025
definition	standard_name : AW105739

name	(CDS detail)
type	STS
link
xref	UniSTS:235540
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:208023
definition	standard_name : AU022477

name	(CDS detail)
type	STS
link
xref	UniSTS:159565
definition	standard_name : AU022477

name	(CDS detail)
type	STS
link
xref	UniSTS:141177
definition	standard_name : Bid

name	(CDS detail)
type	STS
link
xref	UniSTS:165485
definition	standard_name : AI875481

name	(CDS detail)
type	STS
link
xref	UniSTS:141176
definition	standard_name : Bid

name	(CDS detail)
type	STS
link
xref	UniSTS:224314
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:248252
definition	standard_name : BE109414

name	(CDS detail)
type	STS
link
xref	UniSTS:235546
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:142946
definition	standard_name : EC100RR

name	(CDS detail)
type	STS
link
xref	UniSTS:130761
definition	standard_name : D6Mit216

name	(CDS detail)
type	STS
link
xref	UniSTS:225199
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179452
definition	standard_name : AW047653

name	(CDS detail)
type	STS
link
xref	UniSTS:225232
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210070
definition	standard_name : RH136075

name	(CDS detail)
type	STS
link
xref	UniSTS:143157
definition	standard_name : Gabt3

name	(CDS detail)
type	STS
link
xref	UniSTS:143156
definition	standard_name : Gabt2

name	(CDS detail)
type	STS
link
xref	UniSTS:246714
definition	standard_name : BI295714

name	(CDS detail)
type	STS
link
xref	UniSTS:235547
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:227699
definition	standard_name : D4Arb40

name	(CDS detail)
type	STS
link
xref	UniSTS:159566
definition	standard_name : MHAa82c12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:159566
definition	standard_name : MHAa82c12.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:160950
definition	standard_name : RH118304

name	(CDS detail)
type	STS
link
xref	UniSTS:185684
definition	standard_name : AF097357

name	(CDS detail)
type	STS
link
xref	UniSTS:179456
definition	standard_name : AW557034

name	(CDS detail)
type	STS
link
xref	UniSTS:235548
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235549
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:225109
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179455
definition	standard_name : AI325948

name	(CDS detail)
type	STS
link
xref	UniSTS:224890
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:209818
definition	standard_name : RH127292

name	(CDS detail)
type	STS
link
xref	UniSTS:179458
definition	standard_name : C78318

name	(CDS detail)
type	STS
link
xref	UniSTS:496657
definition	standard_name : Gdf3

name	(CDS detail)
type	STS
link
xref	UniSTS:498798
definition	standard_name : Nanog

name	(CDS detail)
type	STS
link
xref	UniSTS:163064
definition	standard_name : RH126356

name	(CDS detail)
type	STS
link
xref	UniSTS:124798
definition	standard_name : D19270

name	(CDS detail)
type	STS
link
xref	UniSTS:161573
definition	standard_name : RH124751

name	(CDS detail)
type	STS
link
xref	UniSTS:159568
definition	standard_name : AU040424

name	(CDS detail)
type	STS
link
xref	UniSTS:235551
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162343
definition	standard_name : RH125527

name	(CDS detail)
type	STS
link
xref	UniSTS:235552
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:125668
definition	standard_name : U11853

name	(CDS detail)
type	STS
link
xref	UniSTS:271942
definition	standard_name : PMC20520P1

name	(CDS detail)
type	STS
link
xref	UniSTS:144424
definition	standard_name : Slc2a3

name	(CDS detail)
type	STS
link
xref	UniSTS:144425
definition	standard_name : Slc2a3

name	(CDS detail)
type	STS
link
xref	UniSTS:144426
definition	standard_name : Slc2a3

name	(CDS detail)
type	misc_feature
link
xref
definition	function : clone overlap note : overlaps bases 1..54896 of clone AC153579

