MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-215P12
Chromosome	6 (Build37)
Map Location	126,030,909 - 126,169,241
singlet/doublet	doublet
Overlap gene	Ntf3, LOC100043565
Upstream gene	Gpr92, Chd4, Nol1, A930037G23Rik, Gapdh, Ncapd2, Mrpl51, Vamp1, Tapbpl, Cd27, 4930417O13Rik, Tuba3a, Ltbr, Scnn1a, Tnfrsf1a, Plekhg6, Cd9, Vwf, Tmem16b
Downstream gene	LOC667427, LOC100043567, Kcna5, Kcna1, Kcna6, LOC667463, Ndufa9, Akap3, Dyrk4, Rad51ap1, D6Wsu163e, LOC667473, LOC624256, Fgf6, Fgf23, 9630033F20Rik, Ccnd2, Tpi-rs11
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gpr92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381810 MGI:2685918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 6 ESTs, 12 Proteins

name	Chd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107932 MGI:1344380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110109 MGI:107891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930037G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320678 MGI:2444516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gapdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14433 MGI:95640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncapd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68298 MGI:1915548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66493 MGI:1913743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vamp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22317 MGI:1313276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tapbpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213233 MGI:2384853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930417O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73870 MGI:1921120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs

name	Tuba3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22144 MGI:1095406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17000 MGI:104875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scnn1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20276 MGI:101782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21937 MGI:1314884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213522 MGI:2682298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12527 MGI:88348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vwf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22371 MGI:98941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem16b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243634 MGI:2387214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18205 MGI:97380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Kcna5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16493 MGI:96662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16485 MGI:96654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16494 MGI:96663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ndufa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66108 MGI:1913358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11642 MGI:1341149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dyrk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101320 MGI:1330292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad51ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19362 MGI:1098224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D6Wsu163e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28040 MGI:107893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC624256 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Fgf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14177 MGI:95520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64654 MGI:1891427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630033F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319801 MGI:2442752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12444 MGI:88314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpi-rs11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111223 MGI:98799
definition	note : triosephosphate isomerase related sequence 11 pseudo : _no_value

name	Gpr92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255424 GeneID:381810 MGI:2685918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 12 Proteins product : G protein-coupled receptor 92 transcript_id : XM_355812.4

name	Chd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130239 GeneID:107932 MGI:1344380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromodomain helicase DNA binding protein 4 transcript_id : NM_145979.2

name	Nol1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27819666 GeneID:110109 MGI:107891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 1 transcript_id : NM_138747.1

name	A930037G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89179301 GeneID:320678 MGI:2444516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930037G23 gene transcript_id : NM_178787.5

name	A930037G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345130 GeneID:320678 MGI:2444516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930037G23 gene transcript_id : NM_001039669.2

name	Gapdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012538 GeneID:14433 MGI:95640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyceraldehyde-3-phosphate dehydrogenase transcript_id : NM_008084.2

name	Ncapd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165391 GeneID:68298 MGI:1915548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC condensin I complex, subunit D2 transcript_id : NM_146171.1

name	Mrpl51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801993 GeneID:66493 MGI:1913743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L51 transcript_id : NM_025595.2

name	Vamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702072 GeneID:22317 MGI:1313276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 1 transcript_id : NM_001080557.1

name	Vamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702046 GeneID:22317 MGI:1313276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein 1 transcript_id : NM_009496.3

name	Tapbpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703781 GeneID:213233 MGI:2384853
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein-like transcript_id : NM_145391.1

name	Cd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350002 GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD antigen 27 transcript_id : NM_001042564.1

name	Cd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350005 GeneID:21940 MGI:88326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD antigen 27 transcript_id : NM_001033126.2

name	4930417O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149255426 GeneID:73870 MGI:1921120
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs product : RIKEN cDNA 4930417O13 gene transcript_id : XM_001481089.1

name	Tuba3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431225 GeneID:22144 MGI:1095406
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 3A transcript_id : NM_009446.2

name	Ltbr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227254 GeneID:17000 MGI:104875
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphotoxin B receptor transcript_id : NM_010736.2

name	Scnn1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859617 GeneID:20276 MGI:101782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, nonvoltage-gated, type I, alpha transcript_id : NM_011324.1

name	Tnfrsf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227249 GeneID:21937 MGI:1314884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 1a transcript_id : NM_011609.3

name	Plekhg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348453 GeneID:213522 MGI:2682298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 6 transcript_id : NM_198604.1

name	Cd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271531 GeneID:12527 MGI:88348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD9 antigen transcript_id : NM_007657.3

name	Vwf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511021 GeneID:22371 MGI:98941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Von Willebrand factor homolog transcript_id : NM_011708.3

name	Tmem16b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956389 GeneID:243634 MGI:2387214
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 16B transcript_id : NM_153589.1

name	Ntf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52694681 GeneID:18205 MGI:97380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophin 3 transcript_id : NM_008742.2

name	LOC100043565 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149255331 GeneID:100043565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001480410.1

name	Kcna5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122428 GeneID:16493 MGI:96662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, member 5 transcript_id : NM_145983.1

name	Kcna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119395751 GeneID:16485 MGI:96654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related subfamily, member 1 transcript_id : NM_010595.3

name	Kcna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343730 GeneID:16494 MGI:96663
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, shaker-related, subfamily, member 6 transcript_id : NM_013568.5

name	Ndufa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354575 GeneID:66108 MGI:1913358
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 transcript_id : NM_025358.2

name	Akap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753025 GeneID:11642 MGI:1341149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 3 transcript_id : NM_009650.1

name	Dyrk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402172 GeneID:101320 MGI:1330292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 transcript_id : NM_207210.1

name	Rad51ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347569 GeneID:19362 MGI:1098224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD51 associated protein 1 transcript_id : NM_009013.3

name	D6Wsu163e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372851 GeneID:28040 MGI:107893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 6, Wayne State University 163, expressed transcript_id : NM_138594.3

name	Fgf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112363075 GeneID:14177 MGI:95520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 6 transcript_id : NM_010204.1

