MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-213F08
Chromosome	6 (Build37)
Map Location	84,808,312 - 84,921,264
singlet/doublet	doublet
Overlap gene	Exoc6b
Upstream gene	LOC380687, LOC665098, LOC676366, Zfml, Dysf, LOC665114, 4930504D19Rik, Cyp26b1, LOC665129
Downstream gene	Npm3-ps1, EG545861, EG623016, Spr, LOC665086, LOC665089, Emx1, Sfxn5, Rab11fip5, Noto, Smyd5, 1700040I03Rik, Cct7, Fbxo41, Egr4, Alms1, LOC100043497, EG665134, LOC100043493, Cml3, LOC623273, Cml5, Cml4, LOC100043504, LOC100043508, Cml2, LOC665177, 1700019G17Rik, Cml1, Tprkb, EG434057, LOC665213, Dusp11
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC380687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380687
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC665098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC676366 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Zfml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18139 MGI:1203484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dysf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins pseudo : _no_value

name	4930504D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cyp26b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 134 ESTs, 10 Proteins

name	LOC665129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 65 ESTs, 22 Proteins pseudo : _no_value

name	Npm3-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108176 MGI:894683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	EG545861 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545861 MGI:3647625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623016 MGI:3643297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Spr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20751 MGI:103078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Emx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfxn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94282 MGI:2137681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11fip5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52055 MGI:1098586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Noto (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384452 MGI:3053002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smyd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232187 MGI:108048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700040I03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12468 MGI:107184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alms1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236266 MGI:1934606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 11 ESTs, 16 Proteins

name	EG665134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein

name	LOC100043493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein

name	Cml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93674 MGI:2136449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC623273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	Cml5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69049 MGI:1916299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68396 MGI:1915646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100043508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins

name	Cml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700019G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75541 MGI:1922791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66116 MGI:1913366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tprkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69786 MGI:1917036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins

name	LOC665213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Dusp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72102 MGI:1919352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676366 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255282 GeneID:676366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC676366 transcript_id : XM_001479937.1

name	Zfml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803255 GeneID:18139 MGI:1203484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin-like transcript_id : NM_008717.2

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026930 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_001077694.1

name	Dysf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174790 GeneID:26903 MGI:1349385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dysferlin transcript_id : NM_021469.2

name	4930504D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255285 GeneID:78017 MGI:1925267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930504D19 gene transcript_id : XM_001479954.1

name	Cyp26b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341987 GeneID:232174 MGI:2176159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 26, subfamily b, polypeptide 1 transcript_id : NM_175475.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377959 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 132 ESTs, 8 Proteins product : exocyst complex component 6B, transcript variant 2 transcript_id : XM_889280.2

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377957 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 129 ESTs, 2 Proteins product : exocyst complex component 6B, transcript variant 1 transcript_id : XM_355790.4

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377961 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 7 Proteins product : exocyst complex component 6B, transcript variant 9 transcript_id : XM_978347.1

name	Exoc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255289 GeneID:75914 MGI:1923164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 124 ESTs, 6 Proteins product : exocyst complex component 6B transcript_id : XM_001479977.1

name	EG545861 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778970 GeneID:545861 MGI:3647625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545861 transcript_id : NM_001034902.2

name	Spr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755625 GeneID:20751 MGI:103078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sepiapterin reductase transcript_id : NM_011467.1

name	Emx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832022 GeneID:13796 MGI:95387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : empty spiracles homolog 1 (Drosophila) transcript_id : NM_010131.1

name	Sfxn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802372 GeneID:94282 MGI:2137681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sideroflexin 5 transcript_id : NM_178639.3

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743142 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_177466.4

name	Rab11fip5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55743141 GeneID:52055 MGI:1098586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 5 (class I) transcript_id : NM_001003955.2

name	Noto (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372169 GeneID:384452 MGI:3053002
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : notochord homolog (Xenopus laevis) transcript_id : NM_001007472.1

name	Smyd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450314 GeneID:232187 MGI:108048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET and MYND domain containing 5 transcript_id : NM_144918.1

name	1700040I03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606406 GeneID:73327 MGI:1920577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700040I03 gene transcript_id : NM_028505.1

name	Cct7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802764 GeneID:12468 MGI:107184
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 7 (eta) transcript_id : NM_007638.3

name	Fbxo41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625733 GeneID:330369 MGI:1261912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 41 transcript_id : NM_001001160.2

name	Egr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130510 GeneID:13656 MGI:99252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 4 transcript_id : NM_020596.2

name	Alms1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644592 GeneID:236266 MGI:1934606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Alstrom syndrome 1 homolog (human) transcript_id : NM_145223.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255302 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 2 transcript_id : XM_001480038.1

name	LOC100043497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255300 GeneID:100043497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 16 Proteins product : similar to camello-like 3, transcript variant 1 transcript_id : XM_001480031.1

name	EG665134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255224 GeneID:665134 MGI:3646394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : predicted gene, EG665134 transcript_id : XM_974788.2

name	LOC100043493 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255296 GeneID:100043493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : similar to mKIAA0328 protein transcript_id : XM_001480026.1