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : variable size of repeat between subclones gene_synonym : Mug3 note : variable size of repeat (polyAGGCAG) in subclone, size 23-25, deletion at 77806 pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : pcr product sequence only gene_synonym : Mug3 note : PCR product sequence only pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : unsure gene_synonym : Mug3 note : unsure base: C/T pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : single clone coverage gene_synonym : Mug3 note : single subclone pseudo : _no_value

name	Mug-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	function : variable size of repeat between subclones gene_synonym : Mug3 note : variable size of repeat (polyGA) in subclone, size 27-28, deletion at 88510 pseudo : _no_value

name	Mug4 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255294 GeneID:434083 MGI:101843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : murinoglobulin 4 transcript_id : XR_035731.1

name	LOC625931 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255295 GeneID:625931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 150 ESTs, 5 Proteins product : similar to nuclear protein-NHP2-like protein pseudo : _no_value transcript_id : XR_034615.1

name	EG667107 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255414 GeneID:667107 MGI:3646670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 632 ESTs, 5 Proteins product : predicted gene, EG667107 pseudo : _no_value transcript_id : XR_001974.2

clone name	MSMg01-350L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-400P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-399M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-194H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404K14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-364G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190E11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-467G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-188I23.b	B6Ng01-188I23.g
ACC	GA012830	GA012831
length	1,214	1,152
definition	B6Ng01-188I23.b	B6Ng01-188I23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(121,556,881 - 121,557,892)	(121,714,017 - 121,715,184)
sequence	gaattctccttttcaatggagcttccccttccccactgaccttatctggg gactaagcacagatgtctgaccttatctggaggatgaccctgcacagagc ttcctgcaagtgctgcatgattcagcacgtaagtccttgctcagcccttc ctgacatgacaattacgtactgtgttatgagcagtcaaccctcttctccg tacccctaagagccctaatgtaccctatacttggagcattaaagtcaagc tgtctgaagcagtctccagaagtcctttcatcatctcacagctggcaaac cttgctcgttgcttctgctaccttcacccttgtggaccagtggccaatga ccttcaatgagaaaggaaacccacacatagtgtgtgagtttcaggacacc cagggctaagtagagagaccctttcccaaaaaataaaacaaaagacaacc atttgtgtatttaactaatcttaaaattctatctgctttgtctatatatg tttgaagttctgtattaggaacacgaatatttagaattatatgctttttg gaatctgtatctatttatcattacgaaatgatcttatttgttcctgataa tgtttttctctgaaatatattttgattaacatttaaaacttgagatgggg tcttatacatcatccaagttggctttgtactcctgggcttaactaaaagc aatgacttcacttaggtgctactggcctaaggaagaggtcttaatctaag gtgtgatagtttaaatgagatttcccttcaaatgagaggacattgagatc cccaacaaaaatcagttataaatatgttcaaagtttcagagaacacaaac ttaggaatgaatttaaaagaatgaaaataatctgggtggattcaaaagga