MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-204P16
Chromosome	6 (Build37)
Map Location	83,507,042 - 83,667,544
singlet/doublet	doublet
Overlap gene	Stambp, LOC664956, Clec4f, Cd207, Vax2os2, Vax2os1, Vax2
Upstream gene	Tacr1, Pole4, LOC100043412, Hk2, EG622318, Sema4f, D6Mm5e, Dok1, Loxl3, Htra2, Aup1, Dqx1, Tlx2, Pcgf1, Lbx2, A230058J24Rik, Mrpl53, Gcs1, Wbp1, Znhit4, Rtkn, Wdr54, 1700003E16Rik, Dctn1, C330016K18Rik, Mthfd2, Mobk1b, Bola3, D230004J03Rik, Dguok, Actg2
Downstream gene	Atp6v1b1, 1700124L16Rik, Ankrd53, Tex261, LOC665004, Nagk, Paip2b, LOC384450, LOC622683, LOC380687, LOC665098, LOC676366, Zfml, Dysf, LOC665114, 4930504D19Rik, Cyp26b1, Exoc6b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tacr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21336 MGI:98475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pole4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66979 MGI:1914229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 72 ESTs

name	Hk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15277 MGI:1315197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622318 MGI:3646278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Sema4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20355 MGI:1340055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Mm5e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110958 MGI:1315200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13448 MGI:893587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Loxl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16950 MGI:1337004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64704 MGI:1928676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aup1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11993 MGI:107789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dqx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93838 MGI:2136388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21909 MGI:1350935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcgf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69837 MGI:1917087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lbx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16815 MGI:1342288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230058J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243510 MGI:3045292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68499 MGI:1915749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57377 MGI:1929872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22377 MGI:104710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Znhit4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70020 MGI:1917270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtkn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20166 MGI:107371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75659 MGI:1922909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700003E16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 54 ESTs, 3 Proteins

name	Dctn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13191 MGI:107745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330016K18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232156 MGI:2443220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins

name	Mthfd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17768 MGI:1338850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobk1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232157 MGI:2442631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bola3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78653 MGI:1925903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230004J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194388 MGI:2446229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 174 ESTs, 5 Proteins

name	Dguok (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27369 MGI:1351602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11468 MGI:104589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stambp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70527 MGI:1917777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 234 ESTs, 4 Proteins pseudo : _no_value

name	Clec4f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51811 MGI:1859834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246278 MGI:2180021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2os2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545859 MGI:3583303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2os1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574519 MGI:3583301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vax2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24113 MGI:1346018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110935 MGI:103285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700124L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67934 MGI:1915184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ankrd53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75305 MGI:1922555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex261 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21766 MGI:1096575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665004 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Nagk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56174 MGI:1860418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paip2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232164 MGI:2386865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 9 Proteins pseudo : _no_value

name	LOC622683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC380687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380687
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC665098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC676366 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Zfml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18139 MGI:1203484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dysf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins pseudo : _no_value

name	4930504D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cyp26b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 134 ESTs, 10 Proteins

name	Tacr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892945 GeneID:21336 MGI:98475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin receptor 1 transcript_id : NM_009313.4

name	Pole4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350372 GeneID:66979 MGI:1914229
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), epsilon 4 (p12 subunit) transcript_id : NM_025882.2

name	LOC100043412 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255266 GeneID:100043412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 72 ESTs product : hypothetical protein LOC100043412 transcript_id : XM_001479664.1

name	Hk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892208 GeneID:15277 MGI:1315197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase 2 transcript_id : NM_013820.2

name	Sema4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543684 GeneID:20355 MGI:1340055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain transcript_id : NM_011350.2

name	D6Mm5e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14861845 GeneID:110958 MGI:1315200
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 6, Miriam Meisler 5, expressed transcript_id : NM_033079.1

name	Dok1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981795 GeneID:13448 MGI:893587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 1 transcript_id : NM_010070.3

name	Loxl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802822 GeneID:16950 MGI:1337004
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysyl oxidase-like 3 transcript_id : NM_013586.3

name	Htra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980990 GeneID:64704 MGI:1928676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 2 transcript_id : NM_019752.2

name	Aup1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403600 GeneID:11993 MGI:107789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ancient ubiquitous protein transcript_id : NM_007517.3

name	Dqx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130827 GeneID:93838 MGI:2136388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAQ RNA-dependent ATPase transcript_id : NM_033606.3

name	Tlx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70912930 GeneID:21909 MGI:1350935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia, homeobox 2 transcript_id : NM_009392.2

name	Pcgf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574110 GeneID:69837 MGI:1917087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 1 transcript_id : NM_197992.1

name	Lbx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130088 GeneID:16815 MGI:1342288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ladybird homeobox homolog 2 (Drosophila) transcript_id : NM_010692.3

name	A230058J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486906 GeneID:243510 MGI:3045292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A230058J24 gene transcript_id : NM_001081266.1

name	Mrpl53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506706 GeneID:68499 MGI:1915749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L53 transcript_id : NM_026744.3

name	Gcs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981105 GeneID:57377 MGI:1929872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosidase 1 transcript_id : NM_020619.2

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046223 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_001083923.1