name	Fgf23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625790 GeneID:64654 MGI:1891427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 23 transcript_id : NM_022657.3

name	9630033F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802664 GeneID:319801 MGI:2442752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630033F20 gene transcript_id : NM_177003.4

name	Ccnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80751174 GeneID:12444 MGI:88314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D2 transcript_id : NM_009829.3

name	Gpr92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255425 GeneID:381810 MGI:2685918
definition	codon_start : 1 product : similar to Gpr92 protein protein_id : XP_355812.2

name	Chd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39204553 CCDS:CCDS20543.1 GeneID:107932 MGI:1344380
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Mi-2 beta product : chromodomain helicase DNA binding protein 4 protein_id : NP_666091.1

name	Nol1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819667 GeneID:110109 MGI:107891
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : nucleolar protein 1, 120 kDa product : nucleolar protein 1 protein_id : NP_620086.1

name	A930037G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179308 GeneID:320678 MGI:2444516
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; HOM-TES-103 tumor antigen-like product : hypothetical protein LOC320678 isoform a protein_id : NP_001034758.1

name	A930037G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89179302 GeneID:320678 MGI:2444516
definition	GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; HOM-TES-103 tumor antigen-like product : hypothetical protein LOC320678 isoform b protein_id : NP_848902.4

name	Gapdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679937 GeneID:14433 MGI:95640
definition	EC_number : 1.2.1.12 codon_start : 1 product : glyceraldehyde-3-phosphate dehydrogenase protein_id : NP_032110.1

name	Ncapd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165392 GeneID:68298 MGI:1915548
definition	GO_component : GO:0000793 - condensed chromosome [Evidence ISS] [Evidence IDA]; GO:0000797 - condensin core heterodimer [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0045120 - pronucleus [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0042393 - histone binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence ISS] [Evidence IEA] codon_start : 1 product : chromosome condensation-related SMC-associated protein 1 protein_id : NP_666283.1

name	Mrpl51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385050 CCDS:CCDS20545.1 GeneID:66493 MGI:1913743
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IDA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 note : mitochondrial ribosomal protein 64 product : mitochondrial ribosomal protein L51 protein_id : NP_079871.1

name	Vamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678549 CCDS:CCDS20546.1 GeneID:22317 MGI:1313276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : vesicle-associated membrane protein 1 isoform a protein_id : NP_033522.1

name	Vamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123702073 GeneID:22317 MGI:1313276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : vesicle-associated membrane protein 1 isoform b protein_id : NP_001074026.1

name	Tapbpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703782 CCDS:CCDS20547.1 GeneID:213233 MGI:2384853
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TAP binding protein-like protein_id : NP_663366.1

name	Cd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110350003 GeneID:21940 MGI:88326
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IPI] [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042100 - B cell proliferation [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence ISS]; GO:0048305 - immunoglobulin secretion [Evidence NAS]; GO:0006917 - induction of apoptosis [Evidence IPI]; GO:0045579 - positive regulation of B cell differentiation [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence NAS]; GO:0046330 - positive regulation of JNK cascade [Evidence IDA]; GO:0045582 - positive regulation of T cell differentiation [Evidence NAS]; GO:0008588 - release of cytoplasmic sequestered NF-kappaB [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; tumor necrosis factor receptor superfamily, member 7 product : tumor necrosis factor receptor superfamily, member 7 isoform b protein_id : NP_001036029.1

name	Cd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677534 GeneID:21940 MGI:88326
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0043027 - caspase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IPI] [Evidence ISS]; GO:0006915 - apoptosis [Evidence IEA]; GO:0042100 - B cell proliferation [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence ISS]; GO:0048305 - immunoglobulin secretion [Evidence NAS]; GO:0006917 - induction of apoptosis [Evidence IPI]; GO:0045579 - positive regulation of B cell differentiation [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence NAS]; GO:0046330 - positive regulation of JNK cascade [Evidence IDA]; GO:0045582 - positive regulation of T cell differentiation [Evidence NAS]; GO:0008588 - release of cytoplasmic sequestered NF-kappaB [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; tumor necrosis factor receptor superfamily, member 7 product : tumor necrosis factor receptor superfamily, member 7 isoform a protein_id : NP_001028298.1

name	4930417O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149255427 GeneID:73870 MGI:1921120
definition	codon_start : 1 product : hypothetical protein LOC73870 protein_id : XP_001481139.1

name	Tuba3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678465 GeneID:22144 MGI:1095406
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 note : tubulin, alpha 3 product : tubulin, alpha 1a protein_id : NP_033472.1

name	Ltbr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549775 CCDS:CCDS20549.1 GeneID:17000 MGI:104875
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0048535 - lymph node development [Evidence TAS] codon_start : 1 note : LT beta-R; LT-beta receptor; TNF receptor-related protein; tumor necrosis factor receptor superfamily, member 3 product : lymphotoxin B receptor protein_id : NP_034866.1

name	Scnn1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859618 GeneID:20276 MGI:101782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ENaC alpha; sodium channel, nonvoltage-gated, type I, alpha polypeptide product : sodium channel, nonvoltage-gated, type I, alpha protein_id : NP_035454.1

name	Tnfrsf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560799 CCDS:CCDS20550.1 GeneID:21937 MGI:1314884
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005031 - tumor necrosis factor receptor activity [Evidence TAS] [Evidence IMP] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IMP]; GO:0006952 - defense response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0050729 - positive regulation of inflammatory response [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006693 - prostaglandin metabolism [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : TNF receptor alpha chain product : tumor necrosis factor receptor superfamily, member 1a protein_id : NP_035739.2

name	Plekhg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348454 GeneID:213522 MGI:2682298
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pleckstrin homology domain containing, family G (with RhoGef domain) member 6 protein_id : NP_941006.1

name	Cd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680894 CCDS:CCDS20551.1 GeneID:12527 MGI:88348
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0006928 - cell motility [Evidence ISS]; GO:0007338 - fertilization (sensu Metazoa) [Evidence IEA]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IDA]; GO:0030913 - paranodal junction assembly [Evidence IDA]; GO:0030168 - platelet activation [Evidence ISS] codon_start : 1 product : CD9 antigen protein_id : NP_031683.1