acacaaacaaatagctgaatgaataaatcagttaaggattttagaagatg tgatatgcatgttggagtccagcaatggtttcacatcctccaattcctcc tacttagggtatccaaatgtcactgcacaccagggctggaagagtgaagc agaagttcatcttggatgggtggagttcttcaagaatccctttcggacaa gagtaagtgcttggggctatatggtaggcttctctgaggatcttaggtga cgctcttttagacggagggcctcctctcaaaggacttttaataaaacagc tctctctttagata	gaattctttggttttgttttgttttgttgttgtttgtttgctgtttgttt gtttgttgtttcaatttggagccagtactcaccaggtagtagaaaacgag ctctttcagcactccaaagtcccacttcagaataaaatgtgcctgaactg tgtgaatctggttgcagggcaagatgctgctggtctctgtgtcaaggtag atgtagctcttgctgagggaagaaacagcataggccacatgatctgcact tgcatatctttcctccatgcaatagaaatgggaatatgaatcttcctctt tgtgtttgacctggaaaaacaacaaaatactatgccgtagattgcctagc agacagaatatctcttctgtgatgaatcagtgggttttcccattttattt aatgattgagtatttgtacatattattaaaaatggaggggaatttcatta aatggattgatgtctaacaccctgaattttcagaatcgaagcaaatattt ataccaggtaagagggaaaaaggaagtgcattatttttatcagacaaagg aaccatttattgtgcatctaatatataatgaaaattttacagatataaat tttagtgaataatgaatgtagaaaataattgtttaacagaaatattttca tatattaatgtagtgtactctgagcatcttcatccaccttacaatggcat tctatgtctcctgctggctctattcttccttaatggaccctctctgcttt cattcctgtttccctaggttccacatatgggggacttacagagataattt ctcctagtctcatacgcttttcttataatgacaatgtacaaatccattca tttctctatagacaagatgactctcttataaatatctgagtaaaagtcca atgtgaacatatttacaaattttctctatccactcatgtaacagtgggct tttcctgatgtgccagttcataaagtatgactgcaagaatgaatattcat acctgtttattctttctgttggtactctcagtttgggcaaatttctcaca cctaactctacccagaaattctctcaatacctacctcacctcccgggttc tgtctgaagcctaatgccaatggccatttaatgacaggtatgcttccata aa
quality values	Open. Hide. 58 31 35 37 58 54 62 62 62 62 62 62 62 37 16 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 45 43 30 28 31 29 20 28 28 28 33 34 38 46 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 49 33 46 56 54 46 56 54 54 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 54 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 56 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 44 49 62 62 62 62 56 49 44 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 47 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 54 52 54 54 58 58 58 58 58 58 54 54 54 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 47 52 58 58 43 48 58 54 54 58 58 58 58 46 58 58 58 54 54 54 54 54 58 58 54 52 58 43 58 52 49 54 47 47 58 54 52 58 58 58 58 58 51 50 50 58 58 58 58 58 58 44 42 46 50 49 48 50 51 54 41 53 50 41 48 48 51 51 58 51 51 39 33 58 58 58 58 50 51 58 49 53 53 39 49 29 58 52 50 50 48 39 39 43 47 58 49 39 41 42 54 53 58 50 51 46 49 51 50 51 51 51 58 58 49 51 53 53 49 39 46 42 58 51 58 40 40 51 50 46 58 33 44 58 39 35 19 39 49 51 35 13 46 37 50 50 49 41 38 49 58 28 27 50 53 42 43 19 49 28 32 37 47 26 47 32 52 53 45 37 41 39 40 37 49 44 26 51 40 54 49 51 47 33 53 42 54 54 30 19 42 39 47 51 52 31 34 27 54 42 31 33 25 35 28 32 21 54 44 37 53 53 37 27 12 31 37 21 32 35 44 52 53 33 39 33 33 42 33 42 21 32 32 32 53 47 47 42 31 35 40 32 46 37 31 45 39 52 44 47 28 35 52 32 32 32 43 53 31 32 32 51 26 40 26 14 52 18 51 26 26 21 33 29 32 29 25 30 45 31 27 31 51 29 30 31 31 29 22 46 42 38 51 51 45 26 34 30 30 45 41 51 46 40 25 16 16 30 31 31 31 51 32 25 46 22 31 18 42 34 21 40 40 32 37 36 25 25 26 15 25 28 28 