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365388 GeneID:93674 MGI:2136449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_001037842.2

name	Cml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716390 GeneID:93674 MGI:2136449
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 3 transcript_id : NM_053097.1

name	LOC623273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255225 GeneID:623273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : similar to Almstrom syndrome 1 protein transcript_id : XM_887722.3

name	Cml5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956197 GeneID:69049 MGI:1916299
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 5 transcript_id : NM_023493.1

name	Cml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980866 GeneID:68396 MGI:1915646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 4 transcript_id : NM_023455.2

name	LOC100043504 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255308 GeneID:100043504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100043504 transcript_id : XM_001480063.1

name	LOC100043508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255312 GeneID:100043508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 235 ESTs, 5 Proteins product : similar to Sid3177p transcript_id : XM_001480069.1

name	Cml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865962 GeneID:93673 MGI:2136446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 2 transcript_id : NM_053096.3

name	1700019G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254166 GeneID:75541 MGI:1922791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700019G17 gene transcript_id : NM_029331.2

name	Cml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963542 GeneID:66116 MGI:1913366
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : camello-like 1 transcript_id : NM_023160.1

name	Tprkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341154 GeneID:69786 MGI:1917036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tp53rk binding protein transcript_id : NM_176842.2

name	EG434057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94377979 GeneID:434057 MGI:3644831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 17 Proteins product : predicted gene, EG434057 transcript_id : XM_485799.3

name	Dusp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519172 GeneID:72102 MGI:1919352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) transcript_id : NM_028099.2

name	LOC676366 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255283 GeneID:676366
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479987.1

name	Zfml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679098 CCDS:CCDS20288.1 GeneID:18139 MGI:1203484
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear protein 220 product : zinc finger protein 638 protein_id : NP_032743.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026931 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : dysferlin isoform 2 protein_id : NP_001071162.1

name	Dysf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174791 GeneID:26903 MGI:1349385
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001778 - plasma membrane repair [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : dysferlin isoform 1 protein_id : NP_067444.2

name	4930504D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255286 GeneID:78017 MGI:1925267
definition	codon_start : 1 product : hypothetical protein LOC78017 protein_id : XP_001480004.1

name	Cyp26b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202045 CCDS:CCDS20289.1 GeneID:232174 MGI:2176159
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0009954 - proximal/distal pattern formation [Evidence IMP]; GO:0042573 - retinoic acid metabolism [Evidence IC]; GO:0048384 - retinoic acid receptor signaling pathway [Evidence IDA] codon_start : 1 note : cytochrome P450 26B1; retinoic acid hydroxylase; cytochrome P450, 26, retinoic acid B1 product : cytochrome P450, family 26, subfamily b, polypeptide 1 protein_id : NP_780684.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255288 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 2 protein_id : XP_894373.3

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255287 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 1 protein_id : XP_355790.4

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255290 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 protein_id : XP_001480027.1

name	Exoc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377962 GeneID:75914 MGI:1923164
definition	codon_start : 1 product : SEC15-like 2 isoform 9 protein_id : XP_983441.1

name	EG545861 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778971 GeneID:545861 MGI:3647625
definition	codon_start : 1 product : hypothetical protein LOC545861 protein_id : NP_001030074.2

name	Spr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755626 GeneID:20751 MGI:103078
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004757 - sepiapterin reductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006729 - tetrahydrobiopterin biosynthesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : tetrahydrobiopterin biosynthesis product : sepiapterin reductase protein_id : NP_035597.1

name	Emx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832023 CCDS:CCDS20290.1 GeneID:13796 MGI:95387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : empty spiracles homolog 1 protein_id : NP_034261.1

name	Sfxn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519995 CCDS:CCDS20291.1 GeneID:94282 MGI:2137681
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0008324 - cation transporter activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sideroflexin 5 protein_id : NP_848754.1