name	Vwf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511022 CCDS:CCDS20552.1 GeneID:22371 MGI:98941
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0002020 - protease binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence TAS] [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007599 - hemostasis [Evidence TAS] [Evidence IMP] codon_start : 1 product : von Willebrand factor protein_id : NP_035838.3

name	Tmem16b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956390 GeneID:243634 MGI:2387214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 16B protein_id : NP_705817.1

name	Ntf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679144 CCDS:CCDS20553.1 GeneID:18205 MGI:97380
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005166 - neurotrophin p75 receptor binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007411 - axon guidance [Evidence IDA] [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048484 - enteric nervous system development [Evidence IMP]; GO:0008544 - epidermis development [Evidence IMP]; GO:0048699 - generation of neurons [Evidence IGI]; GO:0007403 - glial cell fate determination [Evidence IMP]; GO:0042490 - mechanoreceptor differentiation [Evidence IGI]; GO:0021675 - nerve development [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IDA]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0043523 - regulation of neuron apoptosis [Evidence IDA]; GO:0051145 - smooth muscle cell differentiation [Evidence IMP] codon_start : 1 product : neurotrophin 3 protein_id : NP_032768.1

name	LOC100043565 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149255332 GeneID:100043565
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480460.1

name	Kcna5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122429 CCDS:CCDS20554.1 GeneID:16493 MGI:96662
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage-gated channel, shaker-related subfamily, member 5 protein_id : NP_666095.1

name	Kcna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119395752 CCDS:CCDS20555.1 GeneID:16485 MGI:96654
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mouse brain potassium channel protein-1; megencephaly; potassium voltage gated channel, shaker related subfamily, member 1 product : potassium voltage-gated channel subfamily A member 1 protein_id : NP_034725.3

name	Kcna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305201 CCDS:CCDS20556.1 GeneID:16494 MGI:96663
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : potassium voltage gated channel, shaker related, subfamily, member 6 product : potassium voltage-gated channel, shaker-related, subfamily, member 6 protein_id : NP_038596.1

name	Ndufa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384720 CCDS:CCDS20557.1 GeneID:66108 MGI:1913358
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0050662 - coenzyme binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 protein_id : NP_079634.1

name	Akap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753026 CCDS:CCDS20558.1 GeneID:11642 MGI:1341149
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051018 - protein kinase A binding [Evidence IMP] GO_process : GO:0006928 - cell motility [Evidence IMP]; GO:0008104 - protein localization [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] codon_start : 1 exception : mismatches in translation product : A-kinase anchor protein 3 protein_id : NP_033780.1

name	Dyrk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402173 CCDS:CCDS20559.1 GeneID:101320 MGI:1330292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 protein_id : NP_997093.1

name	Rad51ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626102 GeneID:19362 MGI:1098224
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence ISS] GO_process : GO:0006310 - DNA recombination [Evidence IPI]; GO:0006281 - DNA repair [Evidence IEA] [Evidence ISS]; GO:0000724 - double-strand break repair via homologous recombination [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : RAD51 associated protein 1 protein_id : NP_033039.2

name	D6Wsu163e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070406 CCDS:CCDS20560.1 GeneID:28040 MGI:107893
definition	codon_start : 1 product : hypothetical protein LOC28040 protein_id : NP_613060.1

name	Fgf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112363076 CCDS:CCDS20561.1 GeneID:14177 MGI:95520
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : fibroblast growth factor 6 protein_id : NP_034334.1

name	Fgf23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12083589 CCDS:CCDS20562.1 GeneID:64654 MGI:1891427
definition	GO_function : GO:0005104 - fibroblast growth factor receptor binding [Evidence TAS]; GO:0008083 - growth factor activity [Evidence TAS] GO_process : GO:0030643 - phosphate ion homeostasis [Evidence IMP]; GO:0030500 - regulation of bone mineralization [Evidence IMP] codon_start : 1 product : fibroblast growth factor 23 protein_id : NP_073148.1

name	9630033F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892859 CCDS:CCDS20563.1 GeneID:319801 MGI:2442752
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : RIKEN cDNA 9630033F20 gene protein_id : NP_795977.1

name	Ccnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753310 CCDS:CCDS20564.1 GeneID:12444 MGI:88314
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] [Evidence IMP] codon_start : 1 product : cyclin D2 protein_id : NP_033959.1

name	LOC667427 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667427
definition	number : 1 pseudo : _no_value

name	LOC100043567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043567
definition	number : 3 pseudo : _no_value

name	LOC100043567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043567
definition	number : 2 pseudo : _no_value

name	LOC100043567 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043567
definition	number : 1 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 9 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 8 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 7 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 6 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 5 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 4 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 3 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 2 pseudo : _no_value

name	LOC667463 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667463
definition	number : 1 pseudo : _no_value

name	LOC667473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667473
definition	number : 2 pseudo : _no_value

name	LOC667473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667473
definition	number : 1 pseudo : _no_value

name	(CDS detail)
type	STS
link
xref	UniSTS:208034
definition	standard_name : BB284187

name	(CDS detail)
type	STS
link
xref	UniSTS:268430
definition	standard_name : MARC_17871-17872:1025017089:1

name	(CDS detail)
type	STS
link
xref	UniSTS:167483
definition	standard_name : D6Ertd380e

name	(CDS detail)
type	STS
link
xref	UniSTS:243386
definition	standard_name : AA963793

name	(CDS detail)
type	STS
link
xref	UniSTS:161081
definition	standard_name : RH124259

name	(CDS detail)
type	STS
link
xref	UniSTS:78038
definition	standard_name : RH64827

name	(CDS detail)
type	STS
link
xref	UniSTS:235555
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:144037
definition	standard_name : Nol1

name	(CDS detail)
type	STS
link
xref	UniSTS:235556
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:119881
definition	standard_name : RH94634

name	(CDS detail)
type	STS
link
xref	UniSTS:208035
definition	standard_name : BE292615