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046261 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_001083922.1

name	Wbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046241 GeneID:22377 MGI:104710
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain binding protein 1 transcript_id : NM_016757.2

name	Znhit4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963728 GeneID:70020 MGI:1917270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, HIT type 4 transcript_id : NM_023547.1

name	Rtkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677826 GeneID:20166 MGI:107371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhotekin transcript_id : NM_009106.1

name	Rtkn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281637 GeneID:20166 MGI:107371
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhotekin transcript_id : NM_133641.1

name	Wdr54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963826 GeneID:75659 MGI:1922909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 54 transcript_id : NM_023790.1

name	1700003E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377952 GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 3 Proteins product : RIKEN cDNA 1700003E16 gene, transcript variant 3 transcript_id : XM_897806.2

name	1700003E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377953 GeneID:71837 MGI:1919087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 2 Proteins product : RIKEN cDNA 1700003E16 gene, transcript variant 2 transcript_id : XM_887968.2

name	Dctn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601016 GeneID:13191 MGI:107745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynactin 1 transcript_id : NM_007835.2

name	C330016K18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255274 GeneID:232156 MGI:2443220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : RIKEN cDNA C330016K18 gene, transcript variant 3 transcript_id : XM_888058.3

name	Mthfd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678951 GeneID:17768 MGI:1338850
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase transcript_id : NM_008638.1

name	Mobk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704147 GeneID:232157 MGI:2442631
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 1B (yeast) transcript_id : NM_145571.1

name	Bola3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374066 GeneID:78653 MGI:1925903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bolA-like 3 (E. coli) transcript_id : NM_175277.3

name	D230004J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377951 GeneID:194388 MGI:2446229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 174 ESTs, 5 Proteins product : RIKEN cDNA D230004J03 gene transcript_id : XM_886913.2

name	Dguok (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304998 GeneID:27369 MGI:1351602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyguanosine kinase transcript_id : NM_013764.1

name	Actg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752951 GeneID:11468 MGI:104589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actin, gamma 2, smooth muscle, enteric transcript_id : NM_009610.1

name	Stambp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17941276 GeneID:70527 MGI:1917777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Stam binding protein transcript_id : NM_024239.1

name	Clec4f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376709 GeneID:51811 MGI:1859834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member f transcript_id : NM_016751.3

name	Cd207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560763 GeneID:246278 MGI:2180021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD 207 antigen transcript_id : NM_144943.2

name	Vax2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357991 GeneID:24113 MGI:1346018
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ventral anterior homeobox containing gene 2 transcript_id : NM_011912.2

name	Atp6v1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24371244 GeneID:110935 MGI:103285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit B1 transcript_id : NM_134157.2

name	1700124L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255221 GeneID:67934 MGI:1915184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 1700124L16 gene transcript_id : XM_001479355.1

name	Ankrd53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74315966 GeneID:75305 MGI:1922555
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 53 transcript_id : NM_029245.1

name	Tex261 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678296 GeneID:21766 MGI:1096575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 261 transcript_id : NM_009357.1

name	Nagk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506738 GeneID:56174 MGI:1860418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglucosamine kinase transcript_id : NM_019542.1

name	Paip2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165389 GeneID:232164 MGI:2386865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(A) binding protein interacting protein 2B transcript_id : NM_146169.1

name	LOC676366 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255282 GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC676366 transcript_id : XM_001479937.1

name	Zfml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803255 GeneID:18139 MGI:1203484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin-like transcript_id : NM_008717.2

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026930 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_001077694.1

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174790 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_021469.2

name	4930504D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255285 GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504D19 gene transcript_id : XM_001479954.1

name	Cyp26b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341987 GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 26, subfamily b, polypeptide 1 transcript_id : NM_175475.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377959 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 132 ESTs, 8 Proteins product : exocyst complex component 6B, transcript variant 2 transcript_id : XM_889280.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377957 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 129 ESTs, 2 Proteins product : exocyst complex component 6B, transcript variant 1 transcript_id : XM_355790.4

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377961 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 7 Proteins product : exocyst complex component 6B, transcript variant 9 transcript_id : XM_978347.1

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255289 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 6 Proteins product : exocyst complex component 6B transcript_id : XM_001479977.1

name	Tacr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543840 CCDS:CCDS20262.1 GeneID:21336 MGI:98475
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048265 - response to pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : NK1 receptor; neurokinin receptor 1; substance p receptor product : tachykinin receptor 1 protein_id : NP_033339.2

name	Pole4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385366 GeneID:66979 MGI:1914229
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : DNA polymerase epsilon subunit 4 protein_id : NP_080158.1

name	LOC100043412 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255267 GeneID:100043412
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479714.1

name	Hk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305143 CCDS:CCDS20263.1 GeneID:15277 MGI:1315197
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence IMP]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046835 - carbohydrate phosphorylation [Evidence IMP]; GO:0006006 - glucose metabolism [Evidence IMP]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : hexokinase 2 protein_id : NP_038848.1

name	Sema4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543685 CCDS:CCDS20264.1 GeneID:20355 MGI:1340055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0000299 - integral to membrane of membrane fraction [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence ISS]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030517 - negative regulation of axon extension [Evidence ISS]; GO:0007399 - nervous system development [Evidence IEA]; GO:0031290 - retinal ganglion cell axon guidance [Evidence ISS] codon_start : 1 exception : mismatches in translation note : Sema W product : sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain protein_id : NP_035480.2

name	D6Mm5e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14861846 GeneID:110958 MGI:1315200
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC110958 protein_id : NP_149070.1

name	Dok1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981796 CCDS:CCDS20265.1 GeneID:13448 MGI:893587
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005158 - insulin receptor binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005066 - transmembrane receptor protein tyrosine kinase signaling protein activity [Evidence IPI] GO_process : GO:0000165 - MAPKKK cascade [Evidence TAS]; GO:0007243 - protein kinase cascade [Evidence IPI]; GO:0007265 - Ras protein signal transduction [Evidence IPI]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IPI] codon_start : 1 exception : mismatches in translation note : downstream of tyrosine kinase 1 product : docking protein 1 protein_id : NP_034200.3

name	Loxl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543127 CCDS:CCDS20266.1 GeneID:16950 MGI:1337004
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004720 - protein-lysine 6-oxidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 note : lysyl oxidase-like 2 product : lysyl oxidase-like 3 protein_id : NP_038614.2

name	Htra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980991 CCDS:CCDS20267.1 GeneID:64704 MGI:1928676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005758 - mitochondrial intermembrane space [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007628 - adult walking behavior [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0008629 - induction of apoptosis by intracellular signals [Evidence IMP]; GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0048666 - neuron development [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0040014 - regulation of body size [Evidence IMP] codon_start : 1 exception : mismatches in translation note : serine protease OMI; motor neuron degeneration 2 product : protease, serine, 25 protein_id : NP_062726.2