20 26 27 28 22 26 21 31 34 42 31 31 33 31 32 22 7 25 23 41 18 14 30 26 21 31 26 20 7 19 16 27 30 48 48 35 25 17 28 32 15 39 14 31 29 32 31 23 23 27 32 31 24 31 29 31 16 37 18 38 18 31 18 24 22 23 36 20 14 28 28 29 19 47 13 27 18 26 13 32 30 14 11 14 31 7 6 44 34 16 9 10 6 30 31 27 27 15 25 14 27 40 31 7 21 32 17 19 21 48 22 25 33 32 25 21 28 32 32 19 12 22 18 21 25 18 14 39 10 10 32 33 33 22 32 8 17 6 11 15 13 23 27 28 6 5 11 6 4 15 21 19 21 8 17 6 10 30 19 3 6 24 19 5 8 23 15 19 10 21 20 22 17 20 11 14 24 13 9 25 21 16 27 7 5 3 3 3 5 5 5 3 4 5 30 8 5 6 7 11 5 4 5 9 6 6 14 21 18 5 2 9 13 15 12 20 16 17 7 10 8 14 7 3 4 11 4 4 10 5 18 6 13 7 12 6 4 6 2 1 3 5 2 2 1 3 5 2 1 4 25 16 8 6 4 8 12 10 6 4 4 6 7 9 3 4 16 8 5 6 4 16 8 15 5 6 3 2 2 4 11 10 11 3 2 2 5 18 27 4 5 5 8 2 1 3 4 5 9 6 4 8 4 4 4 4 3 6	Open. Hide. 62 47 56 47 62 62 62 62 62 62 44 26 30 27 21 28 31 34 34 32 28 34 32 32 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 51 59 51 50 51 51 59 59 54 49 54 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 56 56 56 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 47 62 62 62 62 62 46 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 52 47 52 52 52 62 62 62 62 62 62 62 62 54 62 41 45 50 58 58 58 58 58 58 54 58 49 58 58 58 58 58 58 58 58 58 54 54 58 52 54 54 58 58 54 58 58 58 58 54 58 58 36 43 58 54 52 54 54 58 52 58 28 38 54 52 54 58 45 54 54 58 58 52 54 54 52 54 47 45 47 54 54 52 54 58 58 54 58 58 58 54 58 58 49 51 58 50 48 50 47 41 52 58 42 50 58 54 58 58 58 58 58 51 54 51 58 58 58 49 46 38 45 45 58 58 58 58 58 51 58 53 58 58 58 49 50 49 50 44 58 58 53 58 47 50 50 44 48 48 58 49 31 48 49 41 58 58 50 49 39 53 58 50 50 58 41 48 48 46 58 41 52 50 53 58 37 35 34 39 39 51 58 51 22 49 38 50 37 49 49 52 42 53 49 46 37 44 44 50 50 37 43 29 49 50 58 44 50 39 46 46 35 33 53 52 54 46 34 52 36 39 35 51 49 41 49 54 37 38 41 53 39 40 50 41 33 31 19 25 38 53 32 53 45 54 42 41 26 49 47 42 37 42 40 39 45 42 54 54 11 22 24 46 31 28 34 34 54 40 54 41 31 51 40 37 38 16 49 38 33 34 52 32 32 32 45 34 34 53 49 49 32 29 34 14 31 42 31 32 31 29 53 32 39 31 32 52 25 53 29 27 27 31 51 28 41 28 29 37 30 29 31 31 31 31 24 30 37 51 51 46 32 27 31 31 32 28 40 31 42 36 31 25 21 31 42 24 19 27 35 47 26 37 24 26 25 28 27 29 30 42 47 31 28 31 26 27 28 38 34 31 30 25 31 29 30 31 25 31 31 18 32 21 30 31 32 38 31 31 33 46 22 30 25 30 32 43 36 35 16 34 31 46 46 36 18 25 10 25 8 28 31 37 18 31 25 27 14 13 31 25 31 48 21 23 26 7 43 6 44 48 48 27 20 24 21 20 24 20 21 31 18 12 14 26 30 28 33 31 33 9 32 32 14 13 27 48 32 22 33 43 43 30 8 13 16 32 32 23 17 18 19 11 7 4 9 18 9 16 22 26 31 47 39 18 27 24 32 25 32 24 25 21 21 17 37 31 19 19 24 28 16 21 11 3 8 21 17 3 3 6 18 17 10 15 5 40 10 23 10 13 4 5 29 20 8 8 24 7 9 8 3 3 5 3 3 5 15 24 27 8 18 31 8 15 21 14 7 13 40 13 19 28 9 17 20 16 5 6 4 4 13 6 8 13 12 6 6 6 6 18 22 20 9 10 20 30 11 11 10 12 7 8 6 11 4 5 17 6 9 7 5 3 4 5 8 2 5 11 11 13 7 22 20 4 7 3 4 2 6 5 9 4 9 10 8 7 13 5 7 6 7 9 13 1 3 2 4 7 13 4 14 6 3 4 6 15 17 6 5 5 21 8 4 6 3 5 2 3 13 4 7 5 6 5 5 25 8 4 7 18 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_121556881_121557892
seq2: B6Ng01-188I23.b_244_1260