name	(CDS detail)
type	STS
link
xref	UniSTS:144742
definition	standard_name : Vamp1

name	(CDS detail)
type	STS
link
xref	UniSTS:161971
definition	standard_name : RH125149

name	(CDS detail)
type	STS
link
xref	UniSTS:144659
definition	standard_name : Tnfrsf7

name	(CDS detail)
type	STS
link
xref	UniSTS:179462
definition	standard_name : AI528779

name	(CDS detail)
type	STS
link
xref	UniSTS:179464
definition	standard_name : AI256028

name	(CDS detail)
type	STS
link
xref	UniSTS:275859
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:125715
definition	standard_name : U29173

name	(CDS detail)
type	STS
link
xref	UniSTS:143800
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:143799
definition	standard_name : Ltbr

name	(CDS detail)
type	STS
link
xref	UniSTS:130678
definition	standard_name : D6Mit134

name	(CDS detail)
type	STS
link
xref	UniSTS:130762
definition	standard_name : D6Mit217

name	(CDS detail)
type	STS
link
xref	UniSTS:142951
definition	standard_name : EC218RL

name	(CDS detail)
type	STS
link
xref	UniSTS:142953
definition	standard_name : EC351RL

name	(CDS detail)
type	STS
link
xref	UniSTS:144653
definition	standard_name : Tnfrsf1a

name	(CDS detail)
type	STS
link
xref	UniSTS:130804
definition	standard_name : D6Mit254

name	(CDS detail)
type	STS
link
xref	UniSTS:270466
definition	standard_name : PMC124385P1

name	(CDS detail)
type	STS
link
xref	UniSTS:142581
definition	standard_name : D6Jpk2

name	(CDS detail)
type	STS
link
xref	UniSTS:143911
definition	standard_name : Ms6hm3

name	(CDS detail)
type	STS
link
xref	UniSTS:163020
definition	standard_name : RH126312

name	(CDS detail)
type	STS
link
xref	UniSTS:221216
definition	standard_name : RH139130

name	(CDS detail)
type	STS
link
xref	UniSTS:123859
definition	standard_name : 29.MMHAP36FLB5.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:130888
definition	standard_name : D6Mit334

name	(CDS detail)
type	STS
link
xref	UniSTS:272351
definition	standard_name : PMC26753P2

name	(CDS detail)
type	STS
link
xref	UniSTS:144762
definition	standard_name : Vwf

name	(CDS detail)
type	STS
link
xref	UniSTS:271099
definition	standard_name : PMC15073P1

name	(CDS detail)
type	STS
link
xref	UniSTS:179465
definition	standard_name : AI551257

name	(CDS detail)
type	STS
link
xref	UniSTS:123965
definition	standard_name : 31.MMHAP94FLC4.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:122869
definition	standard_name : 06.MMHAP83FLB3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:142947
definition	standard_name : EC108RR

name	(CDS detail)
type	STS
link
xref	UniSTS:225313
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:179466
definition	standard_name : AI835689

name	(CDS detail)
type	STS
link
xref	UniSTS:210129
definition	standard_name : RH136134

name	(CDS detail)
type	STS
link
xref	UniSTS:130887
definition	standard_name : D6Mit333

name	(CDS detail)
type	STS
link
xref	UniSTS:116328
definition	standard_name : D6Mit256

name	(CDS detail)
type	STS
link
xref	UniSTS:142955
definition	standard_name : EC79RR

name	(CDS detail)
type	STS
link
xref	UniSTS:142636
definition	standard_name : D6Tem4

name	(CDS detail)
type	STS
link
xref	UniSTS:159573
definition	standard_name : L22218

name	(CDS detail)
type	STS
link
xref	UniSTS:498332
definition	standard_name : Kcna5

name	(CDS detail)
type	STS
link
xref	UniSTS:463210
definition	standard_name : Kcna5

name	(CDS detail)
type	STS
link
xref	UniSTS:142633
definition	standard_name : D6Tem1

name	(CDS detail)
type	STS
link
xref	UniSTS:142956
definition	standard_name : EC84RL

name	(CDS detail)
type	STS
link
xref	UniSTS:71596
definition	standard_name : RH11273

name	(CDS detail)
type	STS
link
xref	UniSTS:215006
definition	standard_name : RH131723

name	(CDS detail)
type	STS
link
xref	UniSTS:75451
definition	standard_name : RH70531

name	(CDS detail)
type	STS
link
xref	UniSTS:224835
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:143651
definition	standard_name : Kcna1

name	(CDS detail)
type	STS
link
xref	UniSTS:157228
definition	standard_name : GDB:435453

name	(CDS detail)
type	STS
link
xref	UniSTS:143652
definition	standard_name : Kcna1

name	(CDS detail)
type	STS
link
xref	UniSTS:271947
definition	standard_name : PMC20739P2

name	(CDS detail)
type	STS
link
xref	UniSTS:271948
definition	standard_name : PMC20739P3

name	(CDS detail)
type	STS
link
xref	UniSTS:165489
definition	standard_name : AI840627

name	(CDS detail)
type	STS
link
xref	UniSTS:142635
definition	standard_name : D6Tem3

name	(CDS detail)
type	STS
link
xref	UniSTS:142634
definition	standard_name : D6Tem2

name	(CDS detail)
type	STS
link
xref	UniSTS:143653
definition	standard_name : Kcna6

name	(CDS detail)
type	STS
link
xref	UniSTS:159575
definition	standard_name : 06.MMHAP25FLB3.seq

name	(CDS detail)
type	STS
link
xref	UniSTS:179468
definition	standard_name : AW049118

name	(CDS detail)
type	STS
link
xref	UniSTS:235557
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:161454
definition	standard_name : RH124632

name	(CDS detail)
type	STS
link
xref	UniSTS:142651
definition	standard_name : D6Wsu163e

name	(CDS detail)
type	STS
link
xref	UniSTS:156193
definition	standard_name : GDB:214840

name	(CDS detail)
type	STS
link
xref	UniSTS:143094
definition	standard_name : Fgf6