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55743143 CCDS:CCDS20292.1 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : RAB11 family interacting protein 5 (class I) isoform 2 protein_id : NP_803417.3

name	Rab11fip5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421788 GeneID:52055 MGI:1098586
definition	GO_component : GO:0005741 - mitochondrial outer membrane [Evidence ISS] GO_function : GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : RAB11 family interacting protein 5 (class I) isoform 1 protein_id : NP_001003955.1

name	Noto (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372170 CCDS:CCDS20293.1 GeneID:384452 MGI:3053002
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030903 - notochord development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Not homeodomain protein; floating head homolog product : notochord protein_id : NP_001007473.1

name	Smyd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450315 GeneID:232187 MGI:108048
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : retinoic acid responsive gene 1; retinoic acid induced 15 product : SET and MYND domain containing 5 protein_id : NP_659167.1

name	1700040I03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606407 GeneID:73327 MGI:1920577
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73327 protein_id : NP_082781.1

name	Cct7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982472 CCDS:CCDS20295.1 GeneID:12468 MGI:107184
definition	GO_component : GO:0005832 - chaperonin-containing T-complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chaperonin containing t-complex subunit eta product : chaperonin subunit 7 (eta) protein_id : NP_031664.2

name	Fbxo41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564092 CCDS:CCDS20296.1 GeneID:330369 MGI:1261912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 41 protein_id : NP_001001160.1

name	Egr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181102 CCDS:CCDS20297.1 GeneID:13656 MGI:99252
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : early growth response 4 protein_id : NP_065621.1

name	Alms1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644593 CCDS:CCDS20298.1 GeneID:236266 MGI:1934606
definition	GO_component : GO:0005813 - centrosome [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001678 - cell glucose homeostasis [Evidence ISS]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0045598 - regulation of fat cell differentiation [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : mismatches in translation product : Alstrom syndrome 1 protein_id : NP_660258.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255301 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480081.1

name	LOC100043497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255303 GeneID:100043497
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480088.1

name	EG665134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94377971 GeneID:665134 MGI:3646394
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_979882.1

name	LOC100043493 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255297 GeneID:100043493
definition	codon_start : 1 product : similar to mKIAA0328 protein protein_id : XP_001480076.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745106 CCDS:CCDS20299.1 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : camello-like 3 isoform 1 protein_id : NP_001032931.1

name	Cml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716391 GeneID:93674 MGI:2136449
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2 product : camello-like 3 isoform 2 protein_id : NP_444327.1

name	LOC623273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255226 GeneID:623273
definition	codon_start : 1 product : similar to Almstrom syndrome 1 protein protein_id : XP_892815.2

name	Cml5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956198 CCDS:CCDS20300.1 GeneID:69049 MGI:1916299
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation product : camello-like 5 protein_id : NP_075982.1

name	Cml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963681 CCDS:CCDS20301.1 GeneID:68396 MGI:1915646
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005715 - late recombination nodule [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 4 protein_id : NP_075944.1

name	LOC100043504 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255309 GeneID:100043504
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480113.1

name	LOC100043508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255313 GeneID:100043508
definition	codon_start : 1 product : similar to Sid3177p protein_id : XP_001480119.1

name	Cml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542409 CCDS:CCDS20302.1 GeneID:93673 MGI:2136446
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : camello-like 2 protein_id : NP_444326.2

name	1700019G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254167 GeneID:75541 MGI:1922791
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75541 protein_id : NP_083607.2

name	Cml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963543 CCDS:CCDS20304.1 GeneID:66116 MGI:1913366
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007162 - negative regulation of cell adhesion [Evidence ISS] codon_start : 1 product : putative N-acetyltransferase Camello 1 protein_id : NP_075649.1

name	Tprkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849893 CCDS:CCDS20305.1 GeneID:69786 MGI:1917036
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Prpk (p53-related protein kinase)-binding protein protein_id : NP_789812.1

name	EG434057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83029409 GeneID:434057 MGI:3644831
definition	codon_start : 1 product : similar to Camello-like 1 protein_id : XP_485799.3

name	Dusp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519173 CCDS:CCDS20306.1 GeneID:72102 MGI:1919352
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) protein_id : NP_082375.2

name	LOC665098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665098
definition	number : 1 pseudo : _no_value

name	LOC665086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665086
definition	number : 2 pseudo : _no_value

name	LOC665086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665086
definition	number : 1 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 1 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 2 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 3 pseudo : _no_value

name	LOC665089 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665089
definition	number : 4 pseudo : _no_value

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 1 pseudo : _no_value

name	LOC665177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665177
definition	number : 2 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 1 pseudo : _no_value

name	LOC665213 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665213
definition	number : 2 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:179402
definition	standard_name : AI323587

name	(CDS detail)
type	STS
link
xref	UniSTS:479305
definition	standard_name : Zfml

name	(CDS detail)
type	STS
link
xref	UniSTS:22169
definition	standard_name : RH45151

name	(CDS detail)
type	STS
link
xref	UniSTS:235475
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:164329
definition	standard_name : AI604795

name	(CDS detail)
type	STS
link
xref	UniSTS:145902
definition	standard_name : AU049455

name	(CDS detail)
type	STS
link
xref	UniSTS:130876
definition	standard_name : D6Mit322