seq1  TCCGTACCCCTAAGAGCCCTAATGTACCCTATACTTGGAGCATTAAAGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTACCCCTAAGAGCCCTAATGTACCCTATACTTGGAGCATTAAAGTC  50

seq1  AAGCTGTCTGAAGCAGTCTCCAGAAGTCCTTTCATCATCTCACAGCTGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTGTCTGAAGCAGTCTCCAGAAGTCCTTTCATCATCTCACAGCTGGC  100

seq1  AAACCTTGCTCGTTGCTTCTGCTACCTTCACCCTTGTGGACCAGTGGCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCTTGCTCGTTGCTTCTGCTACCTTCACCCTTGTGGACCAGTGGCCA  150

seq1  ATGACCTTCAATGAGAAAGGAAACCCACACATAGTGTGTGAGTTTCAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACCTTCAATGAGAAAGGAAACCCACACATAGTGTGTGAGTTTCAGGA  200

seq1  CACCCAGGGCTAAGTAGAGAGACCCTTTCCCAAAAAATAAAACAAAAGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCAGGGCTAAGTAGAGAGACCCTTTCCCAAAAAATAAAACAAAAGAC  250

seq1  AACCATTTGTGTATTTAACTAATCTTAAAATTCTATCTGCTTTGTCTATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCATTTGTGTATTTAACTAATCTTAAAATTCTATCTGCTTTGTCTATA  300

seq1  TATGTTTGAAGTTCTGTATTAGGAACACGAATATTTAGAATTATATGCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTTTGAAGTTCTGTATTAGGAACACGAATATTTAGAATTATATGCTT  350

seq1  TTTGGAATCTGTATCTATTTATCATTACGAAATGATCTTATTTGTTCCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAATCTGTATCTATTTATCATTACGAAATGATCTTATTTGTTCCTG  400

seq1  ATAATGTTTTTCTCTGAAATATATTTTGATTAACATTTAAAACTTGAGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATGTTTTTCTCTGAAATATATTTTGATTAACATTTAAAACTTGAGAT  450

seq1  GGGGTCTTATACATCATCCAAGTTGGCTTTGTACTCCTGGGCTTAACTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTCTTATACATCATCCAAGTTGGCTTTGTACTCCTGGGCTTAACTAA  500

seq1  AAGCAATGACTTCACTTAGGTGCTACTGGCCTAAGGAAGAGGTCTTAATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAATGACTTCACTTAGGTGCTACTGGCCTAAGGAAGAGGTCTTAATC  550

seq1  TAAGGTGTGATAGTTTAAATGAGATTTCCCTTCAAATGAGAGGACATTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGTGTGATAGTTTAAATGAGATTTCCCTTCAAATGAGAGGACATTGA  600

seq1  GATCCCCAACAAAAATCAGTTATAAATATGTTCAAAGTTTCAGAGAACAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCCCAACAAAAATCAGTTATAAATATGTTCAAAGTTTCAGAGAACAC  650

seq1  AAACTTAGGAATGAATTTAAAAGAATGAAAATAATCTGGGTGGATTCAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTTAGGAATGAATTTAAAAGAATGAAAATAATCTGGGTGGATTCAAA  700

