MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-190I10
Chromosome	6 (Build37)
Map Location	91,280,501 - 91,406,906
singlet/doublet	doublet
Overlap gene	Wnt7a, LOC100043659, LOC625420
Upstream gene	Uroc1, Zxdc, Ccdc37, Klf15, Aldh1l1, Slc41a3, Iqsec1, LOC100043646, EG665685, Nup210, Hdac11, Fbln2, LOC665716
Downstream gene	Chchd4, Tmem43, Xpc, Lsm3, Slc6a6, Grip2, C130022K22Rik, 4930590J08Rik, Fgd5, Nr2c2, Mrps25, Zfyve20, Trh, LOC665805, Prickle2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Uroc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243537 MGI:2385332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zxdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ccdc37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 6 Proteins

name	Klf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107747 MGI:1340024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc41a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71699 MGI:1918949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Iqsec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins

name	LOC100043646 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins

name	EG665685 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins pseudo : _no_value

name	Nup210 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54563 MGI:1859555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232232 MGI:2385252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 3 Proteins pseudo : _no_value

name	Wnt7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22421 MGI:98961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043659 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 mRNAs, 2548 ESTs, 23 Proteins pseudo : _no_value

name	LOC625420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Chchd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72170 MGI:1919420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74122 MGI:1921372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22591 MGI:103557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67678 MGI:1914928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21366 MGI:98488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243547 MGI:2681173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 3 Proteins

name	C130022K22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232236 MGI:2444652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930590J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381798 MGI:2685917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232237 MGI:2443369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr2c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22026 MGI:1352466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64658 MGI:1928140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfyve20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78287 MGI:1925537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22044 MGI:98823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665805 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Prickle2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243548 MGI:1925144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uroc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450100 GeneID:243537 MGI:2385332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocanase domain containing 1 transcript_id : NM_144940.1

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381340 GeneID:80292 MGI:1933108
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_030260.2

name	Zxdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802546 GeneID:80292 MGI:1933108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ZXD family zinc finger C transcript_id : NM_173002.2

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255366 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 3 Proteins product : coiled-coil domain containing 37, transcript variant 2 transcript_id : XM_001480392.1

name	Ccdc37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255364 GeneID:243538 MGI:2141635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : coiled-coil domain containing 37, transcript variant 1 transcript_id : XM_001480389.1

name	Klf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130317 GeneID:66277 MGI:1929988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 15 transcript_id : NM_023184.3

name	Aldh1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532958 GeneID:107747 MGI:1340024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 1 family, member L1 transcript_id : NM_027406.1

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734230 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_027868.2

name	Slc41a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82734224 GeneID:71699 MGI:1918949
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 41, member 3 transcript_id : NM_001037493.1

name	Iqsec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255368 GeneID:232227 MGI:1196356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 55 ESTs, 5 Proteins product : IQ motif and Sec7 domain 1 transcript_id : XM_001480423.1

name	LOC100043646 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255370 GeneID:100043646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 1087 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480428.1

name	Nup210 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055313 GeneID:54563 MGI:1859555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 210 transcript_id : NM_018815.1

name	Hdac11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130074 GeneID:232232 MGI:2385252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 11 transcript_id : NM_144919.2

name	Fbln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517703 GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibulin 2 transcript_id : NM_007992.2

name	Fbln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517692 GeneID:14115 MGI:95488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibulin 2 transcript_id : NM_001081437.1

name	Wnt7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227223 GeneID:22421 MGI:98961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 7A transcript_id : NM_009527.3

name	LOC625420 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255247 GeneID:625420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : hypothetical LOC625420 transcript_id : XM_001479774.1

name	Chchd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129894 GeneID:72170 MGI:1919420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 4 transcript_id : NM_133928.2

name	Tmem43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801819 GeneID:74122 MGI:1921372
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 43 transcript_id : NM_028766.2

name	Xpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247428 GeneID:22591 MGI:103557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xeroderma pigmentosum, complementation group C transcript_id : NM_009531.2