name	(CDS detail)
type	STS
link
xref	UniSTS:130753
definition	standard_name : D6Mit21

name	(CDS detail)
type	STS
link
xref	UniSTS:246808
definition	standard_name : BF398420

name	(CDS detail)
type	STS
link
xref	UniSTS:256999
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:464663
definition	standard_name : Cyp26b1

name	(CDS detail)
type	STS
link
xref	UniSTS:115447
definition	standard_name : D4Got92

name	(CDS detail)
type	STS
link
xref	UniSTS:235476
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235478
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161259
definition	standard_name : RH124437

name	(CDS detail)
type	STS
link
xref	UniSTS:207984
definition	standard_name : BB456356

name	(CDS detail)
type	STS
link
xref	UniSTS:207985
definition	standard_name : AI182275

name	(CDS detail)
type	STS
link
xref	UniSTS:235477
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:130765
definition	standard_name : D6Mit22

name	(CDS detail)
type	STS
link
xref	UniSTS:161704
definition	standard_name : RH124882

name	(CDS detail)
type	STS
link
xref	UniSTS:144504
definition	standard_name : Spr

name	(CDS detail)
type	STS
link
xref	UniSTS:226151
definition	standard_name : Emx1

name	(CDS detail)
type	STS
link
xref	UniSTS:222856
definition	standard_name : RH140790

name	(CDS detail)
type	STS
link
xref	UniSTS:130944
definition	standard_name : D6Mit391

name	(CDS detail)
type	STS
link
xref	UniSTS:130961
definition	standard_name : D6Mit6

name	(CDS detail)
type	STS
link
xref	UniSTS:118840
definition	standard_name : D4Rat47

name	(CDS detail)
type	STS
link
xref	UniSTS:16102
definition	standard_name : RH70059

name	(CDS detail)
type	STS
link
xref	UniSTS:162737
definition	standard_name : RH126025

name	(CDS detail)
type	STS
link
xref	UniSTS:159526
definition	standard_name : C75969

name	(CDS detail)
type	STS
link
xref	UniSTS:167495
definition	standard_name : AU022460

name	(CDS detail)
type	STS
link
xref	UniSTS:179407
definition	standard_name : AW536703

name	(CDS detail)
type	STS
link
xref	UniSTS:207986
definition	standard_name : RH127111

name	(CDS detail)
type	STS
link
xref	UniSTS:235479
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:162345
definition	standard_name : RH125529

name	(CDS detail)
type	STS
link
xref	UniSTS:235482
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161545
definition	standard_name : RH124723

name	(CDS detail)
type	STS
link
xref	UniSTS:119814
definition	standard_name : RH94566

name	(CDS detail)
type	STS
link
xref	UniSTS:235483
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:211133
definition	standard_name : RH127823

name	(CDS detail)
type	STS
link
xref	UniSTS:207987
definition	standard_name : AI173933

name	(CDS detail)
type	STS
link
xref	UniSTS:159527
definition	standard_name : AI266962

name	(CDS detail)
type	STS
link
xref	UniSTS:217253
definition	standard_name : RH133971

name	(CDS detail)
type	STS
link
xref	UniSTS:159528
definition	standard_name : AI481497

name	(CDS detail)
type	STS
link
xref	UniSTS:235481
definition

name	LOC665114 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255284 GeneID:665114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 24 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_034464.1

name	LOC665129 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255291 GeneID:665129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 65 ESTs, 22 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034475.1

name	Npm3-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84794553 GeneID:108176 MGI:894683
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoplasmin 3, pseudogene 1 pseudo : _no_value transcript_id : NR_002702.1

name	EG623016 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149255223 GeneID:623016 MGI:3643297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG623016 pseudo : _no_value transcript_id : XR_034185.1