name	Aup1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90403601 GeneID:11993 MGI:107789
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : ancient ubiquitous protein protein_id : NP_031543.2

name	Dqx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19424112 CCDS:CCDS20268.1 GeneID:93838 MGI:2136388
definition	GO_function : GO:0016887 - ATPase activity [Evidence ISS] codon_start : 1 product : DEAQ RNA-dependent ATPase protein_id : NP_291084.1

name	Tlx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678367 CCDS:CCDS20269.1 GeneID:21909 MGI:1350935
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050774 - negative regulation of dendrite morphogenesis [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : enteric neuron homeobox; homeo box 11-like 1 product : T-cell leukemia, homeobox 2 protein_id : NP_033418.1

name	Pcgf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574111 CCDS:CCDS20270.1 GeneID:69837 MGI:1917087
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : nervous system polycomb 1 product : polycomb group ring finger 1 protein_id : NP_932109.1

name	Lbx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754512 CCDS:CCDS20271.1 GeneID:16815 MGI:1342288
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : lady bird-like homeobox 2 homolog product : ladybird homeobox homolog 2 protein_id : NP_034822.1

name	A230058J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486907 GeneID:243510 MGI:3045292
definition	codon_start : 1 product : hypothetical protein LOC243510 protein_id : NP_001074735.1

name	Mrpl53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313040 CCDS:CCDS20272.1 GeneID:68499 MGI:1915749
definition	codon_start : 1 product : mitochondrial ribosomal protein L53 protein_id : NP_081020.1

name	Gcs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981106 CCDS:CCDS20273.1 GeneID:57377 MGI:1929872
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : glucosidase I product : glucosidase 1 protein_id : NP_065644.2

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046224 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : WW domain binding protein 1 isoform 3 protein_id : NP_001077392.1

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046262 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : WW domain binding protein 1 isoform 2 protein_id : NP_001077391.1

name	Wbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046242 GeneID:22377 MGI:104710
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : WW domain binding protein 1 isoform 1 protein_id : NP_058037.2

name	Znhit4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963729 GeneID:70020 MGI:1917270
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : high mobility group AT-hook 1-like 4 product : PAP-1 binding protein protein_id : NP_076036.1

name	Rtkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677827 CCDS:CCDS20274.1 GeneID:20166 MGI:107371
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence IDA]; GO:0005095 - GTPase inhibitor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045767 - regulation of anti-apoptosis [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation function : binds to p21rho and inhibits its GTPase activity note : isoform 1 is encoded by transcript variant 1 product : rhotekin isoform 1 protein_id : NP_033132.1

name	Rtkn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281638 CCDS:CCDS20274.1 GeneID:20166 MGI:107371
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence IDA]; GO:0005095 - GTPase inhibitor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0045767 - regulation of anti-apoptosis [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3 product : rhotekin isoform 3 protein_id : NP_598396.1

name	Wdr54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963827 CCDS:CCDS20275.1 GeneID:75659 MGI:1922909
definition	codon_start : 1 product : D3Mm3e protein protein_id : NP_076279.1

name	1700003E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029296 GeneID:71837 MGI:1919087
definition	codon_start : 1 product : hypothetical protein LOC71837 isoform 3 protein_id : XP_902899.1

name	1700003E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029294 GeneID:71837 MGI:1919087
definition	codon_start : 1 product : hypothetical protein LOC71837 isoform 2 protein_id : XP_893061.1

name	Dctn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601017 GeneID:13191 MGI:107745
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : dynactin 1, retrograde axonal transport product : dynactin 1 protein_id : NP_031861.2

name	C330016K18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255275 GeneID:232156 MGI:2443220
definition	codon_start : 1 product : similar to electrogenic sodium bicarbonate cotransporter NBC4c isoform 3 protein_id : XP_893151.3

name	Mthfd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678952 CCDS:CCDS20277.1 GeneID:17768 MGI:1338850
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004477 - methenyltetrahydrofolate cyclohydrolase activity [Evidence IEA]; GO:0004487 - methylenetetrahydrofolate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0004488 - methylenetetrahydrofolate dehydrogenase (NADP+) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009396 - folic acid and derivative biosynthesis [Evidence IEA]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 product : methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase protein_id : NP_032664.1

name	Mobk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704148 GeneID:232157 MGI:2442631
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : Mob4B protein protein_id : NP_663546.1

name	Bola3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424938 CCDS:CCDS20278.1 GeneID:78653 MGI:1925903
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : bolA-like 3 protein_id : NP_780486.1

name	D230004J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029316 GeneID:194388 MGI:2446229
definition	codon_start : 1 product : hypothetical protein LOC194388 protein_id : XP_892006.1

name	Dguok (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304999 CCDS:CCDS20279.1 GeneID:27369 MGI:1351602
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004138 - deoxyguanosine kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation function : nucleoside metabolism product : deoxyguanosine kinase protein_id : NP_038792.1

name	Actg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752952 GeneID:11468 MGI:104589
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : actin, gamma 2, smooth muscle, enteric protein_id : NP_033740.1

name	Stambp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17941277 CCDS:CCDS20280.1 GeneID:70527 MGI:1917777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : associated molecule with the SH3 domain of STAM product : Stam binding protein protein_id : NP_077201.1

name	Clec4f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560464 CCDS:CCDS20281.1 GeneID:51811 MGI:1859834
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 note : kupffer cell receptor; Kupffer cell c-type lectin receptor; C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily member 13 product : C-type lectin, superfamily member 13 protein_id : NP_058031.2

name	Cd207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560764 GeneID:246278 MGI:2180021
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IDA] codon_start : 1 function : induction of Birbeck granules note : Langerhans cell specific c-type lectin product : CD207 antigen, langerin protein_id : NP_659192.2

name	Vax2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755957 CCDS:CCDS20282.1 GeneID:24113 MGI:1346018
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0031490 - chromatin DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ventral anterior homeobox containing gene 2 protein_id : NP_036042.1