name	Lsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802858 GeneID:67678 MGI:1914928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_026309.2

name	Slc6a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328477 GeneID:21366 MGI:98488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, taurine), member 6 transcript_id : NM_009320.3

name	Grip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255249 GeneID:243547 MGI:2681173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 3 Proteins product : glutamate receptor interacting protein 2 transcript_id : XM_979116.2

name	C130022K22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370063 GeneID:232236 MGI:2444652
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C130022K22 gene transcript_id : NM_172730.1

name	4930590J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348569 GeneID:381798 MGI:2685917
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930590J08 gene transcript_id : NM_198668.1

name	Fgd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699429 GeneID:232237 MGI:2443369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 5 transcript_id : NM_172731.2

name	Nr2c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892901 GeneID:22026 MGI:1352466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 2, group C, member 2 transcript_id : NM_011630.2

name	Mrps25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130303 GeneID:64658 MGI:1928140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S25 transcript_id : NM_025578.4

name	Zfyve20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541995 GeneID:78287 MGI:1925537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, FYVE domain containing 20 transcript_id : NM_030081.2

name	Trh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031936 GeneID:22044 MGI:98823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyrotropin releasing hormone transcript_id : NM_009426.2

name	Prickle2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487246 GeneID:243548 MGI:1925144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prickle-like 2 (Drosophila) transcript_id : NM_001081146.1

name	Uroc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450101 GeneID:243537 MGI:2385332
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0016153 - urocanate hydratase activity [Evidence IEA] GO_process : GO:0006548 - histidine catabolism [Evidence IEA]; GO:0006547 - histidine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : urocanase domain containing 1 protein_id : NP_659189.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370506 CCDS:CCDS20358.1 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ZXD family zinc finger C isoform 2 protein_id : NP_766590.1

name	Zxdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385100 GeneID:80292 MGI:1933108
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : ZXD family zinc finger C isoform 1 protein_id : NP_084536.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255365 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 1 protein_id : XP_001480439.1

name	Ccdc37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255367 GeneID:243538 MGI:2141635
definition	codon_start : 1 product : coiled-coil domain containing 37 isoform 2 protein_id : XP_001480442.1

name	Klf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963561 CCDS:CCDS20360.1 GeneID:66277 MGI:1929988
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015758 - glucose transport [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Kruppel-like factor 15 protein_id : NP_075673.1

name	Aldh1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532959 CCDS:CCDS20361.1 GeneID:107747 MGI:1340024
definition	EC_number : 1.5.1.6 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0048037 - cofactor binding [Evidence IEA]; GO:0016155 - formyltetrahydrofolate dehydrogenase activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009258 - 10-formyltetrahydrofolate catabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : formyltetrahydrofolate dehydrogenase product : aldehyde dehydrogenase 1 family, member L1 protein_id : NP_081682.1

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734231 CCDS:CCDS20362.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : solute carrier family 41, member 3 isoform 1 protein_id : NP_082144.2

name	Slc41a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82734225 CCDS:CCDS20363.1 GeneID:71699 MGI:1918949
definition	GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006812 - cation transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : solute carrier family 41, member 3 isoform 2 protein_id : NP_001032570.1

name	Iqsec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255369 GeneID:232227 MGI:1196356
definition	codon_start : 1 product : IQ motif and Sec7 domain 1 protein_id : XP_001480473.1

name	LOC100043646 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255371 GeneID:100043646
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480478.1

name	Nup210 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055314 GeneID:54563 MGI:1859555
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005643 - nuclear pore [Evidence ISS] [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear pore membrane glycoprotein 210; nuclear pore membrane protein 210 product : nucleoporin 210 protein_id : NP_061285.1

name	Hdac11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450317 CCDS:CCDS20366.1 GeneID:232232 MGI:2385252
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 11 protein_id : NP_659168.1

name	Fbln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517704 GeneID:14115 MGI:95488
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : fibulin 2 isoform a protein_id : NP_032018.2