seq1  AGGAACACAAACAAATAGCTGAATGAAATAAATCAGTTAAGGATTTTAGA  750
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AGGAACACAAACAAATAGCTGAATG-AATAAATCAGTTAAGGATTTTAGA  749

seq1  AGATGTGATATGCATGTTGGAGTCCAGCAATGGTTTCACATCCTCCATTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  AGATGTGATATGCATGTTGGAGTCCAGCAATGGTTTCACATCCTCCAATT  799

seq1  CCTCCTACTTAGGGTATCCAAATGTCACTGCACACCA-GGCTGGAAGAGT  849
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  CCTCCTACTTAGGGTATCCAAATGTCACTGCACACCAGGGCTGGAAGAGT  849

seq1  GAAGCAG-AGTTCATCTGGGATGGGTGGAGTTCTTCAAG-ATCCCTGTCT  897
      ||||||| ||||||||| ||||||||||||||||||||| |||||| || 
seq2  GAAGCAGAAGTTCATCTTGGATGGGTGGAGTTCTTCAAGAATCCCTTTCG  899

seq1  GAGCAGGAGTAAGTGC-TGGGGCTATATGGTAGGCCTTCTCTGAGGATCT  946
      || || |||||||||| ||||||||||||||||| |||||||||||||||
seq2  GA-CAAGAGTAAGTGCTTGGGGCTATATGGTAGG-CTTCTCTGAGGATCT  947

seq1  TAGTGTGACAGCTCTTTTAGACGGA-GGCCTCCTC-CAAAGGTC-TTTAA  993
      ||| ||||| ||||||||||||||| ||||||||| |||||| | |||||
seq2  TAG-GTGAC-GCTCTTTTAGACGGAGGGCCTCCTCTCAAAGGACTTTTAA  995

seq1  TAAAACAGCTCTC---TTAGAT  1012
      |||||||||||||   ||||||
seq2  TAAAACAGCTCTCTCTTTAGAT  1017

seq1: chr6_121714017_121715184
seq2: B6Ng01-188I23.g_66_1217 (reverse)

seq1  TTTATGGAAGCATCACCTGTCAATAAAATGCCATTGGCCTATTA-GCTTC  49
      ||||||||||||| |||||||| ||||  |||||||||  |||| |||||
seq2  TTTATGGAAGCAT-ACCTGTCATTAAATGGCCATTGGC--ATTAGGCTTC  47

seq1  AGCAGGAAACCGGGAGGTGGAAGTTAAGGTATGGAGAGAATTTCTGGGGT  99
      ||   ||| ||||||||||  || | |||||| |||||||||||| ||||
seq2  AGACAGAACCCGGGAGGTG--AGGT-AGGTATTGAGAGAATTTCT-GGGT  93

seq1  AGAGTTAGGTGTGAGAAATTTGCCCCAAACTGAGAGGTAACCAACAGAAA  149
      |||||||||||||||||||||| |||||||||||||   |||||||| ||
seq2  AGAGTTAGGTGTGAGAAATTTG-CCCAAACTGAGAG--TACCAACAG-AA  139

seq1  AGAATAAACAGGGTAATTGAATAATTCATTCTTGCAGTCATACTTTTATG  199
      |||||||||| ||||  ||||| |||||||||||||||||||| ||||||
seq2  AGAATAAACA-GGTA--TGAAT-ATTCATTCTTGCAGTCATAC-TTTATG  184

seq1  AACTTGGGCACATCAGGAAAAGCCCACTGTTACATGAGTGGATAGAGAAA  249
      ||||  ||||||||||||||||||||||||||||||||||||||||||||
seq2  AACT--GGCACATCAGGAAAAGCCCACTGTTACATGAGTGGATAGAGAAA  232

seq1  A-TTGTAAATATGTTCACATTGGACTTTTACTCAGATATTTATAAGAGAG  298
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGTAAATATGTTCACATTGGACTTTTACTCAGATATTTATAAGAGAG  282