clone name	MSMg01-316L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121C04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-138C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-212H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-442K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150A02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-063D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-478M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-096O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-139P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098O05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063D02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318N07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-268B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-169P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-207D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088D10
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-225M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-213F08.b	B6Ng01-213F08.g
ACC	GA030890	GA030891
length	954	1,153
definition	B6Ng01-213F08.b	B6Ng01-213F08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(84,920,419 - 84,921,264)	(84,808,312 - 84,809,476)
sequence	gaattctttgtagaattacattttttgctaacatattctatactgcctac tagtctttcatggggtcttttaataaataaattcattggactccaatttt actttcaggttctgtgtctcctgaaacttaagagtgtcaacagcagtgaa aagtttgacatacttagtctctgtacatacttggcaatagaagtgagttt tttagtggagccaagacagtattcttacgttaccttgtattgttacgttc ctgcccacagaagttactaccccatcctctcccttacccaaagggtttgc atagttggccatctcttgggtgaagtctcctttgtcagtgatttttcttg acttttaggaactagtcaaattattccaggaaaaaaaaacgtgtggattt tttttttttttttgcttgcctccagcatcttaaggattctaagtgggaga aaagatgaagaatttatttcatcattcatgtaacctattgttttggatcc tcactttcagaattgcactccttgcctcagttataccagacagcctgcat ctatctatctatctatctatctatctatctatctatctatctatctatct atctatgaatctatctgtccatccatccatccatccatccatccatccat ctatcttccttctctgaagccttttgcagtggtaaaagaggagcagttgc ttggctgggagcagttggcagggttctagggcttcctcagcagaccatca gcttagctcttccaggctcctgtttctatctctcagagttcttactgctc ccagtggaatgctggttcagttgcctcttgactttctctgttacttgctt tttctttttctttttttttcttttttagttttttaaaaatatttttatta ggtattttccctcatttacatttccaatgctatcccaaaaagtcccccat accc	gaattcagtgcaacaccagacagtatgcagatagtcagctgtaagtaagc acttggggcatcccacataccgagtgggtacgcaatgctgcgatggtctt tgaaagggccatttcccacagttcatcaatgtaggctctattcactaagc cctgggttgtatgcaaaatgtgatcttcaaccacaaaaaagctgagattg aaaagaaaagaaaacagagatgtcagagatcacagttgctatcatgacca ctaagctttgacattaacagctagcatctaactcaaatggaatgttactt tttctgtgaggaaagctattcattatcataaatgaaattacttcagagat tgaaaacatgtctcaaatcatattaataccttcataggtacattaccaag actgaagtttcacttttaatgtcaaccacataatccaacaattgaaaaga aattatataaagctaatagagtatattttaaacatattttaaaatacaat acatctcaagaaactaacaaatctgacacatataataaacactaaaatta tagattttaaaaaatttaatcaaaacaagattccctttattaaggaattt ttaaattatcaaaaaaaaaatcaaacacaacaagatctcatgtcttatga agctcaggctggccataaactgcctatgtagcctaaggtaatcttaaact attgatcctctagttccctcattcccggcgctgggattatatgtgtacta ccatacctggttttatgcagtgatgaatatcaaacccatgcatgctaggt gagcattctagcagtagctaaatccttcaacactcagtgatatgcataat agaggttattctttacatcaaagcaatattaatctgaagaagaaagcaag ggaggagaagagcggggaatctagagaggaagtgaaggaagaagaaaagg agtggatgtgtgcaggcaaggtgtattgaacaaccaaatctattgccatt tttttaaccatagtgtcatcatatagtggaacagctgctgtaatgaagca gcttgtattgaggtctctatagttaccttacctcacactctactatgtct actcctaagtgagacacggcatgcattgctgttgattagtctgcagcacc tgt