name	Fbln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517693 GeneID:14115 MGI:95488
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : fibulin 2 isoform b protein_id : NP_001074906.1

name	Wnt7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543960 GeneID:22421 MGI:98961
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0035115 - embryonic forelimb morphogenesis [Evidence IGI]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IGI]; GO:0030326 - embryonic limb morphogenesis [Evidence IGI]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : postaxial hemimelia product : wingless-related MMTV integration site 7A protein_id : NP_033553.2

name	LOC625420 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255248 GeneID:625420
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479824.1

name	Chchd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527144 CCDS:CCDS20367.1 GeneID:72170 MGI:1919420
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 4 protein_id : NP_598689.1

name	Tmem43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311891 CCDS:CCDS20368.1 GeneID:74122 MGI:1921372
definition	codon_start : 1 product : transmembrane protein 43 protein_id : NP_083042.1

name	Xpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247429 GeneID:22591 MGI:103557
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP]; GO:0031573 - intra-S DNA damage checkpoint [Evidence IGI]; GO:0006289 - nucleotide-excision repair [Evidence IEA] [Evidence IMP] [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : xeroderma pigmentosum, complementation group C protein_id : NP_033557.2

name	Lsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385806 CCDS:CCDS20369.1 GeneID:67678 MGI:1914928
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0030629 - U6 snRNA 3'-end binding [Evidence ISS] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006374 - nuclear mRNA splicing via U2-type spliceosome [Evidence ISS]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM3 homolog, U6 small nuclear RNA associated protein_id : NP_080585.1

name	Slc6a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982828 GeneID:21366 MGI:98488
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001761 - beta-alanine transporter activity [Evidence IDA]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005368 - taurine transporter activity [Evidence IDA] GO_process : GO:0001762 - beta-alanine transport [Evidence IDA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0015734 - taurine transport [Evidence IMP] [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : taurine/beta-alanine transporter product : solute carrier family 6 (neurotransmitter transporter, taurine), member 6 protein_id : NP_033346.2

name	Grip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255250 GeneID:243547 MGI:2681173
definition	codon_start : 1 product : glutamate receptor interacting protein 2 protein_id : XP_984210.2

name	C130022K22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370064 CCDS:CCDS20370.1 GeneID:232236 MGI:2444652
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC232236 protein_id : NP_766318.1

name	4930590J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348570 GeneID:381798 MGI:2685917
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381798 protein_id : NP_941070.1

name	Fgd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699430 CCDS:CCDS20371.1 GeneID:232237 MGI:2443369
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : FYVE, RhoGEF and PH domain containing 5 protein_id : NP_766319.2

name	Nr2c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906168 CCDS:CCDS20372.1 GeneID:22026 MGI:1352466
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048137 - spermatocyte division [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : orphan receptor, TR4; nuclear receptor subfamily 2, group H, member 2 product : nuclear receptor subfamily 2, group C, member 2 protein_id : NP_035760.1

name	Mrps25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981257 CCDS:CCDS20373.1 GeneID:64658 MGI:1928140
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein S25 protein_id : NP_079854.2

name	Zfyve20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541996 CCDS:CCDS20374.1 GeneID:78287 MGI:1925537
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : zinc finger, FYVE domain containing 20 protein_id : NP_084357.2

name	Trh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031937 CCDS:CCDS20375.1 GeneID:22044 MGI:98823
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008437 - thyrotropin-releasing hormone activity [Evidence ISS] GO_process : GO:0009755 - hormone-mediated signaling [Evidence IEA] codon_start : 1 product : thyrotropin releasing hormone protein_id : NP_033452.2

name	Prickle2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487247 GeneID:243548 MGI:1925144
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : prickle-like 2 protein_id : NP_001074615.1

name	LOC665805 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665805
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130675
definition	standard_name : D6Mit131

name	(CDS detail)
type	STS
link
xref	UniSTS:159545
definition	standard_name : AI265605

name	(CDS detail)
type	STS
link
xref	UniSTS:207998
definition	standard_name : BE136473