name	(CDS detail)
type	STS
link
xref	UniSTS:125000
definition	standard_name : M92416

name	(CDS detail)
type	STS
link
xref	UniSTS:159574
definition	standard_name : M92416

name	(CDS detail)
type	STS
link
xref	UniSTS:142642
definition	standard_name : D6Uwa1

name	(CDS detail)
type	STS
link
xref	UniSTS:130763
definition	standard_name : D6Mit218

name	(CDS detail)
type	STS
link
xref	UniSTS:165491
definition	standard_name : AI595337

name	(CDS detail)
type	STS
link
xref	UniSTS:208032
definition	standard_name : RH126720

name	(CDS detail)
type	STS
link
xref	UniSTS:208031
definition	standard_name : C85509

name	(CDS detail)
type	STS
link
xref	UniSTS:235559
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:235558
definition

name	(CDS detail)
type	STS
link
xref	UniSTS:210096
definition	standard_name : RH136101

name	(CDS detail)
type	STS
link
xref	UniSTS:208030
definition	standard_name : C86853

name	(CDS detail)
type	STS
link
xref	UniSTS:141259
definition	standard_name : Ccnd2

name	LOC624256 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149255428 GeneID:624256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to small nuclear ribonucleoprotein E pseudo : _no_value transcript_id : XR_034994.1