name	Atp6v1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527064 CCDS:CCDS20283.1 GeneID:110935 MGI:103285
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IMP] [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0015988 - energy coupled proton transport, against electrochemical gradient [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence ISS] [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta 56/58 kDa, isoform 1; lysosomal 56/58kDa; ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 product : ATPase, H+ transporting, V1 subunit B, isoform 1 protein_id : NP_598918.1

name	1700124L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255222 GeneID:67934 MGI:1915184
definition	codon_start : 1 product : hypothetical protein LOC67934 protein_id : XP_001479405.1

name	Ankrd53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315967 CCDS:CCDS20284.1 GeneID:75305 MGI:1922555
definition	codon_start : 1 exception : mismatches in translation product : ankyrin repeat domain 53 protein_id : NP_083521.1

name	Tex261 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678297 CCDS:CCDS20285.1 GeneID:21766 MGI:1096575
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : testis expressed gene 261 protein_id : NP_033383.1

name	Nagk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506739 CCDS:CCDS20286.1 GeneID:56174 MGI:1860418
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0045127 - N-acetylglucosamine kinase activity [Evidence IDA]; GO:0009384 - N-acylmannosamine kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006044 - N-acetylglucosamine metabolism [Evidence IDA] codon_start : 1 function : amino sugar metabolism note : GlcNAc kinase product : N-acetylglucosamine kinase protein_id : NP_062415.1

name	Paip2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40807347 CCDS:CCDS20287.1 GeneID:232164 MGI:2386865
definition	codon_start : 1 product : poly(A) binding protein interacting protein 2B protein_id : NP_666281.2

name	LOC676366 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255283 GeneID:676366
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479987.1

name	Zfml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679098 CCDS:CCDS20288.1 GeneID:18139 MGI:1203484
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear protein 220 product : zinc finger protein 638 protein_id : NP_032743.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026931 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : dysferlin isoform 2 protein_id : NP_001071162.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174791 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : dysferlin isoform 1 protein_id : NP_067444.2

name	4930504D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255286 GeneID:78017 MGI:1925267
definition	codon_start : 1 product : hypothetical protein LOC78017 protein_id : XP_001480004.1

name	Cyp26b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202045 CCDS:CCDS20289.1 GeneID:232174 MGI:2176159
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0009954 - proximal/distal pattern formation [Evidence IMP]; GO:0042573 - retinoic acid metabolism [Evidence IC]; GO:0048384 - retinoic acid receptor signaling pathway [Evidence IDA] codon_start : 1 note : cytochrome P450 26B1; retinoic acid hydroxylase; cytochrome P450, 26, retinoic acid B1 product : cytochrome P450, family 26, subfamily b, polypeptide 1 protein_id : NP_780684.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255288 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 2 protein_id : XP_894373.3

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255287 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 1 protein_id : XP_355790.4

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255290 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 protein_id : XP_001480027.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377962 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 9 protein_id : XP_983441.1

name	EG622318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622318
definition	number : 2 pseudo : _no_value

name	EG622318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622318
definition	number : 1 pseudo : _no_value

name	LOC665004 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665004
definition	number : 1 pseudo : _no_value

name	LOC622683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622683
definition	number : 2 pseudo : _no_value

name	LOC622683 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622683
definition	number : 1 pseudo : _no_value

name	LOC665098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665098
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:130670
definition	standard_name : D6Mit129

name	(CDS detail)
type	STS
link
xref	UniSTS:130671
definition	standard_name : D6Mit129.1

name	(CDS detail)
type	STS
link
xref	UniSTS:179399
definition	standard_name : AI642394

name	(CDS detail)
type	STS
link
xref	UniSTS:235473
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130709
definition	standard_name : D6Mit164

name	(CDS detail)
type	STS
link
xref	UniSTS:260414
definition	standard_name : D6UmiJ20

name	(CDS detail)
type	STS
link
xref	UniSTS:130830
definition	standard_name : D6Mit283

name	(CDS detail)
type	STS
link
xref	UniSTS:142637
definition	standard_name : D6Umi10

name	(CDS detail)
type	STS
link
xref	UniSTS:163393
definition	standard_name : AB022316

name	(CDS detail)
type	STS
link
xref	UniSTS:260416
definition	standard_name : D6UmiJ23

name	(CDS detail)
type	STS
link
xref	UniSTS:144393
definition	standard_name : Sema4f

name	(CDS detail)
type	STS
link
xref	UniSTS:260409
definition	standard_name : D6UmiJ16

name	(CDS detail)
type	STS
link
xref	UniSTS:130730
definition	standard_name : D6Mit189

name	(CDS detail)
type	STS
link
xref	UniSTS:123225
definition	standard_name : 14.MMHAP63FRE8.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:260411
definition	standard_name : D6UmiJ18

name	(CDS detail)
type	STS
link
xref	UniSTS:142638
definition	standard_name : D6Umi1a

name	(CDS detail)
type	STS
link
xref	UniSTS:260412
definition	standard_name : D6UmiJ19

name	(CDS detail)
type	STS
link
xref	UniSTS:185673
definition	standard_name : AW557123

name	(CDS detail)
type	STS
link
xref	UniSTS:231082
definition	standard_name : MARC_4349-4350:991938479:1

name	(CDS detail)
type	STS
link
xref	UniSTS:260419
definition	standard_name : D6UmiJ26

name	(CDS detail)
type	STS
link
xref	UniSTS:161004
definition	standard_name : RH124140

name	(CDS detail)
type	STS
link
xref	UniSTS:179401
definition	standard_name : AI481710

name	(CDS detail)
type	STS
link
xref	UniSTS:161788
definition	standard_name : RH124966

name	(CDS detail)
type	STS
link
xref	UniSTS:142639
definition	standard_name : D6Umi2

name	(CDS detail)
type	STS
link
xref	UniSTS:260417
definition	standard_name : D6UmiJ24

name	(CDS detail)
type	STS
link
xref	UniSTS:492892
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130972
definition	standard_name : D6Mit70