name	(CDS detail)
type	STS
link
xref	UniSTS:235501
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179418
definition	standard_name : AW048498

name	(CDS detail)
type	STS
link
xref	UniSTS:222798
definition	standard_name : RH140732

name	(CDS detail)
type	STS
link
xref	UniSTS:468007
definition	standard_name : Klf15

name	(CDS detail)
type	STS
link
xref	UniSTS:179415
definition	standard_name : AW494632

name	(CDS detail)
type	STS
link
xref	UniSTS:164331
definition	standard_name : AV048136

name	(CDS detail)
type	STS
link
xref	UniSTS:130674
definition	standard_name : D6Mit130

name	(CDS detail)
type	STS
link
xref	UniSTS:130917
definition	standard_name : D6Mit363

name	(CDS detail)
type	STS
link
xref	UniSTS:207995
definition	standard_name : AU022697

name	(CDS detail)
type	STS
link
xref	UniSTS:180580
definition	standard_name : AU024588

name	(CDS detail)
type	STS
link
xref	UniSTS:165477
definition	standard_name : AI480742

name	(CDS detail)
type	STS
link
xref	UniSTS:167478
definition	standard_name : RH127019

name	(CDS detail)
type	STS
link
xref	UniSTS:235495
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235497
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:207997
definition	standard_name : RH127108

name	(CDS detail)
type	STS
link
xref	UniSTS:130775
definition	standard_name : D6Mit229

name	(CDS detail)
type	STS
link
xref	UniSTS:162834
definition	standard_name : RH126122

name	(CDS detail)
type	STS
link
xref	UniSTS:179419
definition	standard_name : AI836801

name	(CDS detail)
type	STS
link
xref	UniSTS:224278
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235496
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159544
definition	standard_name : X75285

name	(CDS detail)
type	STS
link
xref	UniSTS:165478
definition	standard_name : AI849442

name	(CDS detail)
type	STS
link
xref	UniSTS:207996
definition	standard_name : BB445750

name	(CDS detail)
type	STS
link
xref	UniSTS:246359
definition	standard_name : BE106651

name	(CDS detail)
type	STS
link
xref	UniSTS:144783
definition	standard_name : Wnt7a

name	(CDS detail)
type	STS
link
xref	UniSTS:235498
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235499
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235500
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:132118
definition	standard_name : DXMit227

name	(CDS detail)
type	STS
link
xref	UniSTS:245086
definition	standard_name : AW531182

name	(CDS detail)
type	STS
link
xref	UniSTS:161845
definition	standard_name : RH125023

name	(CDS detail)
type	STS
link
xref	UniSTS:159542
definition	standard_name : AA589629

name	(CDS detail)
type	STS
link
xref	UniSTS:159543
definition	standard_name : C80501

name	(CDS detail)
type	STS
link
xref	UniSTS:219086
definition	standard_name : RH136997

name	(CDS detail)
type	STS
link
xref	UniSTS:161265
definition	standard_name : RH124443

name	(CDS detail)
type	STS
link
xref	UniSTS:125268
definition	standard_name : MHAa67c6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:225068
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130644
definition	standard_name : D6Mit100

name	(CDS detail)
type	STS
link
xref	UniSTS:124199
definition	standard_name : 36.MMHAP88FLD6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:280875
definition	standard_name : NR2C2_2354

name	(CDS detail)
type	STS
link
xref	UniSTS:144665
definition	standard_name : Nr2c2

name	(CDS detail)
type	STS
link
xref	UniSTS:218949
definition	standard_name : RH136860

name	(CDS detail)
type	STS
link
xref	UniSTS:130916
definition	standard_name : D6Mit362.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130915
definition	standard_name : MTH3026

name	(CDS detail)
type	STS
link
xref	UniSTS:235502
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:165479
definition	standard_name : AI324969

name	(CDS detail)
type	STS
link
xref	UniSTS:125812
definition	standard_name : X59387

name	(CDS detail)
type	STS
link
xref	UniSTS:273081
definition	standard_name : PMC317216P3