clone name	MSMg01-493N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-308D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-292F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192A18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-215P12.b	B6Ng01-215P12.g
ACC	GA032785	GA032786
length	1,131	1,119
definition	B6Ng01-215P12.b	B6Ng01-215P12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(126,030,909 - 126,032,028)	(126,168,122 - 126,169,241)
sequence	gaattccagccacagaatgcagagagagctggctaggaagaatagctcta tctggaagtgctaggtttgacttgtctcaaagaataatgtggaaaagtaa cagggcacactccgggacatcaaccgcgggcctacacatggacgagtaat gaagggtgcggtctaccatttccatacctacatttatgtaaatcatgtat gcatgcatgcacattccaaacatgggaaaataatgctaaagctgtcagca aagtgattttatttgctgttgttttgttttaagacagaatctcacgatga agcctcgctgggtcagcctcaaactcttgatccccctgtctaagcctctt aagtttgagcgtggggcttaagggagtgtgccacatgaccagcaagcagc acagtgtctctctgcagccatgattcctaggacgactttgccaaccagaa gccatgaaacacattacccgtgactcagtttccttgatgacaaaaaagga aggaactgtaagacccacctctcaagaacaaagaaggggtggtattttag tcacttctctcagtgctgtgataaaaatcctgaatcaggcaactaaggaa ggaagggtttactttggtttaccatttgagggcacagctcaccccagcaa ggaaggcgtggtgtcagagctgtgaagcaggtggtcctactgcatctgaa gtcaggaagcagagcctgatgaaagtctttgcttagctcagtttctcctc tttattcagtctggaacctgagcccatggaatggtactgcctacatttgg ggtggatcaccccacatcaaagaacccaaggtagacattccctcgaagac agagccagaggttcgtcttcaacatgattcccaaatttgtcttggttgga aatcaatattaaatcctcacagaagaggcaactactccggagaaactgtc cactttcaatttatattggcctgccccacaagggatgtagtagagtttaa tttgctacttttcctgaattctcttacaatttctggttcttgacctagcc ttaatggatggagccatcctctccagccctgccttctgaatctcaaaggg atgctaagaaattcatctcaggttatttttt	gaattccagaggagcgaaacatgtgtgaaggcttatgacagcactgcgtg tttgagaaactgcaaacattacaaatactgtggctaaccagaggggagct ggaggaggggctgggaaacatctcaggagtattggcagtgtgcacagtca gtctctcaaagaccttgtggctactcagggaagggtgggcttcgacctgc ggcaatggacaaagcttttaattatcttttgttggtgttattttactgca gaagccatgtagaatttcaggtggctgatgtcaatagcatgaagaaaaca tatggaagaaaattgtagaaagagtctatgtcaaaggcagacacagtaag aacagaggtcagcattcttgctgccccatcttcttcagtgttcctggacc ttgaagagagtgaattagatgtcttgtttaagaattgtgtgtgattgtat ttaatttttccataaacctaataaaaactcaaaatacaaagtctaagatt tttaaacacatgtacacacacacacacacacacacacacacacacacaca ccacacacacacacacacacacgcacacacacacacgtgcacgcgcatat gcatgcacacatgcacacacatgcacttacacacatttctggcttttaca taaacttttccagtccttgtccaagtaaatggaagtttaggccaggaatt tagcttcacatgagttgtctgcatgtaaaaacttctcttcagcacaggaa gaagtgacctctaaccctgccaagttacatcagagagggagaggaacgag tcccagagtgatgaatggaggccagtgaagagacttatacaaatttctct actttaaaaaactgacaagctgactcccagagaggcaagtaattcttaat cgcctgtttgattagagttgagaacagataaggagcacaatggcgtgccc agagagcaggacatgaataaccacaagtgacaggtgtaatgtaatgccta gtacattggtgcttggtgctacaagacagcattcccgagtaagcccggtc tccatcatttgatttcaggcttgcagtggacccgaagcaatcacctcttt ctggaaaacgatagagcag
quality values	Open. Hide. 48 38 25 23 58 58 32 14 48 58 25 16 58 26 58 54 54 42 54 62 41 62 62 62 62 62 62 62 54 62 11 9 10 10 13 13 8 16 13 13 20 10 8 10 10 22 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 49 19 18 30 12 13 18 10 28 27 23 34 25 21 28 27 54 48 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 46 46 56 50 50 51 50 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 45 49 38 56 59 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 37 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 42 54 41 62 62 62 62 62 62 47 42 62 47 62 62 62 48 62 62 62 39 58 39 42 58 48 54 54 58 58 58 58 54 52 58 41 50 41 52 52 58 58 54 58 58 54 58 48 54 52 54 52 48 52 54 54 52 52 58 58 43 54 35 52 45 54 58 58 58 39 22 49 42 52 42 58 45 52 54 50 52 47 42 58 22 52 58 54 46 41 36 48 40 52 46 29 58 52 58 46 34 53 50 50 50 24 37 51 46 46 51 46 53 53 50 58 40 52 50 37 29 45 49 48 34 48 49 28 51 18 40 45 46 50 30 23 52 43 58 58 50 41 53 53 58 35 32 32 49 53 50 14 51 41 40 41 27 51 58 37 28 26 36 30 48 46 53 58 53 39 26 53 53 31 41 35 50 42 51 50 50 35 26 44 39 41 46 24 50 58 28 19 29 38 58 51 41 28 46 21 21 33 52 41 50 29 51 27 39 39 30 26 54 28 54 54 54 54 40 38 32 32 31 34 27 33 36 26 33 18 30 21 45 32 23 29 39 32 39 28 16 44 41 21 52 16 51 20 45 35 35 24 17 36 26 28 40 41 37 38 23 27 33 6 20 18 25 29 41 26 37 39 24 31 30 6 29 28 17 21 24 32 31 32 32 34 23 13 16 6 9 15 31 25 41 19 53 14 40 40 14 12 51 13 32 17 16 14 11 52 27 14 25 40 20 15 34 16 22 14 15 20 34 31 28 34 18 51 8 22 23 25 26 31 20 21 14 16 27 9 19 25 17 27 20 34 30 30 34 29 45 21 15 25 28 17 10 7 19 46 28 11 17 37 15 17 24 12 18 31 42 25 31 43 46 13 31 24 13 22 21 9 20 27 31 9 9 22 25 18 42 46 21 11 15 10 9 39 39 21 17 18 30 16 28 21 26 31 9 29 10 22 46 33 28 34 11 41 11 13 4 19 21 25 12 37 48 32 21 7 21 15 19 24 12 17 21 22 36 10 30 11 24 11 12 30 35 31 9 31 7 22 20 12 20 11 10 9 10 5 14 20 14 11 30 17 21 5 5 26 18 25 7 6 7 8 7 15 5 13 22 6 5 6 5 6 5 11 18 22 10 21 7 18 31 12 21 10 10 10 13 30 14 13 13 7 34 7 4 15 9 17 11 11 9 9 16 8 7 15 10 3 3 10 7 17 15 5 10 10 20 11 4 3 3 3 3 3 3 6 6 7 40 27 25 13 12	Open. Hide. 62 47 56 47 62 62 41 24 62 62 12 11 10 10 9 8 18 25 25 13 19 19 25 13 50 36 49 59 59 62 54 62 62 62 62 59 62 59 62 59 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 13 24 19 18 28 23 25 34 27 28 36 28 22 28 28 50 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 54 54 62 62 62 62 54 62 62 62 62 62 54 54 62 59 59 62 62 62 62 62 62 62 62 54 62 62 62 62 54 49 42 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 51 56 48 28 34 49 59 56 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 50 59 48 48 59 59 50 27 38 46 59 59 59 56 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 59 62 62 56 59 56 56 51 51 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 56 56 62 62 56 56 62 56 56 51 56 51 56 56 62 56 62 62 56 51 56 51 56 56 62 62 62 51 56 51 56 51 56 39 56 39 56 37 56 43 47 43 56 40 31 46 56 56 46 41 40 40 31 56 38 47 30 56 43 56 38 47 38 56 56 47 62 62 62 62 47 56 56 52 50 52 48 62 47 41 47 54 62 62 62 52 43 52 52 52 46 52 46 41 43 52 62 52 43 52 32 31 25 45 54 62 43 62 54 58 54 58 40 54 54 38 40 52 54 58 54 42 39 54 54 54 53 49 52 38 40 42 52 52 29 31 54 58 41 32 46 52 58 42 54 54 43 54 52 52 46 39 39 46 45 47 41 44 40 49 54 52 54 54 48 54 42 28 22 58 41 52 54 48 52 42 47 41 45 52 34 38 48 40 42 41 18 33 29 24 42 51 36 37 13 41 58 34 40 32 50 32 50 53 52 24 46 50 54 46 47 47 40 23 30 28 33 15 10 19 18 58 28 50 49 41 40 50 37 28 25 32 23 21 39 34 41 46 15 43 25 29 31 39 18 22 30 29 32 17 28 16 33 28 16 40 40 44 32 29 47 16 14 24 24 24 19 19 18 26 16 50 29 32 23 58 19 53 26 58 25 39 30 38 17 31 22 11 12 10 17 13 15 12 18 29 23 5 36 19 13 33 39 43 34 29 25 23 15 16 11 10 18 23 13 4 7 9 39 46 12 6 21 14 34 32 42 10 6 24 18 28 28 44 15 31 51 24 45 39 25 24 21 37 23 23 21 12 21 15 49 46 6 12 21 29 19 30 14 9 9 17 24 19 29 19 32 26 32 13 9 9 15 7 14 17 18 19 24 27 21 17 14 11 16 23 20 6 8 11 9 23 11 5 11 12 18 20 6 46 8 14 30 22 29 23 20 22 6 22 9 14 45 7 24 22 23 8 9 16 6 5 12 6 16 30 21 23 22 20 9 17 11 25 32 13 21 9 12 31 32 43 26 15 31 15 39 24 24 13 8 18 27 7 12 23 21 13 5 6 8 9 9 21 7 32 10 21 11 11 23 17 11 9 25 33 5 7 8 15 19 22 23 16 18 18 29 14 5 9 31 15 11 7 10 22 9 5 6 31 35 6 19 15 10 33 13 17 7 12 8 6 7 16 10 6 9 8 7 5 8 5 10 4 8 5 16 7 5 5 4 6 4 12 12 24 25 18 10 10 16 18 27 24 22 6 11 27 14 33 26 15 21 16 16 27 6 6 11 14 18 5 8 5 3 3 8 15 10 8 21 11 5 26 3 5 3 4 3 9 8 9 13 18 5 3 3 3 4 9 26 6 5 8 3 4 12 17 21 6 3 3 3 1 2 4 6 3 2 3 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr6_126030909_126032028
seq2: B6Ng01-215P12.b_46_1176