name	(CDS detail)
type	STS
link
xref	UniSTS:164327
definition	standard_name : AU024121

name	(CDS detail)
type	STS
link
xref	UniSTS:260421
definition	standard_name : D6UmiJ4

name	(CDS detail)
type	STS
link
xref	UniSTS:260422
definition	standard_name : D6UmiJ5

name	(CDS detail)
type	STS
link
xref	UniSTS:209909
definition	standard_name : RH135911

name	(CDS detail)
type	STS
link
xref	UniSTS:210015
definition	standard_name : RH136019

name	(CDS detail)
type	STS
link
xref	UniSTS:260420
definition	standard_name : D6UmiJ27

name	(CDS detail)
type	STS
link
xref	UniSTS:260423
definition	standard_name : D6UmiJ9

name	(CDS detail)
type	STS
link
xref	UniSTS:260406
definition	standard_name : D6UmiJ11

name	(CDS detail)
type	STS
link
xref	UniSTS:144363
definition	standard_name : Rtkn

name	(CDS detail)
type	STS
link
xref	UniSTS:163392
definition	standard_name : U54638

name	(CDS detail)
type	STS
link
xref	UniSTS:164328
definition	standard_name : AU041756

name	(CDS detail)
type	STS
link
xref	UniSTS:142640
definition	standard_name : D6Umi3

name	(CDS detail)
type	STS
link
xref	UniSTS:162241
definition	standard_name : RH125419

name	(CDS detail)
type	STS
link
xref	UniSTS:142641
definition	standard_name : D6Umi4

name	(CDS detail)
type	STS
link
xref	UniSTS:124588
definition	standard_name : 45.MMHAP68FLG6.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130755
definition	standard_name : D6Mit211

name	(CDS detail)
type	STS
link
xref	UniSTS:130756
definition	standard_name : D6Mit211.2

name	(CDS detail)
type	STS
link
xref	UniSTS:130913
definition	standard_name : D6Mit360.1

name	(CDS detail)
type	STS
link
xref	UniSTS:130912
definition	standard_name : D6Mit360

name	(CDS detail)
type	STS
link
xref	UniSTS:270671
definition	standard_name : PMC133862P1

name	(CDS detail)
type	STS
link
xref	UniSTS:159524
definition	standard_name : M63445

name	(CDS detail)
type	STS
link
xref	UniSTS:179403
definition	standard_name : AW558851

name	(CDS detail)
type	STS
link
xref	UniSTS:260407
definition	standard_name : D6UmiJ14

name	(CDS detail)
type	STS
link
xref	UniSTS:235474
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:260408
definition	standard_name : D6UmiJ15

name	(CDS detail)
type	STS
link
xref	UniSTS:260413
definition	standard_name : D6UmiJ2

name	(CDS detail)
type	STS
link
xref	UniSTS:130669
definition	standard_name : D6Mit128

name	(CDS detail)
type	STS
link
xref	UniSTS:142583
definition	standard_name : D6Mit1006

name	(CDS detail)
type	STS
link
xref	UniSTS:163394
definition	standard_name : AJ133750

name	(CDS detail)
type	STS
link
xref	UniSTS:271939
definition	standard_name : PMC20377P1

name	(CDS detail)
type	STS
link
xref	UniSTS:260405
definition	standard_name : D6UmiJ1

name	(CDS detail)
type	STS
link
xref	UniSTS:179406
definition	standard_name : AW107289

name	(CDS detail)
type	STS
link
xref	UniSTS:220745
definition	standard_name : RH138658

name	(CDS detail)
type	STS
link
xref	UniSTS:161209
definition	standard_name : RH124387

name	(CDS detail)
type	STS
link
xref	UniSTS:270053
definition	standard_name : PMC100023P1

name	(CDS detail)
type	STS
link
xref	UniSTS:186272
definition	standard_name : M-08868

name	(CDS detail)
type	STS
link
xref	UniSTS:130796
definition	standard_name : D6Mit247

name	(CDS detail)
type	STS
link
xref	UniSTS:179400
definition	standard_name : D18063

name	(CDS detail)
type	STS
link
xref	UniSTS:130971
definition	standard_name : D6Mit69

name	(CDS detail)
type	STS
link
xref	UniSTS:130983
definition	standard_name : D6Mit8.2

name	(CDS detail)
type	STS
link
xref	UniSTS:116325
definition	standard_name : D6Mit8

name	(CDS detail)
type	STS
link
xref	UniSTS:130982
definition	standard_name : D6Mit8.1

name	(CDS detail)
type	STS
link
xref	UniSTS:207983
definition	standard_name : AW742418

name	(CDS detail)
type	STS
link
xref	UniSTS:179405
definition	standard_name : Y17792

name	(CDS detail)
type	STS
link
xref	UniSTS:179404
definition	standard_name : AW208839

name	(CDS detail)
type	STS
link
xref	UniSTS:161668
definition	standard_name : RH124846

name	(CDS detail)
type	STS
link
xref	UniSTS:161057
definition	standard_name : RH124235

name	(CDS detail)
type	STS
link
xref	UniSTS:224529
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:159525
definition	standard_name : AI480706

name	(CDS detail)
type	STS
link
xref	UniSTS:234959
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179402
definition	standard_name : AI323587

name	(CDS detail)
type	STS
link
xref	UniSTS:479305
definition	standard_name : Zfml

name	(CDS detail)
type	STS
link
xref	UniSTS:22169
definition	standard_name : RH45151

name	(CDS detail)
type	STS
link
xref	UniSTS:235475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164329
definition	standard_name : AI604795

name	(CDS detail)
type	STS
link
xref	UniSTS:145902
definition	standard_name : AU049455

name	(CDS detail)
type	STS
link
xref	UniSTS:130876
definition	standard_name : D6Mit322

name	(CDS detail)
type	STS
link
xref	UniSTS:130753
definition	standard_name : D6Mit21

name	(CDS detail)
type	STS
link
xref	UniSTS:246808
definition	standard_name : BF398420