name	(CDS detail)
type	STS
link
xref	UniSTS:162133
definition	standard_name : RH125311

name	(CDS detail)
type	STS
link
xref	UniSTS:272525
definition	standard_name : PMC304098P6

name	EG665685 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255372 GeneID:665685 MGI:3647847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 112 ESTs, 6 Proteins product : predicted gene, EG665685 pseudo : _no_value transcript_id : XR_001769.2

name	LOC665716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255377 GeneID:665716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 3 Proteins product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_034701.1

name	LOC100043659 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255378 GeneID:100043659
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 mRNAs, 2548 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034702.1

clone name	MSMg01-478A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-190I10.b	B6Ng01-190I10.g
ACC	GA014260	GA014261
length	1,127	563
definition	B6Ng01-190I10.b	B6Ng01-190I10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(91,405,791 - 91,406,906)	(91,280,501 - 91,281,069)
sequence	gaattcctcccccaggagtagctagaacgtctcttgtgactcagacactg cctggtcatctgcttcagtggcagacctgacttacaatgtctaccctagt acatttttgtggatagaagatctttctgtccccccattgcacactggaga agctctgggtaccgagtgtggggaacccatggacagtaccataaggctcc ctgctgagccactatgcattgtggggtcagagctcctgtccctccttggt gactgggaatccctgctgtggttttgttggacaggcccaggtgactgctt gccatccaaagccatcggtggaatgtctgtgggattctttgccaaaaccc caaggcaaaatccaaggtccaaggccattgccagcagcttcccagttccc tttcccataggaacttttttgttgaaacctagctcccaacatgcttccaa aggccatgttctgtctttcctggatcactacagtgaagtatgacagttgt acagttttccaatctggccttggcttgctcgggtaaagctttgttatgta ttttgtaaggcatagattctatattgtaatgtcctatgcaaaagaaaaaa aaattaatgaaattgtaaattttattgctttgacatgtatgcatgtttag tgatgtttacattttgaaagaaaatttatgattcatttaaaaaaattact cagaacagggtcatgctgaccatataccctgttatgttctgtatgagggt tttttaatcttaagaaattccacaaccataagcttcatgtaggatagggt tagggctagacccagggttagggttaggtcaatatgagctgttatgtcag aagtgaccactgggcagcactgatagcacctatgtataagcttattgtgg gttttgtggttttagccctttaataagctggccctgggaaatgtccagtg cacagctttcagctgttgccctggtaaatcagtctttaagtggtgtgttt aattaaaccattcctgttgactgagatcagtgtttcgtggtggtttgttg gggtgactcctgaaccaaacaagcctagacactgaaagatcctgaaccga atgtagaagtcacagagctcttgaagt	ctaggtcgtctgtgttttcatatattcttggctttatgatgatcttagaa gataatcttttgggacggtttttgttcacatatagtatactgctagtgtt tatattcagcatgttgtcagtaatttttctcatttcttgtgttgagttta gtaatgtatctgtaagcattttattttattttgttttgttttatttgtat ccccagaggggattcaaccaagggttaaaattcctctgattctatgaatt tgaaggcagggagaaggaagagggcgaaaggaaataccagttaagtaaga tgcctgcccgcctgtgagataattctgcactctgatccccaggttctcgc tgtggcctggaacaccctcttctgtgtctgctgaccttcatctgcagggt ggagtttagtggctaccaaagcttgtcttcactgggcagaggtgggactg tagagtgctaggcagcaggcatgctgcaagaccctcatttctcccagtaa cagttgtgggggacacctactgcagtgagctgctatcatgcactgttgga ggggggtgggttt