seq1  GAATTCCAGCCACAGAATGCAGAGAGAGCTGGCTAGGAAGAATAGCTCTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGCCACAGAATGCAGAGAGAGCTGGCTAGGAAGAATAGCTCTA  50

seq1  TCTGGAAGTGCTAGGTTTGACTTGTCTCAAAGAATAATGTGGAAAAGTAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAGTGCTAGGTTTGACTTGTCTCAAAGAATAATGTGGAAAAGTAA  100

seq1  CAGGGCACACTCCGGGACATCAACCGCGGGCCTACACATGGACGAGTAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCACACTCCGGGACATCAACCGCGGGCCTACACATGGACGAGTAAT  150

seq1  GAAGGGTGCGGTCTACCATTTCCATACCTACATTTATGTAAATCATGTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGTGCGGTCTACCATTTCCATACCTACATTTATGTAAATCATGTAT  200

seq1  GCATGCATGCACATTCCAAACATGGGAAAATAATGCTAAAGCTGTCAGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCATGCACATTCCAAACATGGGAAAATAATGCTAAAGCTGTCAGCA  250

seq1  AAGTGATTTTATTTGCTGTTGTTTTGTTTTAAGACAGAATCTCACGATGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGATTTTATTTGCTGTTGTTTTGTTTTAAGACAGAATCTCACGATGA  300

seq1  AGCCTCGCTGGGTCAGCCTCAAACTCTTGATCCCCCTGTCTAAGCCTCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTCGCTGGGTCAGCCTCAAACTCTTGATCCCCCTGTCTAAGCCTCTT  350

seq1  AAGTTTGAGCGTGGGGCTTAAGGGAGTGTGCCACATGACCAGCAAGCAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTGAGCGTGGGGCTTAAGGGAGTGTGCCACATGACCAGCAAGCAGC  400

seq1  ACAGTGTCTCTCTGCAGCCATGATTCCTAGGACGACTTTGCCAACCAGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGTCTCTCTGCAGCCATGATTCCTAGGACGACTTTGCCAACCAGAA  450

seq1  GCCATGAAACACATTACCCGTGACTCAGTTTCCTTGATGACAAAAAAGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATGAAACACATTACCCGTGACTCAGTTTCCTTGATGACAAAAAAGGA  500

seq1  AGGAACTGTAAGACCCACCTCTCAAGAACAAAGAAGGGGTGGTATTTTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACTGTAAGACCCACCTCTCAAGAACAAAGAAGGGGTGGTATTTTAG  550

seq1  TCACTTCTCTCAGTGCTGTGATAAAAATCCTGAATCAGGCAACTAAGGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTCTCTCAGTGCTGTGATAAAAATCCTGAATCAGGCAACTAAGGAA  600

seq1  GGAAGGGTTTACTTTGGTTTACCATTTGAGGGCACAGCTCACCCCAGCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGGTTTACTTTGGTTTACCATTTGAGGGCACAGCTCACCCCAGCAA  650

seq1  GGAAGGCGTGGTGTCAGAGCTGTGAAGCAGGTGGTCCTACTGCATCTGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGCGTGGTGTCAGAGCTGTGAAGCAGGTGGTCCTACTGCATCTGAA  700

seq1  GTCAGGAAGCAGAGCCTGATGAAAGTCTTTGCTTAGCTCAGTTTCTCCTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGGAAGCAGAGCCTGATGAAAGTCTTTGCTTAGCTCAGTTTCTCCTC  750

seq1  TTTATTCAGTCTGGAACCTGAGCCCATGGAATGGTACTGCCTACATTTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTCAGTCTGGAACCTGAGCCCATGGAATGGTACTGCCTACATTTGG  800

seq1  GGTGGATCACCCCACATCAAAGAACCCAAGGTAGACATTCCCTCGAAGAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGATCACCCCACATCAAAGAACCCAAGGTAGACATTCCCTCGAAGAC  850

seq1  AGAGCCAGAGGTTCGTCTTCAACATGATT-CCAAAATTGTC-TGGTTGGA  898
      ||||||||||||||||||||||||||||| ||||| ||||| ||||||||
seq2  AGAGCCAGAGGTTCGTCTTCAACATGATTCCCAAATTTGTCTTGGTTGGA  900

seq1  AATCAATATT-AATCCTCACAGAAGGAGGCAACTACTCGGAGGAAACTGT  947
      |||||||||| ||||||||||||| ||||||||||||| |  ||||||||
seq2  AATCAATATTAAATCCTCACAGAA-GAGGCAACTACTCCGGAGAAACTGT  949

seq1  CCAC-TTCAAATTATAT--GGCTG-CCCAC-AGGGATGTAGTAGAGTTTA  992
      |||| ||||| ||||||  | ||| ||||| |||||||||||||||||||
seq2  CCACTTTCAATTTATATTGGCCTGCCCCACAAGGGATGTAGTAGAGTTTA  999

seq1  A-TTGGTACTTT--CTGAATTCTCTTAC-ATTTTTGGTTCTGAACCTAGC  1038
      | ||| ||||||  |||||||||||||| |||| |||||||  |||||||
seq2  ATTTGCTACTTTTCCTGAATTCTCTTACAATTTCTGGTTCTTGACCTAGC  1049

seq1  CTTTAATGGAT-GAGCCAT-CTCTCCAG-CCTGCTTCCTGAATTCTCAAA  1085
      | ||||||||| ||||||| |||||||| ||||| | ||||| |||||||
seq2  C-TTAATGGATGGAGCCATCCTCTCCAGCCCTGCCTTCTGAA-TCTCAAA  1097

seq1  GTGATGCTATAGAATCTATCTCATGGTTATTTTTT  1120
      | |||||||   |||  |||||| |||||||||||
seq2  GGGATGCTAAGAAATTCATCTCA-GGTTATTTTTT  1131