seq1  TCATCTTGTCTATAGAGAAATGAATGGATTTGTACATTGTCATTATAAGA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATCTTGTCTATAGAGAAATGAATGGATTTGTACATTGTCATTATAAGA  332

seq1  AAAGCGTATGAGACTAGGAGAAATTATCTCTGTAAGTCCCCCATATGTGG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCGTATGAGACTAGGAGAAATTATCTCTGTAAGTCCCCCATATGTGG  382

seq1  AACCTAGGGAAACAGGAATGAAAGCAGAGAGGGTCCATTAAGGAAGAATA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTAGGGAAACAGGAATGAAAGCAGAGAGGGTCCATTAAGGAAGAATA  432

seq1  GAGCCAGCAGGAGACATAGAATGCCATTGTAAGGTGGATGAAGATGCTCA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCAGCAGGAGACATAGAATGCCATTGTAAGGTGGATGAAGATGCTCA  482

seq1  GAGTACACTACATTAATATATGAAAATATTTCTGTTAAACAATTATTTTC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTACACTACATTAATATATGAAAATATTTCTGTTAAACAATTATTTTC  532

seq1  TACATTCATTATTCACTAAAATTTATATCTGTAAAATTTTCATTATATAT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATTCATTATTCACTAAAATTTATATCTGTAAAATTTTCATTATATAT  582

seq1  TAGATGCACAATAAATGGTTCCTTTGTCTGATAAAAATAATGCACTTCCT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATGCACAATAAATGGTTCCTTTGTCTGATAAAAATAATGCACTTCCT  632

seq1  TTTTCCCTCTTACCTGGTATAAATATTTGCTTCGATTCTGAAAATTCAGG  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCCCTCTTACCTGGTATAAATATTTGCTTCGATTCTGAAAATTCAGG  682

seq1  GTGTTAGACATCAATCCATTTAATGAAATTCCCCTCCATTTTTAATAATA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTAGACATCAATCCATTTAATGAAATTCCCCTCCATTTTTAATAATA  732

seq1  TGTACAAATACTCAATCATTAAATAAAATGGGAAAACCCACTGATTCATC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACAAATACTCAATCATTAAATAAAATGGGAAAACCCACTGATTCATC  782

seq1  ACAGAAGAGATATTCTGTCTGCTAGGCAATCTACGGCATAGTATTTTGTT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAAGAGATATTCTGTCTGCTAGGCAATCTACGGCATAGTATTTTGTT  832

seq1  GTTTTTCCAGGTCAAACACAAAGAGGAAGATTCATATTCCCATTTCTATT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTCCAGGTCAAACACAAAGAGGAAGATTCATATTCCCATTTCTATT  882

seq1  GCATGGAGGAAAGATATGCAAGTGCAGATCATGTGGCCTATGCTGTTTCT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGGAGGAAAGATATGCAAGTGCAGATCATGTGGCCTATGCTGTTTCT  932

seq1  TCCCTCAGCAAGAGCTACATCTACCTTGACACAGAGACCAGCAGCATCTT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCAGCAAGAGCTACATCTACCTTGACACAGAGACCAGCAGCATCTT  982

seq1  GCCCTGCAACCAGATTCACACAGTTCAGGCACATTTTATTCTGAAGTGGG  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTGCAACCAGATTCACACAGTTCAGGCACATTTTATTCTGAAGTGGG  1032

seq1  ACTTTGGAGTGCTGAAAGAGCTCGTTTTCTACTACCTGGTGAGTACTGGC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTGGAGTGCTGAAAGAGCTCGTTTTCTACTACCTGGTGAGTACTGGC  1082

seq1  TCCAAATTGAAACAACAAACAAACAAACAGCAAACAAACAACAACAAAAC  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAATTGAAACAACAAACAAACAAACAGCAAACAAACAACAACAAAAC  1132

seq1  AAAACAAAACCAAAGAATTC  1168
      ||||||||||||||||||||
seq2  AAAACAAAACCAAAGAATTC  1152

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information