quality values	Open. Hide. 38 10 17 31 62 62 62 34 34 46 62 62 33 24 62 62 47 62 62 62 62 62 62 47 62 62 62 59 62 62 62 59 62 59 38 49 59 56 33 35 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 54 59 54 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 56 46 38 59 59 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 54 62 62 48 62 62 62 62 62 48 41 47 42 62 52 62 62 62 52 54 58 58 58 54 58 58 58 58 58 58 41 54 43 54 58 46 58 58 58 58 58 58 58 42 58 58 58 52 58 58 58 58 58 58 58 58 52 54 54 54 54 58 58 58 58 50 58 58 58 52 52 58 48 46 58 58 54 58 54 58 58 54 58 58 58 54 52 52 52 58 58 52 54 45 54 54 52 54 58 54 58 58 54 54 54 58 49 46 58 50 58 54 50 52 50 51 58 58 58 45 47 58 58 50 58 58 58 50 46 58 46 40 58 54 54 30 43 50 50 42 58 41 46 58 58 58 58 58 25 36 52 52 54 58 54 50 27 58 39 30 50 32 58 58 51 53 39 41 58 54 54 52 46 29 44 37 52 53 46 50 42 58 54 37 58 50 46 53 32 58 58 35 49 41 39 32 41 41 41 49 16 49 50 32 58 58 58 58 52 38 50 41 51 39 52 46 50 27 51 58 18 17 53 41 41 37 41 33 33 37 54 32 38 26 51 37 53 46 41 35 29 40 47 35 28 7 49 31 21 43 28 54 39 28 32 38 24 54 34 27 28 31 31 41 30 40 47 32 37 54 26 26 34 41 38 45 24 9 19 37 12 30 35 33 18 51 40 32 33 31 47 24 47 37 39 37 25 31 32 29 29 39 30 17 53 41 30 31 32 32 33 29 24 32 34 33 49 34 37 23 15 30 14 31 34 30 31 31 35 32 32 24 42 42 33 31 27 31 39 23 31 33 31 22 42 36 31 31 19 18 23 17 42 46 31 23 46 42 33 23 11 26 28 14 40 37 31 31 29 36 46 25 6 40 23 8 13 12 27 33 30 31 16 12 41 25 41 37 11 15 46 29 30 46 15 11 29 7 12 12 20 30 26 28 16 21 31 19 10 31 32 46 17 34 21 20 35 30 14 23 9 23 37 44 28 15 21 31 8 31 44 17 27 31 24 21 21 32 31 41 31 19 30 26 6 19 7 6 8 18 14 12 47 29 33 14 8 6 7 32 33 18 33 22 25 24 15 28 14 8 25 20 10 10 12 25 32 34 14 34 17 10 5 22 5 14 11 14 8 9 9 8 7 15 7 31 19 4 37 8 8 5 3 4 30 34 20 5 8 14 13 17 18 28 7 10 7 12 8 9 22 25 6 7 13 13 22 7 7 9 10 18 10 6 3 5 12 28 24 29 16 10 24 20 12 27 6 9 4 9 8 8 24 15 16 12 11 8 4 4 18 16 9 4 5 1 3 5 7 12 4 9 4 8 11 21 11 16 16 5 12	Open. Hide. 62 54 59 62 59 32 49 27 25 28 28 35 28 48 54 54 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 59 62 62 59 59 62 62 62 51 59 56 32 34 38 48 59 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 59 49 62 56 62 56 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 49 58 58 46 58 58 58 58 58 58 58 58 58 58 54 54 53 49 58 58 58 54 52 58 58 58 58 58 58 58 58 58 45 42 54 54 58 58 54 58 58 58 58 58 42 53 58 58 52 58 58 58 47 58 51 58 58 54 58 58 58 50 58 58 58 58 58 58 51 58 54 49 58 58 58 58 50 58 58 58 49 25 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_91405791_91406906
seq2: B6Ng01-190I10.b_47_1170 (reverse)

seq1  ACTTCAAGGCTTCTGTGACCTTCTACATTCTG-TCAGGATCTTTCAGTGT  49
      ||||||||   ||||||| ||||||||||| | |||||||||||||||||
seq2  ACTTCAAGAGCTCTGTGA-CTTCTACATTCGGTTCAGGATCTTTCAGTGT  49