quality values	Open. Hide. 58 36 34 29 62 62 62 62 62 54 62 47 62 62 54 42 54 62 54 42 62 62 62 62 62 62 59 59 59 59 32 30 24 27 25 31 30 31 28 32 32 28 32 32 62 59 62 59 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 51 56 48 38 43 43 62 54 42 54 49 49 54 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 56 59 59 56 46 56 59 59 51 56 56 56 59 59 56 59 59 59 51 59 59 47 56 56 56 59 59 51 50 49 49 50 56 31 38 45 56 56 38 59 43 50 62 56 45 62 62 59 59 59 56 62 62 62 47 56 56 56 56 56 56 56 56 56 62 50 50 56 56 62 62 62 56 56 62 38 56 56 56 62 56 62 56 56 56 50 56 56 56 62 62 56 56 56 51 62 62 62 56 56 56 51 47 56 56 56 56 56 62 56 56 56 56 56 43 56 56 56 56 56 62 47 38 27 35 47 41 47 41 62 52 62 48 52 52 52 62 62 62 62 54 62 62 62 54 62 52 62 49 54 52 54 48 62 62 62 48 62 54 62 52 54 52 52 48 54 52 54 54 58 48 58 58 58 46 58 54 58 54 58 46 54 54 54 54 54 58 54 47 54 54 58 54 52 52 52 47 47 52 52 52 54 46 54 45 35 54 52 45 35 52 52 45 47 48 52 45 42 58 54 42 31 58 54 54 37 54 52 45 39 51 58 43 47 52 46 48 50 58 53 53 48 47 49 48 49 50 50 50 51 58 54 51 26 46 51 47 49 51 51 50 42 25 13 9 20 11 13 50 51 58 58 31 50 23 39 49 23 40 50 28 53 52 50 34 50 50 49 50 27 50 48 38 35 41 18 43 49 40 52 51 50 58 32 50 13 43 43 30 33 39 42 38 30 51 51 29 32 33 24 50 41 50 41 28 33 40 21 53 18 28 19 38 40 45 37 32 39 32 39 16 40 53 39 33 49 22 37 32 30 29 27 49 37 39 23 54 21 54 35 38 40 29 52 43 53 43 39 34 52 22 54 11 35 31 37 40 40 32 34 26 52 24 52 32 54 53 29 27 12 37 38 32 35 28 45 18 39 30 36 6 7 26 14 32 27 36 41 31 51 28 35 31 29 33 33 31 31 47 31 34 23 52 19 25 14 26 29 24 28 29 34 14 32 53 52 47 23 53 32 51 46 51 42 38 29 46 51 51 51 46 46 46 28 22 10 51 51 46 46 23 31 28 33 51 51 41 46 6 8 46 51 46 40 21 24 20 48 47 46 42 32 27 24 10 9 11 8 8 6 46 46 46 18 42 21 32 32 17 17 23 17 13 19 28 26 46 25 27 20 21 31 26 39 12 14 18 11 13 31 24 15 33 46 39 22 30 35 33 48 37 37 30 10 10 26 26 37 22	Open. Hide. 62 59 59 59 62 59 59 59 45 43 39 23 18 31 24 30 27 20 25 29 28 28 40 38 62 59 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 51 59 59 56 32 54 59 54 54 54 54 43 59 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 44 58 58 58 54 58 58 58 58 54 58 58 54 58 58 58 58 54 58 58 58 58 46 58 58 54 48 58 58 58 58 58 58 54 54 45 42 41 58 54 58 54 41 41 58 58 58 45 50 58 58 58 58 53 51 58 52 58 58 58 58 58 58 58 58 47 54 58 51 58 58 58 50 58 50 58 58 49 53 54 51 42 51 51 51 52 58 58 50 51 58 43 50 52 51 58 58 50 52 58 42 50 42 58 46 49 51 58 33 47 50 51 47 58 53 54 51 58 29 58 49 52 53 53 52 50 50 53 58 41 51 37 29 58 31 51 51 52 53 51 50 54 58 46 50 47 50 37 40 58 53 52 49 58 50 50 50 50 50 51 52 40 58 54 50 52 39 49 47 31 54 42 37 54 45 53 53 42 37 54 27 41 25 26 37 42 45 41 53 39 51 35 31 35 35 40 52 52 28 35 39 51 54 40 33 49 19 54 54 29 40 39 53 40 42 37 29 49 31 31 42 34 33 28 37 33 37 23 46 47 27 44 42 24 19 32 34 31 31 52 31 45 39 29 49 26 38 51 29 40 40 53 53 53 35 41 24 45 39 29 32 52 24 31 32 41 52 31 32 30 46 33 32 39 18 31 25 15 27 31 31 28 31 21 45 36 35 31 30 30 24 18 30 29 36 30 31 35 31 20 33 9 33 26 27 16 26 32 51 33 24 29 19 38 30 13 40 25 21 31 27 27 29 23 22 6 18 46 21 27 36 26 31 22 10 22 33 15 29 41 26 28 31 16 18 20 31 20 29 16 16 29 17 25 25 6 32 17 34 33 41 46 32 25 27 21 31 30 23 21 32 16 30 22 28 11 25 13 27 21 22 20 13 14 19 24 16 25 30 11 35 38 27 17 20 16 17 33 14 17 24 7 6 18 31 31 11 27 32 24 18 32 15 20 9 30 19 18 28 16 12 13 26 7 5 29 16 8 28 19 25 10 31 15 17 5 7 16 23 26 34 13 16 15 32 48 48 43 43 43 21 7 15 11 12 8 14 13 19 30 13 4 8 24 18 27 13 21 11 5 8 12 8 8 11 13 21 20 28 16 28 24 27 11 11 3 3 6 7 19 11 18 14 13 24 16 9 21 21 9 14 6 7 5 6 7 12 3 4 5 6 6 4 16 5 18 24 11 7 6 29 10 22 5 5 21 5 7 3 2 1 3 5 5 6 5 5 6 7 4 4 4 6 7 22 16 13 18 5 6 12 6 15 9 13 8 6 4 1 4 7 7 5 7 6 13 7 17 23 11 5 8 8 8 2 1 2 3 3 3 2 3 6 5 4 7 5 7 16 5 9 9 6 11 7 15 4 8 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_84920419_84921264
seq2: B6Ng01-213F08.b_44_893 (reverse)