seq1: chr6_126168122_126169241
seq2: B6Ng01-215P12.g_66_1184 (reverse)

seq1  CTGCTCTTCTCTGTTTTCAG-AAGA-GTGATTGCTTTTGGGTCCACTTAC  48
      |||||| | ||  ||| ||| |||| |||||||| || |||||||||   
seq2  CTGCTC-TATCGTTTTCCAGAAAGAGGTGATTGC-TTCGGGTCCACTGCA  48

seq1  AGCCTG-AATCAAATGATGGAGACCGGGCTTAACTCTGGAATTGCTGTCC  97
      |||||| |||||||||||||||||||||||| |||| |||| |||||| |
seq2  AGCCTGAAATCAAATGATGGAGACCGGGCTT-ACTCGGGAA-TGCTGT-C  95

seq1  TTGTAGCCACAAGCACCATTGTACTA-GCATTACATTACACCTGTCACTT  146
      |||||||  ||||||||| ||||||| |||||||||||||||||||||||
seq2  TTGTAGCACCAAGCACCAATGTACTAGGCATTACATTACACCTGTCACTT  145

seq1  GTGGTTACTCATGTCCTGCTCTCTGGGCACGCCATTGCTGCTCCTTATCT  196
      ||||||| ||||||||||||||||||||||||||||| ||||||||||||
seq2  GTGGTTATTCATGTCCTGCTCTCTGGGCACGCCATTG-TGCTCCTTATCT  194

seq1  GTTCTCAACTCCTAATC-AACAGGCGATTATGAATTACTTGCCTCTCTGG  245
      |||||||||| |||||| |||||||||||| |||||||||||||||||||
seq2  GTTCTCAACT-CTAATCAAACAGGCGATTAAGAATTACTTGCCTCTCTGG  243

seq1  GAGTCAGCTTGTCAG-TTTTTAAAGTAGAGAAATTTGTATAAAGTCTCTT  294
      ||||||||||||||| |||||||||||||||||||||||| |||||||||
seq2  GAGTCAGCTTGTCAGTTTTTTAAAGTAGAGAAATTTGTAT-AAGTCTCTT  292

seq1  CACTGGCCT-CATTCATCACTCTGGGACTCGTTCCTCTCCCTCTCTGATG  343
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGCCTCCATTCATCACTCTGGGACTCGTTCCTCTCCCTCTCTGATG  342

seq1  TAACTTGGCAGGGTTAGAGGTCACTTCTTCCTGTGCTGAAGAGAAGTTTT  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTGGCAGGGTTAGAGGTCACTTCTTCCTGTGCTGAAGAGAAGTTTT  392

seq1  TACATGCAGACAACTCATGTGAAGCTAAATTCCTGGCCTAAACTTCCATT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATGCAGACAACTCATGTGAAGCTAAATTCCTGGCCTAAACTTCCATT  442

seq1  TACTTGGACAAGGACTGGAAAAGTTTATGTAAAAGCCAGAAATGTGTGTA  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTGGACAAGGACTGGAAAAGTTTATGTAAAAGCCAGAAATGTGTGTA  492

seq1  AGTGCATGTGTGTGCATGTGTGCATGCATATGCGCGTGCACGTGTGTGTG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCATGTGTGTGCATGTGTGCATGCATATGCGCGTGCACGTGTGTGTG  542

seq1  TGTGCGTGTGTGTGTGTGTGTGTGTGGTGTGTGTGTGTGTGTGTGTGTGT  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCGTGTGTGTGTGTGTGTGTGTGGTGTGTGTGTGTGTGTGTGTGTGT  592

seq1  GTGTGTGTGTGTGTACATGTGTTTAAAAATCTTAGACTTTGTATTTTGAG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTACATGTGTTTAAAAATCTTAGACTTTGTATTTTGAG  642

seq1  TTTTTATTAGGTTTATGGAAAAATTAAATACAATCACACACAATTCTTAA  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTATTAGGTTTATGGAAAAATTAAATACAATCACACACAATTCTTAA  692

seq1  ACAAGACATCTAATTCACTCTCTTCAAGGTCCAGGAACACTGAAGAAGAT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGACATCTAATTCACTCTCTTCAAGGTCCAGGAACACTGAAGAAGAT  742

seq1  GGGGCAGCAAGAATGCTGACCTCTGTTCTTACTGTGTCTGCCTTTGACAT  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCAGCAAGAATGCTGACCTCTGTTCTTACTGTGTCTGCCTTTGACAT  792

seq1  AGACTCTTTCTACAATTTTCTTCCATATGTTTTCTTCATGCTATTGACAT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTCTTTCTACAATTTTCTTCCATATGTTTTCTTCATGCTATTGACAT  842

seq1  CAGCCACCTGAAATTCTACATGGCTTCTGCAGTAAAATAACACCAACAAA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCACCTGAAATTCTACATGGCTTCTGCAGTAAAATAACACCAACAAA  892

seq1  AGATAATTAAAAGCTTTGTCCATTGCCGCAGGTCGAAGCCCACCCTTCCC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAATTAAAAGCTTTGTCCATTGCCGCAGGTCGAAGCCCACCCTTCCC  942

seq1  TGAGTAGCCACAAGGTCTTTGAGAGACTGACTGTGCACACTGCCAATACT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTAGCCACAAGGTCTTTGAGAGACTGACTGTGCACACTGCCAATACT  992

seq1  CCTGAGATGTTTCCCAGCCCCTCCTCCAGCTCCCCTCTGGTTAGCCACAG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAGATGTTTCCCAGCCCCTCCTCCAGCTCCCCTCTGGTTAGCCACAG  1042

seq1  TATTTGTAATGTTTGCAGTTTCTCAAACACGCAGTGCTGTCATAAGCCTT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTGTAATGTTTGCAGTTTCTCAAACACGCAGTGCTGTCATAAGCCTT  1092

seq1  CACACATGTTTCGCTCCTCTGGAATTC  1120
      |||||||||||||||||||||||||||
seq2  CACACATGTTTCGCTCCTCTGGAATTC  1119

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information