name	(CDS detail)
type	STS
link
xref	UniSTS:256999
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:464663
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:115447
definition	standard_name : D4Got92

name	(CDS detail)
type	STS
link
xref	UniSTS:235476
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235478
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161259
definition	standard_name : RH124437

name	(CDS detail)
type	STS
link
xref	UniSTS:207984
definition	standard_name : BB456356

name	LOC664956 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255280 GeneID:664956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 234 ESTs, 4 Proteins product : similar to ribosomal protein L5 pseudo : _no_value transcript_id : XR_034418.1

name	Vax2os2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872164 GeneID:545859 MGI:3583303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vax2 opposite strand transcript 2 transcript_id : NR_002871.1

name	Vax2os1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872168 GeneID:574519 MGI:3583301
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vax2 opposite strand transcript 1 transcript_id : NR_002873.1

name	LOC384450 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255281 GeneID:384450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 9 Proteins product : similar to ribosomal protein L18 pseudo : _no_value transcript_id : XR_034442.1

name	LOC665114 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255284 GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_034464.1

clone name	MSMg01-270B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-213O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344C20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-165O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-270C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368M17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-072D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121C04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-138C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-212H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-204P16.b	B6Ng01-204P16.g
ACC	GA024780	GA024781
length	795	935
definition	B6Ng01-204P16.b	B6Ng01-204P16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(83,666,755 - 83,667,544)	(83,507,042 - 83,507,961)
sequence	gaattcatttcactgtatttacactaaatcagaccaagtgcaggtccttc ccaccctacataattagcttactcaatggtcaaaggacacagagctgttg gaactgcaaatgcccaagacagttaaaaaatttcaccgatgactttcaaa atagcctgaggaaagtgcgtggaagggcaaggaggaggcttctggctttc ttccccctccggttctgccttcctgtgaagtgtgtattcggaaatgaaag cctgctaggccatgaagctgagtacggcctgcccaagctggaccttgagg acaggatcctccctgcagctccagagtcggtgaggccaagcctccaggga aagagggagcaactctttttctaagacatcgcatcttatgggtgcatggg tggggtgcatgcagacttagctagtggtttcagctaggtcgttcttagat ttttgttgttgttgttgttttgatttttgttttacttttgtttttggtag acttggaggctgaccttgaagctgaggtaatcttcctgtctctacctcct atagcctgctggcattaccaacccagccactactctggtcagccagtttt ggttatttttgctggtcgagcctcgtagaagcgtccgctgtggctctgca cttcctaagaccttgcaatagactcctatgctttcacagcgctccctccc caactctctgtctctgtctcccgccccccccccctccatccccctcttgc acaggcacacagatgcacaggaaaaaaaaatttaaggtttgtcca	gaattcactatgcagctgacctcaaatctgtggaaagtcttctgtctcag attctcagggggtgggattacaggcatgaggtatcattcctgacctgtat gtattacagttgtatactcatgcatgtgtaggtcagagaaaaactgtgtg tgttgttcttcacattcaattaatgtgtttttgtgatgagacctcttatt ggcccaagacttgtcaggtaggctgcctgtctggctttgtaaacttcagg gatctgccttccattgcccctgggatcatgccatgcactctctgtggagg gattggtatagagtcagactccagatacccagtcatgggaaaggccacag aggaagcagccccagttcagggaagttacacccgcttaccagttttccac agaggactccacaggtttcaatgcctttggcggtattggcactggcaagc tggagaaattctgagcacagattacggggcaccacgatgtggcgcaggcc ttcaatggtgggaactgaaatgggcaagagggaagagttggagtccgcag ggccagggatccctgagcagcagctggagctgacagactgagactgtctc cagcgacggctgcagctggaggactgagcctggcagagctgagtcccagg gtttccgggctccgtagggatcagccatccctctcctgcctatttctccc tttggaatagtgttatctttactctgcctctctgccagaagtgtggatta cttgagtgccacacacttcacagctgggagaaggatgaatgcctcgttct agagcagatcttagataggagctctgcatttgtgttttaagatcctgatt ccttcaagaagagaagatttttaccattcaaggtaagataagggctcacc ttactattcttccaaaagttgttttttgaagagtg
quality values	Open. Hide. 48 20 17 19 54 38 22 45 54 58 19 26 45 58 58 42 52 54 62 47 52 42 35 62 54 62 62 62 62 47 39 56 62 18 23 10 13 13 20 32 21 24 36 49 32 50 56 56 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 59 62 54 62 62 62 62 56 50 59 48 34 48 50 59 54 50 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 51 59 56 54 35 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 54 54 51 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 47 44 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 35 37 62 56 62 62 62 62 62 56 62 56 62 62 62 62 62 56 62 62 47 47 56 56 43 56 62 62 49 29 47 47 62 62 39 62 62 62 62 56 56 62 56 52 62 54 47 47 62 62 54 62 14 11 16 6 9 12 52 62 52 62 52 62 62 62 52 38 62 54 45 62 54 62 62 52 52 38 42 50 52 47 50 52 53 42 46 47 41 40 42 42 46 50 42 35 34 44 39 41 41 52 54 54 54 32 36 54 50 45 58 58 58 58 58 52 54 58 58 52 58 37 54 46 52 54 52 52 33 54 54 26 58 58 27 45 45 52 58 58 52 46 54 58 54 58 54 33 41 37 47 45 38 41 31 34 35 26 58 41 52 38 37 54 30 58 58 58 54 35 35 50 40 50 40 42 30 49 37 49 52 51 50 50 50 58 58 51 46 40 50 40 39 48 48 47 58 48 49 49 50 19 16 21 18 14 20 40 58 48 51 30 49 47 26 37 40 42 43 33 31 30 38 20 50 37 39 26 27 27 26 25 22 21 28 6 9 9 9 9 10 16 31 7 15 13 16 14 46 25 20 28 31 11 11 14 11 9 31 9 15 24 25 24 11 9 42 17 40 39 19 24 31 13 19 17 21 18 19 19 19 18 18 22 14 19 9 9 10 6 46 8 32 13 13 19 10 9 9	Open. Hide. 62 47 46 47 62 42 42 54 54 62 62 27 14 9 8 19 19 21 20 21 21 28 22 22 28 50 59 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 43 30 56 28 32 34 34 48 34 34 33 44 40 59 62 59 54 49 56 59 62 59 54 59 62 59 62 62 62 56 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 51 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 56 62 59 62 59 59 62 62 62 62 62 62 54 62 62 56 56 56 37 38 56 56 36 50 51 56 62 62 62 56 62 62 56 56 54 62 62 62 62 62 62 56 62 62 56 56 62 56 62 62 62 62 62 50 62 62 47 47 62 62 62 62 62 56 56 51 62 56 43 62 62 54 62 62 62 62 62 62 62 47 47 62 56 62 47 47 62 62 62 49 32 40 47 56 47 31 62 56 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 56 56 62 52 40 52 62 62 62 62 62 62 62 47 47 31 52 43 62 54 33 62 38 35 62 62 62 62 46 52 47 50 43 52 52 35 62 52 50 62 52 48 52 46 28 46 52 58 54 58 54 45 35 54 52 37 54 54 47 54 54 42 58 45 26 52 58 52 54 30 52 52 54 46 52 52 54 30 42 36 52 58 52 54 52 42 41 35 50 52 41 42 39 44 58 42 49 54 52 31 50 52 54 46 54 54 24 58 28 16 50 52 54 27 44 43 39 54 53 41 53 28 58 12 46 54 50 58 8 34 20 37 27 25 16 47 29 7 49 12 19 43 38 47 34 35 50 37 43 33 37 41 19 38 47 53 30 48 43 19 23 29 30 53 50 54 47 50 42 53 34 25 26 49 30 42 25 50 40 58 38 36 50 28 58 32 38 52 39 49 33 42 53 42 53 28 40 51 14 50 46 37 46 26 58 7 26 40 46 51 25 28 39 38 50 50 40 32 33 39 18 40 27 27 53 53 26 41 40 39 50 25 39 32 50 32 32 19 9 21 41 23 50 20 6 26 29 53 30 46 20 39 32 13 32 16 53 36 25 39 34 19 31 15 40 18 39 32 28 46 18 7 16 51 40 32 45 40 49 30 35 33 14 9 18 31 37 30 54 29 31 38 13 52 31 35 13 15 20 30 29 22 20 10 8 32 28 29 15 22 18 22 29 12 28 16 24 46 10 28 34 51 53 32 20 19 20 41 32 33 20 9 28 18 7 15 35 33 21 30 26 7 23 25 32 34 18 47 21 32 32 13 11 6 37 47 32 20 32 18 41 17 51 19 26 22 14 10 29 6 16 25 26 33 9 6 6 27 51 31 12 12 20 21 23 31 8 24 28 28 18 31 23 23 32 33 34 38 31 32 21 21 12 8 8 7 9 20 32 18 45 25 22 28 19 13 13 20 9 12 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_83666755_83667544
seq2: B6Ng01-204P16.b_45_839 (reverse)