seq1  CTA-GCTTGTTTTGTTCAGGAGTCACCCC-ACAAACCA-CACG-AACACC  95
      ||| |||||||| |||||||||||||||| |||||||| |||| ||||| 
seq2  CTAGGCTTGTTTGGTTCAGGAGTCACCCCAACAAACCACCACGAAACACT  99

seq1  GATCTCAGTCAACAGGAATGGTTT-ATTAAACACA-CACTTAAAGACTGA  143
      |||||||||||||||||||||||| |||||||||| ||||||||||||||
seq2  GATCTCAGTCAACAGGAATGGTTTAATTAAACACACCACTTAAAGACTGA  149

seq1  TTTACCAGGGCAACAGCTGAAAGCTGTGCACTGGACATTTCCCAGGGCCA  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACCAGGGCAACAGCTGAAAGCTGTGCACTGGACATTTCCCAGGGCCA  199

seq1  GCTTAT--AAGGGCTAAAACCACAAAACCCACAATAAGCTTATACATAGG  241
      ||||||  ||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTATTAAAGGGCTAAAACCACAAAACCCACAATAAGCTTATACATAGG  249

seq1  TGCTATCAGTGCTGCCCAGTGGTCACTTCTGACATAACAGCTCATATTGA  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATCAGTGCTGCCCAGTGGTCACTTCTGACATAACAGCTCATATTGA  299

seq1  CCTAACCCTAACCCTGGGTCTAGCCCTAACCCTATCCTACATGAAGCTTA  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAACCCTAACCCTGGGTCTAGCCCTAACCCTATCCTACATGAAGCTTA  349

seq1  TGGTTGTGGAATTTCTTAAGATTAAAAAACCCTCATACAGAACATAACAG  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTGTGGAATTTCTTAAGATTAAAAAACCCTCATACAGAACATAACAG  399

seq1  GGTATATGGTCAGCATGACCCTGTTCTGAGTAATTTTTTTAAATGAATCA  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATATGGTCAGCATGACCCTGTTCTGAGTAATTTTTTTAAATGAATCA  449

seq1  TAAATTTTCTTTCAAAATGTAAACATCACTAAACATGCATACATGTCAAA  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTTTCTTTCAAAATGTAAACATCACTAAACATGCATACATGTCAAA  499

seq1  GCAATAAAATTTACAATTTCATTAATTTTTTTTTCTTTTGCATAGGACAT  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATAAAATTTACAATTTCATTAATTTTTTTTTCTTTTGCATAGGACAT  549

seq1  TACAATATAGAATCTATGCCTTACAAAATACATAACAAAGCTTTACCCGA  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAATATAGAATCTATGCCTTACAAAATACATAACAAAGCTTTACCCGA  599

seq1  GCAAGCCAAGGCCAGATTGGAAAACTGTACAACTGTCATACTTCACTGTA  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCCAAGGCCAGATTGGAAAACTGTACAACTGTCATACTTCACTGTA  649

seq1  GTGATCCAGGAAAGACAGAACATGGCCTTTGGAAGCATGTTGGGAGCTAG  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATCCAGGAAAGACAGAACATGGCCTTTGGAAGCATGTTGGGAGCTAG  699

seq1  GTTTCAACAAAAAAGTTCCTATGGGAAAGGGAACTGGGAAGCTGCTGGCA  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCAACAAAAAAGTTCCTATGGGAAAGGGAACTGGGAAGCTGCTGGCA  749

seq1  ATGGCCTTGGACCTTGGATTTTGCCTTGGGGTTTTGGCAAAGAATCCCAC  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCTTGGACCTTGGATTTTGCCTTGGGGTTTTGGCAAAGAATCCCAC  799

seq1  AGACATTCCACCGATGGCTTTGGATGGCAAGCAGTCACCTGGGCCTGTCC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATTCCACCGATGGCTTTGGATGGCAAGCAGTCACCTGGGCCTGTCC  849

seq1  AACAAAACCACAGCAGGGATTCCCAGTCACCAAGGAGGGACAGGAGCTCT  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAAACCACAGCAGGGATTCCCAGTCACCAAGGAGGGACAGGAGCTCT  899