seq1  AAGCAAGTAACAGAGAAAGTCAAGAGGCAACTGGACCAGCATTCCACTGG  50
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  AAGCAAGTAACAGAGAAAGTCAAGAGGCAACTGAACCAGCATTCCACTGG  50

seq1  GAGCAGTAAGAACTCTGAGAGATAGAAACAGGAGCCTGGAAGAGCTAAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAGTAAGAACTCTGAGAGATAGAAACAGGAGCCTGGAAGAGCTAAGC  100

seq1  TGATGGTCTGCTGAGGAAGCCCTAGAACCCTGCCAACTGCTCCCAGCCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGGTCTGCTGAGGAAGCCCTAGAACCCTGCCAACTGCTCCCAGCCAA  150

seq1  GCAACTGCTCCTCTTTTACCACTGCAAAAGGCTTCAGAGAAGGAAGATAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACTGCTCCTCTTTTACCACTGCAAAAGGCTTCAGAGAAGGAAGATAG  200

seq1  ATGGATGGATGGATGGATGGATGGATGGATGGACAGATAGATTC----AT  246
      ||||||||||||||||||||||||||||||||||||||||||||    ||
seq2  ATGGATGGATGGATGGATGGATGGATGGATGGACAGATAGATTCATAGAT  250

seq1  AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAG  300

seq1  ATGCAGGCTGTCTGGTATAACTGAGGCAAGGAGTGCAATTCTGAAAGTGA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAGGCTGTCTGGTATAACTGAGGCAAGGAGTGCAATTCTGAAAGTGA  350

seq1  GGATCCAAAACAATAGGTTACATGAATGATGAAATAAATTCTTCATCTTT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCCAAAACAATAGGTTACATGAATGATGAAATAAATTCTTCATCTTT  400

seq1  TCTCCCACTTAGAATCCTTAAGATGCTGGAGGCAAGCAAAAAAAAAAAAA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCACTTAGAATCCTTAAGATGCTGGAGGCAAGCAAAAAAAAAAAAA  450

seq1  AAATCCACACGTTTTTTTTTCCTGGAATAATTTGACTAGTTCCTAAAAGT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCACACGTTTTTTTTTCCTGGAATAATTTGACTAGTTCCTAAAAGT  500

seq1  CAAGAAAAATCACTGACAAAGGAGACTTCACCCAAGAGATGGCCAACTAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAAAAATCACTGACAAAGGAGACTTCACCCAAGAGATGGCCAACTAT  550

seq1  GCAAACCCTTTGGGTAAGGGAGAGGATGGGGTAGTAACTTCTGTGGGCAG  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACCCTTTGGGTAAGGGAGAGGATGGGGTAGTAACTTCTGTGGGCAG  600

seq1  GAACGTAACAATACAAGGTAACGTAAGAATACTGTCTTGGCTCCACTAAA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACGTAACAATACAAGGTAACGTAAGAATACTGTCTTGGCTCCACTAAA  650

seq1  AAACTCACTTCTATTGCCAAGTATGTACAGAGACTAAGTATGTCAAACTT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCACTTCTATTGCCAAGTATGTACAGAGACTAAGTATGTCAAACTT  700

seq1  TTCACTGCTGTTGACACTCTTAAGTTTCAGGAGACACAGAACCTGAAAGT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACTGCTGTTGACACTCTTAAGTTTCAGGAGACACAGAACCTGAAAGT  750

seq1  AAAATTGGAGTCCAATGAATTTATTTATTAAAAGACCCCATGAAAGACTA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTGGAGTCCAATGAATTTATTTATTAAAAGACCCCATGAAAGACTA  800

seq1  GTAGGCAGTATAGAATATGTTAGCAAAAAATGTAATTCTACAAAGAATTC  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGCAGTATAGAATATGTTAGCAAAAAATGTAATTCTACAAAGAATTC  850

seq1: chr6_84808312_84809476
seq2: B6Ng01-213F08.g_66_1218

seq1  GAATTCAGTGCAACACCAGACAGTATGCAGATAGTCAGCTGTAAGTAAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTGCAACACCAGACAGTATGCAGATAGTCAGCTGTAAGTAAGC  50

seq1  ACTTGGGGCATCCCACATACCGAGTGGGTACGCAATGCTGCGATGGTCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGGGCATCCCACATACCGAGTGGGTACGCAATGCTGCGATGGTCTT  100

seq1  TGAAAGGGCCATTTCCCACAGTTCATCAATGTAGGCTCTATTCACTAAGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGGGCCATTTCCCACAGTTCATCAATGTAGGCTCTATTCACTAAGC  150

seq1  CCTGGGTTGTATGCAAAATGTGATCTTCAACCACAAAAAAGCTGAGATTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGGTTGTATGCAAAATGTGATCTTCAACCACAAAAAAGCTGAGATTG  200

seq1  AAAAGAAAAGAAAACAGAGATGTCAGAGATCACAGTTGCTATCATGACCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAAAGAAAACAGAGATGTCAGAGATCACAGTTGCTATCATGACCA  250