seq1  TGGAC-AACCTTAA--TTTTTTTTCCTGTGCATCTGTGTGCCTGTGCAAG  47
      ||||| ||||||||  ||||||||||||||||||||||||||||||||||
seq2  TGGACAAACCTTAAATTTTTTTTTCCTGTGCATCTGTGTGCCTGTGCAAG  50

seq1  A-GGGGATGGA-GGGGGGGGGGCGGGAGACAGAGACAGAGAGTTGGGGAG  95
      | ||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGATGGAGGGGGGGGGGGCGGGAGACAGAGACAGAGAGTTGGGGAG  100

seq1  GGAGCGCTGTGAAAGCATAGGAGTCTATTGCAAGGTCTTAGGAAGTGCAG  145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCGCTGTGAAAGCATAGGAGTCTATTGCAAGGTCTTAGGAAGTGCAG  150

seq1  AGCCACAGCGGACGCTTCTACGAGGCTCGACCAGCAAAAATAACCAAAAC  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCACAGCGGACGCTTCTACGAGGCTCGACCAGCAAAAATAACCAAAAC  200

seq1  TGGCTGACCAGAGTAGTGGCTGGGTTGGTAATGCCAGCAGGCTATAGGAG  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTGACCAGAGTAGTGGCTGGGTTGGTAATGCCAGCAGGCTATAGGAG  250

seq1  GTAGAGACAGGAAGATTACCTCAGCTTCAAGGTCAGCCTCCAAGTCTACC  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAGACAGGAAGATTACCTCAGCTTCAAGGTCAGCCTCCAAGTCTACC  300

seq1  AAAAACAAAAGTAAAACAAAAATCAAAACAACAACAACAACAAAAATCTA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACAAAAGTAAAACAAAAATCAAAACAACAACAACAACAAAAATCTA  350

seq1  AGAACGACCTAGCTGAAACCACTAGCTAAGTCTGCATGCACCCCACCCAT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACGACCTAGCTGAAACCACTAGCTAAGTCTGCATGCACCCCACCCAT  400

seq1  GCACCCATAAGATGCGATGTCTTAGAAAAAGAGTTGCTCCCTCTTTCCCT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCCATAAGATGCGATGTCTTAGAAAAAGAGTTGCTCCCTCTTTCCCT  450

seq1  GGAGGCTTGGCCTCACCGACTCTGGAGCTGCAGGGAGGATCCTGTCCTCA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGCTTGGCCTCACCGACTCTGGAGCTGCAGGGAGGATCCTGTCCTCA  500

seq1  AGGTCCAGCTTGGGCAGGCCGTACTCAGCTTCATGGCCTAGCAGGCTTTC  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCCAGCTTGGGCAGGCCGTACTCAGCTTCATGGCCTAGCAGGCTTTC  550