seq1  GACCCCACAATGCATAGTGGCTCAGCAGGGAGCCTTATGGTACTGTCCAT  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCCACAATGCATAGTGGCTCAGCAGGGAGCCTTATGGTACTGTCCAT  949

seq1  GGGTTCCCCACACTCGGTACCCAGAGCTTCTCCAGTGTGCAATGGGGGGA  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCCCCACACTCGGTACCCAGAGCTTCTCCAGTGTGCAATGGGGGGA  999

seq1  CAGAAAGATCTTCTATCCACAAAAATGTACTAGGGTAGACATTGTAAGTC  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAGATCTTCTATCCACAAAAATGTACTAGGGTAGACATTGTAAGTC  1049

seq1  AGGTCTGCCACTGAAGCAGATGACCAGGCAGTGTCTGAGTCACAAGAGAC  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCTGCCACTGAAGCAGATGACCAGGCAGTGTCTGAGTCACAAGAGAC  1099

seq1  GTTCTAGCTACTCCTGGGGGAGGAA  1116
      |||||||||||||||||||||||||
seq2  GTTCTAGCTACTCCTGGGGGAGGAA  1124

seq1: chr6_91280501_91281069
seq2: B6Ng01-190I10.g_68_636

seq1  GAATTCCTAGGTCGTCTGTGTTTTCATATATTCTTGGCTTTATGATGATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTAGGTCGTCTGTGTTTTCATATATTCTTGGCTTTATGATGATC  50

seq1  TTAGAAGATAATCTTTTGGGACGGTTTTTGTTCACATATAGTATACTGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAGATAATCTTTTGGGACGGTTTTTGTTCACATATAGTATACTGCT  100

seq1  AGTGTTTATATTCAGCATGTTGTCAGTAATTTTTCTCATTTCTTGTGTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTTTATATTCAGCATGTTGTCAGTAATTTTTCTCATTTCTTGTGTTG  150

seq1  AGTTTAGTAATGTATCTGTAAGCATTTTATTTTATTTTGTTTTGTTTTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTAGTAATGTATCTGTAAGCATTTTATTTTATTTTGTTTTGTTTTAT  200

seq1  TTGTATCCCCAGAGGGGATTCAACCAAGGGTTAAAATTCCTCTGATTCTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATCCCCAGAGGGGATTCAACCAAGGGTTAAAATTCCTCTGATTCTA  250

seq1  TGAATTTGAAGGCAGGGAGAAGGAAGAGGGCGAAAGGAAATACCAGTTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATTTGAAGGCAGGGAGAAGGAAGAGGGCGAAAGGAAATACCAGTTAA  300

seq1  GTAAGATGCCTGCCCGCCTGTGAGATAATTCTGCACTCTGATCCCCAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGATGCCTGCCCGCCTGTGAGATAATTCTGCACTCTGATCCCCAGGT  350

seq1  TCTCGCTGTGGCCTGGAACACCCTCTTCTGTGTCTGCTGACCTTCATCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCGCTGTGGCCTGGAACACCCTCTTCTGTGTCTGCTGACCTTCATCTG  400

seq1  CAGGGTGGAGTTTAGTGGCTACCAAAGCTTGTCTTCACTGGGCAGAGGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTGGAGTTTAGTGGCTACCAAAGCTTGTCTTCACTGGGCAGAGGTG  450

seq1  GGACTGTAGAGTGCTAGGCAGCAGGCATGCTGCAAGACCCTCATTTCTCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGTAGAGTGCTAGGCAGCAGGCATGCTGCAAGACCCTCATTTCTCC  500

seq1  CAGTAACAGTTGTGGGGGACACCTACTGCAGTGAGCTGCTATCATGCACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAACAGTTGTGGGGGACACCTACTGCAGTGAGCTGCTATCATGCACT  550

seq1  GTTGGAGGGGGGTGGGTTT  569
      |||||||||||||||||||
seq2  GTTGGAGGGGGGTGGGTTT  569

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information