seq1  CTAAGCTTTGACATTAACAGCTAGCATCTAACTCAAATGGAATGTTACTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGCTTTGACATTAACAGCTAGCATCTAACTCAAATGGAATGTTACTT  300

seq1  TTTCTGTGAGGAAAGCTATTCATTATCATAAATGAAATTACTTCAGAGAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGTGAGGAAAGCTATTCATTATCATAAATGAAATTACTTCAGAGAT  350

seq1  TGAAAACATGTCTCAAATCATATTAATACCTTCATAGGTACATTACCAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAACATGTCTCAAATCATATTAATACCTTCATAGGTACATTACCAAG  400

seq1  ACTGAAGTTTCACTTTTAATGTCAACCACATAATCCAACAATTGAAAAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAAGTTTCACTTTTAATGTCAACCACATAATCCAACAATTGAAAAGA  450

seq1  AATTATATAAAGCTAATAGAGTATATTTTAAACATATTTTAAAATACAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTATATAAAGCTAATAGAGTATATTTTAAACATATTTTAAAATACAAT  500

seq1  ACATCTCAAGAAACTAACAAATCTGACACATATAATAAACACTAAAATTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTCAAGAAACTAACAAATCTGACACATATAATAAACACTAAAATTA  550

seq1  TAGATTTTAAAAAATTTAATCAAAACAAGATTCCCTTTATTAAGGAATTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATTTTAAAAAATTTAATCAAAACAAGATTCCCTTTATTAAGGAATTT  600

seq1  TTAAATTATCAAAAAAAAAATCAAACACAACAAGATCTCATGTCTTATGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATTATCAAAAAAAAAATCAAACACAACAAGATCTCATGTCTTATGA  650

seq1  AGCTCAGGCTGGCCATAAACTGCCTATGTAGCCTAAGGTAATCTTAAACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCAGGCTGGCCATAAACTGCCTATGTAGCCTAAGGTAATCTTAAACT  700

seq1  ATTGATCCTCTAGTTCCCTCATTCCCGGCGCTGGGATTATATGTGTACTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGATCCTCTAGTTCCCTCATTCCCGGCGCTGGGATTATATGTGTACTA  750

seq1  CCATACCTGGTTTTATGCAGTGATGAATATCAAACCCATGCATGCTAGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATACCTGGTTTTATGCAGTGATGAATATCAAACCCATGCATGCTAGGT  800

seq1  GAGCATTCTAGCAGTAGCTAAATCCTTCAACACTCAGTGATATGCATAAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCATTCTAGCAGTAGCTAAATCCTTCAACACTCAGTGATATGCATAAT  850

seq1  AGAGGTTATTCTTTACATCAAAGCAATATAAATCTGAAGAAAGAAAGCAA  900
      ||||||||||||||||||||||||||||| ||||||||| ||||||||||
seq2  AGAGGTTATTCTTTACATCAAAGCAATATTAATCTGAAG-AAGAAAGCAA  899

seq1  GGGAGGAGAAGAGCGGGGAATCTAGAGAGGAAGTGAAGGAAGAAGAAAAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGAGAAGAGCGGGGAATCTAGAGAGGAAGTGAAGGAAGAAGAAAAG  949

seq1  GAGGTGGATGTGTGCAGGCAAGGTGTATTGAACAACCAAATTCTATTGCC  1000
      || ||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GA-GTGGATGTGTGCAGGCAAGGTGTATTGAACAACCAAA-TCTATTGCC  997

seq1  ATTTTTTTTAACCATAGTTGTCATCATATAGTTGGAACAAGCTGCTTGTA  1050
      | ||||||||||||||| ||||||||||||| |||||| |||||| ||||
seq2  A-TTTTTTTAACCATAG-TGTCATCATATAG-TGGAAC-AGCTGC-TGTA  1042

seq1  TATGAAGCAGCTTGTATATGAAGGTCTTTATTAAGTAACCTAACTTCACA  1100
       |||||||||||||||| || |||||| |||  ||| |||| || |||||
seq2  -ATGAAGCAGCTTGTAT-TG-AGGTCTCTAT--AGTTACCTTACCTCACA  1087

seq1  --CTACTATGTCTACT-CTAAGTGAGAACAGCCATGCA-TGCTGTTGAAT  1146
        |||||||||||||| ||||||||||   | |||||| |||||||| ||
seq2  CTCTACTATGTCTACTCCTAAGTGAGACACGGCATGCATTGCTGTTG-AT  1136

seq1  TAGTCTGGCAGCAACCTGT  1165
      |||||| ||||| ||||||
seq2  TAGTCT-GCAGC-ACCTGT  1153

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information