seq1  ATTTCCGAATACACACTTCACAGGAAGGCAGAACCGGAGGGGGAAGAAAG  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCGAATACACACTTCACAGGAAGGCAGAACCGGAGGGGGAAGAAAG  600

seq1  CCAGAAGCCTCCTCCTTGCCCTTCCACGCACTTTCCTCAGGCTATTTTGA  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAAGCCTCCTCCTTGCCCTTCCACGCACTTTCCTCAGGCTATTTTGA  650

seq1  AAGTCATCGGTGAAATTTTTTAACTGTCTTGGGCATTTGCAGTTCCAACA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCATCGGTGAAATTTTTTAACTGTCTTGGGCATTTGCAGTTCCAACA  700

seq1  GCTCTGTGTCCTTTGACCATTGAGTAAGCTAATTATGTAGGGTGGGAAGG  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGTGTCCTTTGACCATTGAGTAAGCTAATTATGTAGGGTGGGAAGG  750

seq1  ACCTGCACTTGGTCTGATTTAGTGTAAATACAGTGAAATGAATTC  790
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGCACTTGGTCTGATTTAGTGTAAATACAGTGAAATGAATTC  795

seq1: chr6_83507042_83507961
seq2: B6Ng01-204P16.g_66_1000

seq1  GAATTCACTATGCAGCTGACCTCAAATCTGTGGAAAGTCTTCTGTCTCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTATGCAGCTGACCTCAAATCTGTGGAAAGTCTTCTGTCTCAG  50

seq1  ATTCTCAGGGGGTGGGATTACAGGCATGAGGTATCATTCCTGACCTGTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTCAGGGGGTGGGATTACAGGCATGAGGTATCATTCCTGACCTGTAT  100

seq1  GTATTACAGTTGTATACTCATGCATGTGTAGGTCAGAGAAAAACTGTGTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATTACAGTTGTATACTCATGCATGTGTAGGTCAGAGAAAAACTGTGTG  150

seq1  TGTTGTTCTTCACATTCAATTAATGTGTTTTTGTGATGAGACCTCTTATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGTTCTTCACATTCAATTAATGTGTTTTTGTGATGAGACCTCTTATT  200

seq1  GGCCCAAGACTTGTCAGGTAGGCTGCCTGTCTGGCTTTGTAAACTTCAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCAAGACTTGTCAGGTAGGCTGCCTGTCTGGCTTTGTAAACTTCAGG  250

seq1  GATCTGCCTTCCATTGCCCCTGGGATCATGCCATGCACTCTCTGTGGAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGCCTTCCATTGCCCCTGGGATCATGCCATGCACTCTCTGTGGAGG  300

seq1  GATTGGTATAGAGTCAGACTCCAGATACCCAGTCATGGGAAAGGCCACAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGTATAGAGTCAGACTCCAGATACCCAGTCATGGGAAAGGCCACAG  350

seq1  AGGAAGCAGCCCCAGTTCAGGGAAGTTACACCCGCTTACCAGTTTTCCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGCAGCCCCAGTTCAGGGAAGTTACACCCGCTTACCAGTTTTCCAC  400

seq1  AGAGGACTCCACAGGTTTCAATGCCTTTGGCGGTATTGGCACTGGCAAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGACTCCACAGGTTTCAATGCCTTTGGCGGTATTGGCACTGGCAAGC  450

seq1  TGGAGAAATTCTGAGCACAGATTACGGGGCACCACGATGTGGCGCAGGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGAAATTCTGAGCACAGATTACGGGGCACCACGATGTGGCGCAGGCC  500

seq1  TTCAATGGTGGGAACTGAAATGGGCAAGAGGGAAGAGTTGGAGTCCGCAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAATGGTGGGAACTGAAATGGGCAAGAGGGAAGAGTTGGAGTCCGCAG  550

seq1  GGCCAGGGATCCCTGAGCAGCAGCTGGAGCTGACAGACTGAGACTGTCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGGGATCCCTGAGCAGCAGCTGGAGCTGACAGACTGAGACTGTCTC  600

seq1  CAGCGACGGCTGCAGCTGGAGGACTGAGCCTGGCAGAGCTGAGTCCCAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGACGGCTGCAGCTGGAGGACTGAGCCTGGCAGAGCTGAGTCCCAGG  650

seq1  G-TTCCGGGCTCCGTAGGGATCAGCCATCCCTCTCCTGCCTATTTCTCCC  699
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCCGGGCTCCGTAGGGATCAGCCATCCCTCTCCTGCCTATTTCTCCC  700

seq1  TTTGGAATAGTGTTATC-TTACTCTGCCTCTCTGCCAGAAGTGTGGATTA  748
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TTTGGAATAGTGTTATCTTTACTCTGCCTCTCTGCCAGAAGTGTGGATTA  750

seq1  C-TGAGTG-CACACAC-TCACAGCT-GGAGAAGGATGAATGCCTCG-TCT  793
      | |||||| ||||||| |||||||| |||||||||||||||||||| |||
seq2  CTTGAGTGCCACACACTTCACAGCTGGGAGAAGGATGAATGCCTCGTTCT  800

seq1  AGAGCAGATC-TAGATA-GAGCTCTGCATTTGTGTTTTAAGATCCTGA-T  840
      |||||||||| |||||| |||||||||||||||||||||||||||||| |
seq2  AGAGCAGATCTTAGATAGGAGCTCTGCATTTGTGTTTTAAGATCCTGATT  850

seq1  CCTTCAAGAAGAGAAGATTTTAACCATTCAAGGTAAGAT-AGGGCTCACC  889
      ||||||||||||||||||||| ||||||||||||||||| ||||||||||
seq2  CCTTCAAGAAGAGAAGATTTTTACCATTCAAGGTAAGATAAGGGCTCACC  900

seq1  -TACTA-TCTTCCAAAAGT--GTTTTTGAAGAGTG  920
       ||||| ||||||||||||   |||||||||||||
seq2  TTACTATTCTTCCAAAAGTTGTTTTTTGAAGAGTG  935

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information